Application of Aeu8-dsRNA in controlling Meloidogyne enterolobii

Through nanopreparations combined with Aeu8 gene dsRNA and nanocarrier SPc, the problem of delivery stability of RNA biopesticides in plant nematodes is solved, and the effect of preventing and controlling elephant bean root knot nematodes is significantly improved, and a new prevention and control method is provided.

CN119876170BActive Publication Date: 2025-08-01INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510369492.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-27
Publication Date
2025-08-01
Estimated Expiration
2045-03-27

AI Technical Summary

Technical Problem

The stability of existing RNA biopesticides in delivery to plant nematodes has affected its commercial application. How to effectively deliver exogenous dsRNA to plant nematodes is a key difficulty.

Method used

Complex nanopreparations were prepared by combining the Aeu8 gene dsRNA of elephant ceramate and nanocarrier SPc. They were used to prevent and control elephant ceramate and use nanocarrier SPc to improve the penetration ability and RNAi efficiency of dsRNA.

Benefits of technology

The effect of preventing and controlling elephant ceramate nematodes has been significantly improved, and a new combination of target genes and biopesticide nanopreparations has been provided, providing a new method for effectively preventing and controlling elephant ceramate nematodes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876170B_ABST
    Figure CN119876170B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of Aeu8-dsRNA in controlling Meloidogyne enterolobii, belonging to the field of biotechnology. Using Meloidogyne enterolobii as the experimental material, through the in vitro synthesis of dsRNA technology, the gene Aeu8 that can significantly kill Meloidogyne enterolobii was screened. By using the technology of compounding dsRNA with nanomaterials, the dsRNA and the nanocarrier SPc were compounded in a specific ratio to prepare a biological pesticide nano-formulation. Through pot experiment with root irrigation, it was found that compared with the sole use of dsRNA, the purpose of controlling Meloidogyne enterolobii was significantly improved. The present invention provides a new target gene for the screening of drugs for controlling Meloidogyne enterolobii, and provides a new combination of biological pesticide nano-formulations for controlling Meloidogyne enterolobii, thus providing a new method for effectively controlling Meloidogyne enterolobii.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of Aeu8-dsRNA in controlling Meloidogyne enterolobii. Background Art

[0002] Plant-parasitic nematodes (PPN) disease is the second most important crop disease after fungi, causing global crop yield losses of up to 10% - 25% annually, with an economic loss of approximately $173 billion. Among them, root-knot nematodes (Meloidogyne spp.) have become the second largest category of crop diseases, parasitizing more than 5,500 plant species, including food crops, terrestrial vegetables, fruit trees, ornamental plants, and grasses, etc. They are one of the important pathogenic nematodes seriously endangering crop production, causing losses of up to $70 billion to global agricultural production every year and reducing vegetable yields by more than 30%. They are widely distributed geographically, with large genetic variations among and within species and a wide host range, and are listed as the top of the world's ten most important plant-parasitic nematodes. In particular, Meloidogyne enterolobii has extremely strong pathogenicity. Compared with other root-knot nematodes such as Meloidogyne incognita and Meloidogyne hapla, it has a short generation alternation cycle, strong reproductive ability, no overwintering phenomenon, and can infect host plants when the initial inoculation density is only 50 individuals per 500 cm -3 ². Moreover, it has a wide host range, can overcome known disease-resistant genes such as Mi, N, and RK, causing devastating harm to crops. It was listed in the EPPO A2 list in 2010 and has now been recommended as a quarantine species.

[0003] RNA biopesticides utilize the principle of RNA interference (RNAi). By introducing double-stranded RNA (dsRNA) targeting key host genes, they induce the degradation of mRNA of genes related to growth, development, or behavior, thereby specifically hindering the expression of target genes. Biopesticides based on RNAi technology have become recognized green control products for plant pests and diseases due to their high specificity, safety for non-target organisms, easy degradation in the environment, and low resistance formation. They have shown great application prospects in crop quality improvement, pest and disease control, and the screening and identification of new pesticide targets. In the study of RNAi in plant nematodes, the functions of dozens of genes, such as Meloidogyne incognita, M. enterolobii, and M. graminicola, have been successfully studied using the soaking method and plant-mediated method. It was found that after RNAi, the pathogenic and parasitic abilities of root-knot nematodes were significantly reduced, indicating that the RNAi metabolic pathway is widely present and plays a key role in root-knot nematodes. Iqbal et al. silenced 20 key genes in the RNAi pathway of M. incognita using the soaking method. The results showed that after 18 of these genes were silenced, the nematodes showed varying degrees of paralysis, abnormal behavior, or abnormal movement. This indicates that it is feasible to develop new control technologies for root-knot nematodes targeting highly efficient RNAi lethal target genes. Although many studies have shown that RNA biopesticides have strong application prospects, their stability seriously affects commercial application. How to effectively deliver exogenous dsRNA into plant nematodes is one of the key difficulties that need to be solved currently.

[0004] The star polycation (SPc) constructed by China Agricultural University, as a plant-derived pesticide adjuvant, can significantly improve the physicochemical properties of pesticides, enhance the control effects of matrine, d-limonene, and pyrethrins on pests, and extend the effective period of the drugs. Research has shown that nanocarriers can be used for the delivery of biopesticides such as dsRNA, enhancing the ability of dsRNA to penetrate the body wall of pests and improving the RNAi efficiency. They can also be formulated into spray pesticides convenient for field operations, showing broad application prospects in the field of pest control. The dsRNA complexed with nanomaterials improves the gene silencing effect of traditional dsRNA and can more effectively regulate the growth and development process of pests, laying a strong foundation for the establishment of a safe, green, and highly targeted pest control technology. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of Aeu8-dsRNA in controlling M. enterolobii to solve the problems existing in the above-mentioned prior art. The composite nanocomposite prepared by complexing the dsRNA of the Aeu8 gene of M. enterolobii with the nanocarrier SPc can significantly improve the control effect on M. enterolobii.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an Aeu8 gene of Meloidogyne enterolobii, and the nucleotide sequence of the Aeu8 gene is shown in SEQ ID NO.1.

[0008] The present invention also provides a protein encoded by the Aeu8 gene.

[0009] The present invention also provides dsRNA of the Aeu8 gene, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.2.

[0010] The present invention also provides an application of the dsRNA or a composite nano - preparation constructed by combining the dsRNA with a nano - carrier SPc in controlling Meloidogyne enterolobii.

[0011] Optionally, the application is to directly kill Meloidogyne enterolobii by feeding the dsRNA into the body of Meloidogyne enterolobii, or to inhibit the reproduction or pathogenesis of Meloidogyne enterolobii, so as to achieve the purpose of controlling Meloidogyne enterolobii.

[0012] The nano - carrier Spc is a star - shaped cationic polymer, and its chemical structural formula is:

[0013] , where n is an integer from 1 to 100.

[0014] The preparation method of the nano - carrier Spc is prepared with reference to the literature "A Facile - Synthesized Star Polycation Constructed as a Highly Efficient Gene Vector in Pest Management".

[0015] Optionally, in the composite nano - preparation, the mass ratio of the dsRNA to the nano - carrier SPc is 1:1.

[0016] The present invention also provides a biological pesticide for controlling Meloidogyne enterolobii, which contains the dsRNA or a composite nano - preparation constructed by combining the dsRNA with a nano - carrier SPc, and the mass ratio of the dsRNA to the nano - carrier SPc in the composite nano - preparation is 1:1.

[0017] The present invention also provides a method for controlling Meloidogyne enterolobii, which includes the following steps: using the dsRNA or a composite nano - preparation constructed by combining the dsRNA with a nano - carrier SPc to control Meloidogyne enterolobii by (1) soaking Meloidogyne enterolobii or (2) irrigating the roots of plants infected with Meloidogyne enterolobii;

[0018] Among them, the mass ratio of dsRNA to the nano-carrier SPc in the composite nano-formulation is 1:1.

[0019] The present invention discloses the following technical effects:

[0020] Taking the root-knot nematode of Enterolobium cyclocarpum as the experimental material, through the in vitro synthesis of dsRNA technology, the gene Aeu8 that can significantly kill the root-knot nematode of Enterolobium cyclocarpum is screened and obtained. By using the compounding technology of dsRNA and nano-materials, dsRNA and the nano-carrier SPc are compounded in a specific ratio to prepare a biological pesticide nano-formulation. Through the pot experiment of irrigation at the root, it is found that compared with the single use of dsRNA, the purpose of preventing and controlling the root-knot nematode of Enterolobium cyclocarpum is significantly improved. The present invention provides a new target gene for the screening of drugs for preventing and controlling the root-knot nematode of Enterolobium cyclocarpum, and provides a new combination of biological pesticide nano-formulations for preventing and controlling the root-knot nematode of Enterolobium cyclocarpum, and provides a new method for effectively preventing and controlling the root-knot nematode of Enterolobium cyclocarpum. Brief Description of the Drawings

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0022] Figure 1 It is the electrophoresis result of in vitro synthesis of dsRNA; M: DNA marker DL2000; 1: egfp gene; 2: Smg2 gene; 3: Aeu8 gene; 4: ego1 gene; 5: 2242 gene;

[0023] Figure 2 It is the relative lethality rate of 1 mg / mL dsRNA of different genes;

[0024] Figure 3 It is the relative lethality rate after the compounding of Aeu8 dsRNA and the nano-material SPC;

[0025] Figure 4 It is the amplification result of the L4440-Aeu8 gene fragment; M: DNA marker DL2000; 1: Aeu8 gene;

[0026] Figure 5 It is the expression situation of Aeu8 gene dsRNA; M: DNA marker DL2000; 1: Aeu8 gene dsRNA;

[0027] Figure 6 It is the acid fuchsin staining situation of tomato roots after 10 days;

[0028] Figure 7 This is the statistical result of the number of nematodes in tomato roots with different treatments after 10 days;

[0029] Figure 8 This is the indigo dyeing of tomato roots after 45 days;

[0030] Figure 9 This is the statistical result of tomato root disease index after 45 days. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] Example 1

[0037] 1. Materials and Methods

[0038] 1.1 Test nematodes and plant materials

[0039] Test nematode material: Meloidogyne enterolobii was propagated in the laboratory greenhouse. Mature egg masses were collected and placed in sterile water, and second-stage larvae were collected after hatching in an incubator at 28 °C for inoculation.

[0040] Test plant material: The tomato variety Maofen 802 was selected as the potted plant experimental material. First, tomato seeds were placed in a Petri dish, covered with moist kitchen paper towels, and placed in the dark at 25 °C for germination. After 5 days, the germinated seedlings were transferred to sterilized sandy soil in disposable plastic cups. The tomato potted plants were placed in the greenhouse for cultivation at a temperature of 25 ± 2 °C, a relative humidity of 65 ± 5%, and a light cycle of light (L): dark (D) of 16 h: 8 h. After about one month, when the tomatoes had grown four true leaves, an inoculation and root irrigation experiment was carried out.

[0041] 1.2 Strains and plasmids

[0042] Viral vector: The L4440 vector was donated by China Agricultural University.

[0043] Strains: Escherichia coli (E. coli) HT115(DE3) was donated by China Agricultural University; the E. coli DH5α strain was preserved in our laboratory.

[0044] 1.3 Preparation of related solutions

[0045] LB (Luria-Bertani) medium: Yeast extract 5 g / L, tryptone 10 g / L, NaCl 10 g / L;

[0046] 150 mM NaCl: NaCl 8.77 g / L.

[0047] 1.4 High-throughput RNAi target screening and verification

[0048] 1.4.1 Amplification of dsRNA synthesis template

[0049] 1.4.1.1 Primer design

[0050] The genomes of higher animals, plants, and root-knot nematodes were subjected to Blast alignment analysis to obtain genes unique to root-knot nematodes. These genes were then aligned with the RNAi interference phenotype database of Caenorhabditis elegans genes to obtain genes with high RNAi efficiency and lethal phenotypes. Subsequently, the above genes were screened to obtain high-efficiency RNAi target genes of Meloidogyne enterolobii.

[0051] According to the obtained potential lethal gene sequence of *Meloidogyne enterolobii*, specific primers containing siRNA fragments were designed using Primer Premier 5.0 software and the siDirect version 2.0 website, and a T7 promoter sequence (underlined) was added in front of the specific primers. At the same time, the exogenous gene enhanced green fluorescent protein eGFP was used as a control, and primers eGFP-T7-F and eGFP-T7-R were designed. Partial primer sequences are shown in Table 1.

[0052] Table 1 Primers for dsRNA template synthesis

[0053]

[0054] Note: (The underlined base sequence is the T7 promoter).

[0055] 1.4.1.2 PCR amplification and product purification

[0056] Using *Meloidogyne enterolobii* cDNA and pcambia35s-gfp plasmid as templates, templates for the synthesis of dsRNA of *Meloidogyne enterolobii* and GFP gene were amplified respectively. The specific reaction system is shown in Table 2 below:

[0057] Table 2 Reaction system

[0058]

[0059] The PCR reaction program was: 98℃ for 5 min; 98℃ for 10 sec, 64 / 60℃ for 5 sec, 72℃ for 30 sec, 35 cycles; 72℃ for 10 min; 4℃ hold.

[0060] The above amplified products were purified using a PCR product purification kit (Beijing Tiangen Biochemical Company). The specific steps were referred to the kit instruction manual, and the concentration of the purified products was detected using NanoDrop 2000 and stored at -20℃.

[0061] 1.4.1.3 In vitro reverse transcription synthesis of dsRNA and purification

[0062] Using the purified DNA in 1.4.1.2 above as a template, in vitro transcription was carried out using the T7 RNAi Transcription Kit (Vazyme). The specific steps are as follows:

[0063] Table 3 In vitro transcription system

[0064]

[0065] After mixing the reactants, incubate them in a PCR instrument at 37 °C for 16 h. After taking out the product, add 30 µL of DEPC water and 2 µL of Dnase Ⅰ, and react at 37 °C for 15 min to remove DNA.

[0066] Purify the synthesized dsRNA above. The specific steps are as follows:

[0067] (1) Add 80 µL of the product to 200 µL of ddH2O, then add 200 µL of phenol:chloroform:isoamyl alcohol = 25:4:1, shake and mix well for 15 sec, and centrifuge at 12000 rpm for 10 min;

[0068] (2) Take the supernatant into a new centrifuge tube, add 20 µL of 3M NaAC (PH = 5.2) and 400 µL of EtOH;

[0069] (3) Centrifuge at 12000 rpm for 1 min at 4 °C, and place it at -20 °C for precipitation for at least 2 h;

[0070] (4) Centrifuge at 12000 rpm for 10 min at 4 °C, discard the supernatant, add 1 ml of 75% ethanol, wash the precipitate 2 times at 4 °C, and discard the supernatant;

[0071] (5) Let the precipitate dry at room temperature, and dissolve it by adding 30 µL of ddH2O;

[0072] (6) Detect the concentration of the purified product, and take 2 µL of the product to detect the quality of dsRNA by 1.0% agarose gel electrophoresis.

[0073] 1.4.2 In vitro RNAi

[0074] Collect freshly hatched second-stage larvae of Meloidogyne enterolobii, wash them twice with DEPC water first, then wash them twice with 1×PBS buffer and store them in this solution. The reaction solution is shown in Table 4 below:

[0075] Table 4 Reaction solution

[0076]

[0077] Treat them at 28 °C under dark conditions at 100 rpm for 24 h. There are 200 nematodes in each treatment. Use eGFP dsRNA as a negative control. Calculate the lethality after 24 h. Screen out the genes with a lethality rate of more than 70% against the second-stage larvae of Meloidogyne enterolobii at a dsRNA concentration of 1 mg / mL.

[0078] 1.5 Construction of RNAi-Aeu8 interference vector

[0079] An efficient RNAi target gene Aeu8 of Meloidogyne enterolobii with a lethal phenotype was obtained through in vitro RNAi screening. According to the Aeu8 gene sequence, a pair of specific primers were designed with Xba I and Xho I restriction sites at both ends (as shown in Table 5), and the target fragment was amplified respectively. Then, the PCR amplification products were detected by 1% agarose gel electrophoresis and the fragments were recovered. The target fragment and the vector plasmid were digested with enzymes respectively and constructed into the L4440 vector.

[0080] Table 5 Primer information for Aeu8 gene fragment

[0081]

[0082] Note: The underlined bold italic part is the restriction site.

[0083] Xba I and Xho I enzymes were selected for double digestion. After 2 h at 37 °C, 1% agarose electrophoresis was carried out, and the target band was recovered. The recovered product fragments were stored at -20 °C for later use. The digestion system is shown in Table 6.

[0084] Table 6 Digestion system

[0085]

[0086] After double digestion and gel recovery of the L4440 vector and the Aeu8 fragment, the ligation step was carried out according to the T4 ligase instruction manual. The ligation reaction system is shown in Table 7 below.

[0087] Table 7 Ligation reaction system

[0088]

[0089] Reaction conditions: overnight at 4 °C (more than 8 hours). Then it was transferred into DH5α, spread on an LB plate containing ampicillin (AMP), single colonies were picked, colony PCR was detected with primers L4440-T7-F / R, sequenced and analyzed. After verification, the bacteria were shaken to extract the plasmid.

[0090] 1.6 Preparation of competent cells of Escherichia coli (E. coli) HT115(DE3)

[0091] The Escherichia coli HT115(DE3) strain used in the laboratory was a gift from China Agricultural University. The strain itself carried tetracycline resistance. The method for preparing competent cells was referred to the method provided by Dr. Timmons in the United States. The steps are as follows:

[0092] (1) Pick a single colony of Escherichia coli HT115(DE3) and inoculate it into 5 mL of LB liquid medium (containing tetracycline (Tet+), final concentration 12.5 μg / mL), and culture it overnight with shaking at 37 °C.

[0093] (2) Inoculate into 25 mL of LB liquid medium (Tet+) at a volume ratio of 1:100 the next day, and culture with shaking at 37 °C.

[0094] (3) When the OD 600 is approximately 0.4, centrifuge the bacterial solution at 4 °C and 3000 rpm for 10 min.

[0095] (4) Discard the supernatant, add pre-cooled sterile 50 mM CaCl2 equivalent to 1 / 2 volume (12.5 mL) of the original culture, and gently pipette up and down to mix evenly to resuspend the precipitate.

[0096] (5) Incubate on ice for 30 min, then centrifuge at 4 °C and 3000 rpm for 10 min.

[0097] (6) Discard the supernatant, add pre-cooled sterile 50 mM CaCl2 equivalent to 1 / 10 volume (2.5 mL) of the original culture, then add the corresponding volume of 75% sterilized glycerol to make its final concentration 10%, gently pipette up and down to mix evenly, quickly freeze on ice, aliquot (150 µL / tube), and store at -80 °C in the refrigerator for later use.

[0098] 1.7 Transformation of competent cells of Escherichia coli (E. coli) HT115 (DE3)

[0099] The transformation method of competent cells of Escherichia coli HT115 (DE3) is slightly different from that of competent cells of DH5a. The specific method is as follows:

[0100] (1) Add 1 µL of recombinant interfering vector plasmid to 100 µL of competent cells and incubate on ice for 30 min.

[0101] (2) Place the centrifuge tube in a circulating water bath at 42 °C for 1 min.

[0102] (3) Quickly transfer the tube to an ice bath for 2 min.

[0103] (4) In a laminar flow hood, add 1 mL of LB liquid medium to each tube and culture in a shaker at 37 °C for 1 h.

[0104] (5) Transfer the LB liquid medium containing the transformed competent cells to a double-antibody LB solid medium plate containing Amp and Tet (the final concentration of Amp is 50 µg / mL, and the final concentration of Tet is 12.5 µg / mL).

[0105] (6) Place the plate in a laminar flow hood until the surface bacterial solution is absorbed, then invert the plate and culture at 37 °C.

[0106] After single colonies grow on the plate, pick monoclonal colonies and inoculate them into 5 mL of LB medium (Amp+Tet), culture overnight, extract plasmids, and perform restriction enzyme digestion identification. Save the correctly identified recombinant vector for future use.

[0107] 1.8 Induced expression of dsRNA

[0108] Inoculate the correctly identified bacteria into 15 mL of LB medium (Amp+Tet), culture overnight at 37°C with shaking at 220 r / min. Take the overnight culture broth and inoculate it into 100 mL of LB liquid medium (Amp+Tet) at a volume ratio of 1:100, culture at 37°C with shaking at 220 r / min for about 3 h until the OD of the broth 600nm is 0.4 - 0.45; add IPTG treated by filtration to a final concentration of 1 mmol / L, continue shaking culture for 4 h; collect the broth for extracting dsRNA in HT115(DE3).

[0109] 1.9 Extraction of dsRNA in Escherichia coli HT115(DE3) by ethanol fixation method

[0110] (1) Concentrate 5 mL of the induced broth to 1 mL, and incubate in a water bath at 80°C for 20 min.

[0111] (2) Centrifuge at 6000 rpm for 5 min at 4°C, discard the supernatant.

[0112] (3) Add 250 μL of 75% absolute ethanol (prepared with PBS), mix quickly, and let stand at room temperature for 5 min.

[0113] (4) Centrifuge at 10000 rpm for 5 min at 4°C, discard the supernatant.

[0114] (5) Resuspend the cells with 50 μL of 150 mM NaCl solution and let stand at room temperature for 1 h.

[0115] (6) Centrifuge at 12000 rpm for 5 min at 4°C to obtain the supernatant. Detect the size of the target band by agarose gel electrophoresis. After diluting the solution 5 times, use Nanodrop 2000 to detect the product concentration.

[0116] Absorb 20 μL of the crude dsRNA extract, add 1 U of RNase-Free DNase and RNase A Solution with a final concentration of 2 ng / μL, and incubate at 37°C for 10 min to remove double-stranded DNA and single-stranded RNA therein.

[0117] 1.10 Nematode hatching and plant inoculation methods

[0118] Pick mature egg masses from the root knots and transfer them into a cell strainer. Then place the cell strainer in sterile water and incubate it in an incubator at 28 °C for single egg mass hatching. After 72 h, collect the J2 larvae with higher viability, make them into a nematode suspension of 50 individuals / mL, and inoculate the nematodes onto the roots of tomato seedlings. Add 10 mL of the nematode suspension to each seedling. Cultivate the inoculated tomatoes under greenhouse conditions at a temperature of 28 °C.

[0119] When the tomato seedlings have grown four true leaves, inoculate dsRNA at a concentration of 0.5 mg / mL onto the roots of the tomato potted plants, and simultaneously introduce 10 mL of the above-mentioned nematode suspension. There are two treatment groups, namely dsRNA and dsRNA / SPc nanoparticles. Use the inoculation of second-stage larvae of *Meloidogyne enterolobii* alone as a control. Inoculate 500 worms for each treatment and repeat three times. After 10 days, stain and count the number of third-stage larvae, and after 45 days, count the number of root knots and observe and calculate the control effect.

[0120] The above-mentioned dsRNA / SPc nanoparticles are prepared by compounding dsRNA of the Aeu8 gene and the nanomaterial SPc at a mass ratio of dsRNA:SPc = 1:1. Structural characteristics of the nanocarrier SPc: It is a dendrimer and is functionalized with amino functional groups. The structural formula is shown below, and the value of n is 1 - 100.

[0121] 。

[0122] 1.11 Statistical analysis of control effect in pot experiment

[0123] After 45 days of inoculation, take out the tomato plants in the pots, record and count the fresh weight of the roots and the number of root knots of the tomato plants, and use the grading standard of Bridge & Page to count the disease levels. The root knot grading standard is as follows:

[0124] Grade 0: No root knots;

[0125] Grade 1: The content of root knots on the root system is less than 1 / 5 and the root knots are not connected to each other;

[0126] Grade 2: The content of root knots on the root system is between 1 / 5 and 2 / 5, and a small number of root knots are connected to each other;

[0127] Grade 3: The content of root knots on the root system is between 2 / 5 and 3 / 5, and the number of connected root knots is less than 1 / 2;

[0128] Grade 4: The content of root knots on the root system is between 3 / 5 and 4 / 5, and the number of connected root knots is greater than 1 / 2, and some main and lateral roots become thick or even deformed;

[0129] Grade 5: The content of root knots on the root system is more than 4 / 5, and the root knots are connected to each other, and most main and lateral roots are deformed.

[0130] The control effect is calculated according to the following formula:

[0131] Disease index = × 100;

[0132] Control effect = × 100%.

[0133] 2. Results and Analysis

[0134] 2.1 dsRNA Synthesis

[0135] Using the cDNA of *Meloidogyne enterolobii* as a template, PCR amplification was carried out with primers containing the recognition sequence of T7 transcriptase to amplify the target fragment of the potential lethal gene of *Meloidogyne enterolobii*. After purifying the amplified fragment, in vitro transcription was performed using the T7 RNAi Transcription Kit (Vazyme) to synthesize dsRNA (see Figure 1 ). After precipitation and purification with isopropanol, the concentration of dsRNA measured by a micro-spectrophotometer was between 10 mg / mL and 19 mg / mL, which could be used for the subsequent soaking experiment of second-stage larvae of nematodes.

[0136] 2.2 In Vitro RNAi

[0137] The lethality of the potential lethal gene of *Meloidogyne enterolobii* was verified by the in vitro soaking method. When the concentration of one dsRNA was 1 mg / mL, the lethality rate of the second-stage larvae of *Meloidogyne enterolobii* was above 70% for the lethal gene Aeu8 (see Figure 2 ).

[0138] After mixing the dsRNA of the Aeu8 gene with the nanomaterial SPc at a mass ratio of dsRNA:SPc = 1:1 and soaking the second-stage larvae of *Meloidogyne enterolobii* in vitro again, the results showed that after the dsRNA was mixed with the nanomaterial SPc, the relative lethality rate was 24.21% higher than that of the single dsRNA (see Figure 3 ).

[0139] 2.3 Construction of L4440-Aeu8 Vector

[0140] The L4440 expression vector used in this experiment has a bidirectional T7 promoter inside. The target gene fragment can be inserted between the bidirectional T7 promoters through the internal restriction enzyme sites. Under the induction of IPTG, the two reverse T7 promoters play a role and can form complementary dsRNA molecules. The engineering strain HT115 has Tet resistance itself and lacks RNase III-like endonuclease in vivo. Therefore, the dsRNA expressed by L4440 in the bacteria can maintain the form of large fragments.

[0141] According to the Aeu8 sequence information, primers were designed and used to amplify the target gene fragment (see Figure 4 ).

[0142] The cloned target fragment was digested with Xba I and Xho I, and then ligated into the L4440 vector to form the L4440-Aeu8 vector. After verification by PCR amplification and DNA sequencing, it was found that the sequence was completely consistent with the target fragment sequence. Then, the verified positive plasmid was transformed into Escherichia coli HT115(DE3) for the induced expression of dsRNA.

[0143] 2.4 Extraction of dsRNA

[0144] The correctly sequenced monoclonal was added to the LB medium, and IPTG (final concentration about 1 mM) was added for induction, and then the bacteria were collected. The dsRNA was extracted by ethanol precipitation to detect the expression of dsRNA (see Figure 5 ). A large amount of dsRNA about 256 bp was found by electrophoresis.

[0145] 2.5 Statistical analysis of the control effect of dsRNA on tomato potted plants after 10 d

[0146] The dsRNA was mixed with the suspension of Meloidogyne enterolobii at a concentration of 0.5 mg / mL and inoculated onto the roots of tomato potted plants. There were two treatment groups, namely dsRNA and dsRNA / SPc nanoparticles, with the inoculation of the second-stage larvae of Meloidogyne enterolobii alone as the control. 500 worms were inoculated in each treatment, with three replicates. After 10 d, the tomato roots were stained with acid fuchsin. The results are as Figure 6 shown. After statistics, the number of nematodes in the control group with only nematode inoculation was 50% more than that in the dsRNA treatment group alone, and 57.31% more than that in the dsRNA / SPc nanoparticle treatment group (see Figure 7 ).

[0147] 2.6 Statistical analysis of the control effect of dsRNA on tomato potted plants after 45 d

[0148] The dsRNA was mixed with the suspension of Meloidogyne enterolobii at a concentration of 0.5 mg / mL and inoculated onto the roots of tomato potted plants. There were two treatment groups, namely dsRNA and dsRNA / SPc nanoparticles, with the inoculation of the second-stage larvae of Meloidogyne enterolobii alone as the control. 500 worms were inoculated in each treatment, with three replicates. After 45 d, the root knots of the tomato roots were stained with food indigo (see Figure 8 ), and the disease index of the roots was statistically analyzed (see Figure 9 The control efficacy was calculated. After calculation, the control efficacy of dsRNA alone was 55.55%, and that of the dsRNA / SPc nanoparticle was up to 66.67%. ).

[0149] Aeu8 target gene fragment (SEQ ID NO.1):

[0150] CCGTCGTTAT GAGCCTAAATCTGACTTAGTCGAAATGTTAACAACACAAACACCTTGGGCAGGTATAGAACCATTTGCCATTCATG TCAGAACTATGCCAGAACCGTCATTGCCTAATGGACTTTCTTTGGCATTAATTGAAGCGATTAATTTAATGTTAAA AAGAAAACTTGAGGAAAGGCCAACAGCCCTAGAATTACTTGGAATTAAACCATTTTGTAGTTCTGATGAACGATTA GATGTAGTAGAGGAGGCA AAGGAAGGGAGAGGAGTGATTTTGAAAATTGTTAAAATGGAAATGTTTTCTTCTTTAGTAGAAAATGTTCAAAATATATCTGAAAATATGCTTTCAGGTATTAATATAATACAACCAAAAGAGGAACAAAAAATAGCTAGTCTGGTTTCAAATTTTTACAGACAAATTAGTACTCGTGAGGATATTCAGAATCTTTTGACAAAGTATCAACTCCAACTTTTTCAAATAAAAGAAGTAAATTCAGAAACTATTAGACAAGCAAATATTTGTTCAACTCGAATGGGTAGAGTACAGCAAACTTTAAGGTAA。

[0151] The underlined part of the above sequence is the dsRNA of the Aeu8 gene (SEQ ID NO.2).

[0152] The embodiments described above are only descriptions of the preferred modes of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of a composite nanomedicine constructed by dsRNA combined with a nanocarrier SPc in preventing and controlling Meloidogyne enterolobii, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID NO.2; the mass ratio of the dsRNA to the nanocarrier SPc is 1:

1.

2. The application according to claim 1, characterized in that The application is that the composite nanoplatform is ingested into the body of *Meloidogyne enterolobii*, directly killing *Meloidogyne enterolobii* or inhibiting the pathogenesis of *Meloidogyne enterolobii*, so as to achieve the purpose of controlling *Meloidogyne enterolobii*.

3. A biological pesticide for preventing and controlling Meloidogyne enterolobii, characterized in that, It contains a composite nanoplatform constructed by combining dsRNA with the nanocarrier SPc. In the composite nanoplatform, the mass ratio of dsRNA to the nanocarrier SPc is 1:1, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.

2.

4. A method for preventing and controlling Meloidogyne enterolobii, characterized in that, It includes the following steps: Using the composite nanoplatform constructed by combining dsRNA with the nanocarrier SPc to control *Meloidogyne enterolobii* by means of (1) soaking *Meloidogyne enterolobii* or (2) irrigating the roots of plants infected with *Meloidogyne enterolobii*. Among them, the mass ratio of dsRNA to the nanocarrier SPc in the composite nanoplatform is 1:1; the nucleotide sequence of the dsRNA is shown in SEQ ID NO.2.

Citation Information

Patent Citations

  • Nano-RNA (Ribonucleic Acid) preparation for targeting growth and development of aphis gossypii gossypii and chitin synthesis

    CN118064430A