Transcription factor AbHY5 for regulating and controlling formation of colorful leaf color of golden-edge red-bud pineapple and application of transcription factor AbHY5

Abstract

The invention discloses a transcription factor AbHY5 for regulating and controlling formation of colorful leaf colors of a golden-edge red-bud pineapple and application of the transcription factor AbHY5. The optical signal transcription factor AbHY5 is obtained by cloning in the golden-edge red-bud pineapple, the expression of the transcription factor has obvious tissue specificity, and the transcription factor is specifically expressed in petals and red leaves; researches show that the AbHY5 promoter responds to light induction, the expression level of AbHY5 is remarkably reduced under the dark condition, and AbHY5 expression has extremely remarkable positive correlation with the content of anthocyanin, flavonoid, cane sugar and starch. Further, transgenic technology research shows that overexpression of AbHY5 significantly promotes synthesis of pigments and flavonoids of transgenic plants, accumulation of endogenous sucrose and starch and ROS balance in leaves, can increase the content of flavonoids, chlorophyll a, anthocyanin and carotenoid, increases the photosynthetic rate of plant leaves, and provides support for cultivation of new varieties of pineapple with multiple leaf colors.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and more specifically, relates to a transcription factor AbHY5 for regulating the formation of colorful leaf colors of golden-edged red-bract pineapple and its application. Background Art

[0002] The leaves of Ananas comosus var. bracteatus are green and white, forming golden stripes. In spring and autumn, the albino tissue on the edge of the leaves will appear bright red, forming a green / white / red colorful leaf color, which is of great ornamental and economic value. Compared with flowering plants, foliage plants have a longer viewing period and are more capable of improving the urban ecological environment. However, compared with flowering plants, there are fewer species of colorful foliage plants. Therefore, researching and cultivating colorful leaf ornamental plant resources with high ornamental value can provide strong support for the high-quality construction of urban human settlement ecological environment.

[0003] The mosaic leaves of golden-edged red-bristled pineapple have rich color changes and are excellent ornamental plant resources. The central green tissue of its leaves contains a large amount of chlorophyll and carotenoids, while anthocyanins account for a very small proportion. The marginal albino tissue turns white due to abnormal chloroplast development and blocked chlorophyll synthesis, forming the "golden edge" trait. In spring and autumn, the epidermal cells of the marginal albino tissue accumulate a large amount of anthocyanins, making the leaves appear red. The leaves of golden-edged red-bristled pineapple can specifically synthesize and accumulate chlorophyll, carotenoids and anthocyanins in different time and space, showing a variety of color types; the dynamic changes in its color are the result of the synergistic competition relationship between the accumulation of chlorophyll, carotenoids and anthocyanins in time and space, and are ideal materials for studying the mechanism of pigment synergistic competition accumulation. Chlorophyll and carotenoids are important photosynthetic pigments in plants, which have the functions of light capture and photooxidation protection under high light, while anthocyanins are important antioxidant substances and stress response signals in plants. The formation and change of plant leaf color is determined by the changes in the content and relative proportions of the three major pigments, and is also an adaptation to environmental factors. In the mosaic leaves of golden-edged red-bristled pineapple, the central green tissue and the edge white tissue have different tissue structures and physiological characteristics, and the distribution patterns of pigments are also completely different. The dynamic balance of the three major types of pigments is of great significance to the growth, development and trait expression of leaves and plants. Therefore, identifying the common key regulatory factors upstream of the three major pigment metabolism accumulation and exploring the function of key regulatory factors in regulating pigment synthesis accumulation are of great significance for revealing the regulation mechanism of pigment synthesis accumulation and directing the cultivation of new leaf color varieties.

[0004] The light signal factor HY5 is at the center of plant signal transduction, and its regulatory function in the metabolic accumulation of the three major pigments has been widely reported, but these studies are mainly focused on fruits, and there are few reports that HY5 can simultaneously regulate the synthesis of two or more pigments in plants. Since plant leaves rarely accumulate anthocyanins, there are few reports on the mechanism of the coordinated competition between photosynthetic pigments and anthocyanins in leaves for synthesis and accumulation. Summary of the invention

[0005] The present invention provides a transcription factor AbHY5 for regulating the formation of colorful leaf colors of golden-edged red-bract pineapple and an application thereof.

[0006] The purpose of the present invention is to provide a transcription factor AbHY5 for regulating the formation of colorful leaf colors of golden-edged red-bract pineapple and its encoding protein.

[0007] Another object of the present invention is to provide the application of the transcription factor AbHY5 or its expression promoter, or the encoded protein.

[0008] Another object of the present invention is to provide a recombinant expression vector and a genetically engineered bacterium.

[0009] Another object of the present invention is to provide a product for improving the photosynthetic efficiency of plants.

[0010] Another object of the present invention is to provide a method for promoting the synthesis of pigments in plant leaves or improving the photosynthetic efficiency of plants.

[0011] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0012] The present invention cloned a light signal transcription factor AbHY5 for the first time in the transcriptome data of golden-edged red-bract pineapple, the nucleic acid sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2. Studies have shown that the expression of AbHY5 has obvious tissue specificity, specifically expressed in petals and red leaves, and the expression level of AbHY5 is extremely significantly positively correlated with the content of anthocyanins, flavonoids, sucrose and starch. In addition, the present invention reveals the effect of pigment synthesis accumulation on leaf color formation. The expression level of AbHY5 in both tissues of dark red leaves is significantly higher than that of non-red and light red leaves, and the expression level in the edge albino tissue is significantly higher than that of the corresponding central green tissue, which is consistent with the result that the content of anthocyanins in the edge albino tissue is significantly higher than that in the central green tissue; the promoter activity characteristics of AbHY5 are also analyzed, showing that the AbHY5 promoter responds to light induction, and the expression level of AbHY5 decreases significantly under dark conditions.

[0013] At the same time, the function of AbHY5 in regulating the synthesis of three major types of pigments was verified by transgenic technology. Overexpression of AbHY5 can not only reduce the yellowness of transgenic tobacco leaves, but also significantly promote the synthesis rate of flavonoids in Nicotiana benthamiana, the accumulation of endogenous sucrose and starch, increase the content of pigments such as flavonoids, chlorophyll a, anthocyanins, and carotenoids, and improve the photosynthetic rate of tobacco leaves and the ability of transgenic tobacco non-enzymatic system to remove ROS, thereby promoting the balance of ROS in tobacco leaves. In summary, the research results of the present invention show that the light signal transcription factor AbHY5 of golden-edged red-shell pineapple can be used to regulate the synthesis of anthocyanins, chlorophyll, and carotenoids in red-shell pineapple leaves, provide support for explaining the synergistic competitive relationship and regulatory mechanism of the three major pigments of golden-edged red-shell pineapple, and provide a theoretical basis for the cultivation of new leaf color varieties.

[0014] Therefore, the present invention provides the following applications of the transcription factor AbHY5 of golden-edged red-bract pineapple or its expression promoter, or its encoded protein:

[0015] Application in promoting pigment synthesis in plant leaves and promoting the expression of structural genes related to pigment synthesis.

[0016] Furthermore, the pigment synthesis-related structural gene is anthocyanin synthesis structural gene, preferably AbCHS, AbCHI, AbDFR, AbF3'5'H and other genes.

[0017] Application in improving plant photosynthetic efficiency.

[0018] Application in promoting the synthesis of plant flavonoids or increasing the content of plant flavonoids.

[0019] Application in increasing the content of pigment, sucrose and / or starch in plant leaves.

[0020] Application in improving the ability of non-enzymatic systems in plants to remove ROS or in promoting the balance of ROS in plant leaves.

[0021] Application in breeding new varieties of plants with multiple leaf colors.

[0022] Application in constructing transgenic plants with altered leaf color.

[0023] Furthermore, the plants are golden-edged red-bristled pineapple and tobacco.

[0024] The invention provides a recombinant expression vector containing the transcription factor AbHY5.

[0025] The present invention provides a genetically engineered bacterium comprising the above-mentioned recombinant expression vector.

[0026] The present invention also provides a product for improving plant photosynthetic efficiency, comprising an expression promoter of the transcription factor AbHY5 for regulating the formation of colorful leaf colors of golden-edged red-brimmed pineapple.

[0027] The present invention also provides a method for promoting the synthesis of pigments in plant leaves or improving the photosynthetic efficiency of plants, by transforming the above-mentioned recombinant vector or genetically engineered bacteria into plants, or treating plants with an expression promoter of the transcription factor AbHY5 that regulates the formation of colorful leaf colors of golden-edged red-brimmed pineapple.

[0028] Preferably, an AbHY5 plant overexpression vector is constructed and stably genetically transformed into plants.

[0029] The present invention has the following beneficial effects:

[0030] The present invention cloned the light signal transcription factor AbHY5 in the golden-edged red-brid pineapple for the first time. The transcription factor AbHY5 is related to the formation of colorful leaf colors of the golden-edged red-brid pineapple and is specifically expressed in petals and red leaves. It shows that the AbHY5 promoter responds to light induction, and the expression level of AbHY5 decreases significantly under dark conditions, and the expression level of AbHY5 is extremely significantly positively correlated with the content of anthocyanins, flavonoids, sucrose and starch. At the same time, through transgenic technology research, it is shown that overexpression of AbHY5 significantly promotes the synthesis of transgenic plant pigments and flavonoids, the accumulation of endogenous sucrose and starch, and increases the content of pigments such as flavonoids, chlorophyll a, anthocyanins, and carotenoids, and increases the photosynthetic rate of tobacco leaves and the ability of transgenic tobacco non-enzymatic systems to remove ROS, thereby promoting the balance of ROS in tobacco leaves and increasing the photosynthetic rate of plant leaves, providing support for the cultivation of new varieties of pineapple with multiple leaf colors. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 These are diagrams of different tissue phenotypes of the golden-edged red-bristled pineapple.

[0032] Figure 2 This is the result of electrophoresis detection of the full-length CDS amplified fragment of AbHY5 (Note: M: 2000Maker, 1-6: AbHY5).

[0033] Figure 3 This is the result diagram of subcellular localization of AbHY5 protein.

[0034] Figure 4 The results of anthocyanin content (A) and AbHY5 expression level (B) in different tissues of golden-edged red-brid pineapple (RG is the green tissue in the center of the dark red leaf; RW is the white tissue on the edge of the dark red leaf; FL is the petal; BR is the bract; FR is the flesh).

[0035] Figure 5The expression level results of AbHY5 and related genes in leaves of different color types (Ur is non-red leaves, Cr is dark red leaves, Lr is light red leaves; CG represents central green tissue, MW represents marginal white tissue, the same below).

[0036] Figure 6 P AbHY5 GUS staining of transiently transformed tobacco.

[0037] Figure 7 For dark processing P AbHY5 GUS staining and activity analysis results of transiently transformed tobacco leaves (A: GUS staining analysis under darkness and hormone treatment, ABA is abscisic acid, GA3 is gibberellin; B: GUS enzyme activity analysis under darkness and hormone treatment).

[0038] Figure 8 Pictures of the leaves of the golden-edged red-bristled pineapple under different light treatments (A: 15 days of light; B: 15 days of darkness; C: 15 days of darkness followed by 15 days of light restoration).

[0039] Fig. 9 This is the result of the pigment content in the leaves of golden-edged red-bristled pineapple treated with darkness (A: chlorophyll content; B: carotenoid content; C: anthocyanin content).

[0040] Fig.10 This is the expression level result of AbHY5 under dark treatment.

[0041] Fig.11 Electrophoresis detection result diagram for the construction of AbHY5 overexpression vector (M: 5000Maker; 1: plasmid after double enzyme digestion; 2: recombinant plasmid).

[0042] Fig.12 This is a diagram of the identification results of transgenic tobacco (M: 2000Maker; a: negative control; b: standard plasmid positive control, 1, 3, 6: transgenic plants 2, 4, 5, 7, 8: negative plants).

[0043] Fig.13 The phenotypes of transgenic tobacco plants (the left is the wild-type plant CK, and the right is the transgenic tobacco plant OE-AbHY5).

[0044] Fig.14 This is the result of measuring the pigment content of transgenic tobacco (A: chlorophyll content; B: carotenoid content; C: anthocyanin content; D: flavonoid content).

[0045] Fig.15 This is the result of measuring the sugar content in transgenic tobacco (A: fructose content; B: sucrose content; C: starch content).

[0046] Fig.16 This is the result of measuring photosynthetic indicators of transgenic tobacco (A: net photosynthetic rate; B: stomatal conductance; C: intercellular CO2 concentration; D: transpiration rate).

[0047] Fig.17 The results of DAB staining (A) and H2O2 content (B) of transgenic tobacco.

[0048] Fig.18 The expression levels of transgenic tobacco AbHY5 and pigment synthesis-related genes are shown in Figure 1 (A: AbHY5; B: NbDVR; C: NbPSY; D: NbCHS; E: NbDFR; F: NbF3'H).

[0049] Fig.19 The results of the content of enzymes encoded by NbDVR (A), NbPSY (B), and NbCHS (C) in transgenic tobacco are shown. DETAILED DESCRIPTION

[0050] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0051] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0052] Nicotiana benthamiana seeds were purchased from Beijing Huayueyang Biological Co., Ltd., DH5α Escherichia coli competent cells were purchased from Beijing Qingke Biological Co., Ltd., GV3101 Agrobacterium competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd., and the pCAMBIA-2300-eGFP vector was stored in the -80°C refrigerator of our research group. The fluorescence quantitative PCR kit used was SYBR Green Premix Pro Taq HS QPCR Kit (Aikerui, Nanjing).

[0053] Nucleic acid sequence SEQ ID of light signaling transcription factor AbHY5 NO.1: ATGCAGGATCAAGGTACGAACTCACTTCCATCGAGCAGCGAGAGATCGTCGAGCTCGGCTCCTCAGATGGAAGTCAAAGAAGGAATGACGAGTGACGAGGAAATAGGAAGGGTGCCGG AGCTTGGGCCGTCGGAGGTAGGCGGGCCGTCGACGTCGGGCCGGGATGGTGGGCCGGCTGCTGGGCCGTCCGGCCAGGCCGGGGCCCAGCGTAGGCAGCGCTCCGGGAGGAGCTCCGCCGACAA AGAACACAAGCGGCTCAAAAGGTTGCTGAGGAATCGGGTGTCGGCGCAGCAGGCGAGGGAGAGGAAGAAGGCGTATCTGAACGAGTTGGAGGCCAGAGTGAAGGAGTTGGAGACCAAGAACTCC GAGCTGGAGGAGAGGGTCTCCACCTTGCAGAATGAGAACCAGATGCTCAGACAAATACTGAAGAATACGACAGTTAGCAGAAGAGGATCAAGTAGCAGTGCCAATGTTGGAGAAGGTCCATAG;

[0054] The amino acid sequence of the protein encoded by AbHY5 is SEQ ID NO.2:MQDQGTNSLPSSSERSSSSAPQMEVKEGMTSDEEIGRVPELGPSEVGGPSTSGRDGGPAAGPSGQAGAQRRQRSGRSSADKEHKRLKRLLRNRVSAQQARERKKAYLNELEARVKELETKNSELEERVSTLQNENQMLRQILKNTTVSRRGSSSSANVGEGP.

[0055] Example 1 Phenotypic differences and rules of different color types of golden-edged red-bud pineapple

[0056] Anthocyanins usually appear red in plants, while chlorophyll and carotenoids usually appear green and orange-yellow. The content and proportion of various pigments will directly affect the color of leaves. In order to understand the phenotypic differences and rules of different color types of leaves (dark red leaves, non-red leaves and light red leaves) of golden-edged red-brimmed pineapple, this example studied and analyzed the different color traits of golden-edged red-brimmed pineapple, and detected the content of pigments, sugar substances and flavonoids in leaf tissues of different colors.

[0057] The results showed that chlorophyll was the dominant pigment in the central green tissue of leaves of different colors, accounting for 79.4%-80.9%, carotenoids accounted for 11.3%-15.9%, and anthocyanins accounted for only 4%-9%; anthocyanins were the dominant pigment in the edge white tissue, accounting for 53.5%-92.4%, chlorophyll accounted for 5%-27%, and carotenoids accounted for 2.9%-19.5%. The three major types of pigments in dark red leaves were the highest. The chlorophyll content of the central green tissue was more than 1.4 times that of the non-red leaves, the carotenoid content was about 1.3 times that of the non-red leaves, and the anthocyanin content was about 6 times that of the non-red leaves. The content of chlorophyll a and chlorophyll b accounted for 80% of the total content of the three types of pigments, covering the color of carotenoids and anthocyanins, making the leaves appear green. The chlorophyll and carotenoid contents of the albino tissue at the edge of dark red leaves are lower than those of non-red leaves and light red leaves. The anthocyanin content is the highest, which is 0.32 mg / g, accounting for 92.4% of the total amount of the three major pigments in the albino tissue at the edge, making the leaves appear red.

[0058] At the same time, the dark red leaves have the highest contents of sugars and flavonoids. The sucrose content in the white tissue at the edge of the leaves increases significantly with the deepening of the red color, and is significantly higher than that in the central green tissue. The flavonoid content in the central green tissue is significantly lower than that in the white tissue at the edge, which is consistent with the accumulation of anthocyanins.

[0059] Example 2 Cloning and expression analysis of AbHY5

[0060] 1. Cloning and identification of AbHY5

[0061] The plant material used in the experiment, Golden Edge Red Bract pineapple, was introduced from Zhanjiang, Guangdong, and planted in the greenhouse of Chengdu Campus of Sichuan Agricultural University, with regular watering and fertilization. Figure 1 ) were quickly frozen at -80℃ for storage and used for tissue-specific gene expression determination. RNA from different golden-edged red-bud pineapple tissue samples was extracted using a kit, reverse transcribed into cDNA, and then PCR amplified and gel electrophoresed. Figure 2 The band of about 500 bp shown is clear, without non-specific amplification, and is similar in length to the reference sequence. The amplification results were then sequenced and analyzed, and the sequencing results were spliced ​​on DNAMAN to obtain a sequence of 489 bp in length, the nucleotide sequence of which is shown in SEQ ID NO: 1. The obtained sequence was imported into the NCBI website and compared with Nucleotide BLAST. The comparison analysis showed that the sequence had a homology of up to 94% with pineapple AcHY5, and the sequence was named AbHY5.

[0062] 2. Protein sequence analysis of AbHY5

[0063] Using the ORF Finder and Expasy online tools on the NCBI website, we found that AbHY5 encodes 162 amino acids, of which serine (ser) is the largest at 24, accounting for 14.8%, with 22 negatively charged amino acid residues and 27 positively charged amino acid residues. The total number of atoms in the AbHY5 protein is 2441, and the predicted protein formula is: C 719 H 1214 N 246 O 258 S4, molecular weight is 1.76kDa, theoretical isoelectric point PI is 9.80. The protein instability index is calculated to be 67.13, indicating that AbHY5 is an unstable protein. The overall average hydrophilicity of the protein is -0.6733, belonging to a hydrophilic protein; the protein amino acid sequence of AbHY5 is shown in SEQ ID NO: 2.

[0064] 3. Subcellular localization analysis of AbHY5 protein

[0065] In order to understand the localization of AbHY5 transcription factor in Prunella vulgaris cells, the Agrobacterium-mediated transient transformation of Nicotiana benthamiana leaves was performed. The leaves were cut 48 hours after infection and temporary water mounts were made. The distribution of fluorescence signals in tobacco leaves was observed under a laser confocal microscope to determine the place where AbHY5 functions.

[0066] The results of the test are as follows Figure 3 As shown, the AbHY5 protein with green fluorescence labeling is distributed in the cell nucleus, overlapping with the red fluorescence of the cell nucleus localization Maker, while the control fluorescence signal is distributed throughout the cell. Therefore, it can be seen that the AbHY5 protein is localized in the cell nucleus to further perform its function.

[0067] 4. Analysis of expression patterns of AbHY5 and related genes

[0068] Expression in different tissues: The central green tissue and edge albino tissue, petals, bracts, and fruits of the red leaves of P. chinensis were used as materials to study the expression level of the AbHY5 gene in different tissues of P. chinensis using qRT-PCR technology to understand the tissue specificity of its expression. The specific methods are as follows:

[0069] RNA from different tissue samples was extracted using a kit and reverse transcribed into cDNA. AbHY5 primers (F: CTCCACCTTGCAGAATGAGAACCAG, R: AC ATTGGCACTGCTACTTGATCCTC) were designed and synthesized according to SEQ ID NO: 1. The housekeeping gene Unigene16454 of red-bracted pineapple was used as the internal reference gene (F: TCTCACGCCCTCTTTCTTCCA, R: GCTCTAACTCGCCACGCCT TT). The cDNA of different tissues was used as a template, and the fluorescent quantitative components were added according to the system in Table 1 under light-proof conditions. After adding, they were gently pipetted and mixed. Three technical replicates were set for each biological replicate, and then the detection was carried out according to the procedure in Table 2. Finally, 2 –ΔΔCT The relative expression level of AbHY5 in different tissues of P.

[0070] Table 1 Fluorescence quantitative PCR detection system

[0071]

[0072] Table 2 Fluorescence quantitative PCR detection procedures

[0073]

[0074] Test results such as Figure 4 As shown in the figure, with the central green tissue as the control, the expression level of AbHY5 in the edge albino tissue was significantly higher than that in the central green tissue, which was twice its expression level, which was consistent with the result that the content of anthocyanins in the edge albino tissue was significantly higher than that in the central green tissue ( Figure 4 A). AbHY5 is highly expressed in petals, with the expression level being approximately 15 times higher than that in the central green tissue of leaves ( Figure 4 B), which is consistent with the result that the anthocyanin content in petals is the highest. AbHY5 is almost not expressed in bracts and fruits; it shows that the expression of AbHY5 has obvious tissue specificity and is specifically expressed in petals and red leaves. In addition, the anthocyanin content in red bracts is high, but the expression level of AbHY5 in bracts is low, which is inconsistent with the anthocyanin content, indicating that the bracts may have a different anthocyanin synthesis and accumulation regulation mechanism from petals and leaves.

[0075] Expression in leaves of different color types: Using three color types of leaves of golden-edged red-bridled pineapple (deep red leaves, non-red leaves and light red leaves) as materials, the central green tissue and edge white tissue of the leaves were detected, and the qRT-PCR technology was used to study the expression of AbHY5 and pigment synthesis-related structural genes. The pigment synthesis-related structural genes are anthocyanin synthesis structural genes such as AbCHS, AbCHI, AbDFR, AbF3'5'H, etc. The gene sequences used are shown in Table 3 below, and the qRT-PCR detection method is the same as above.

[0076] Table 3 Pigment synthesis related structural gene sequences

[0077]

[0078] The results are as follows Figure 5 As shown in the figure, the expression level of AbHY5 in the marginal albino tissue was significantly higher than that in the green tissue. The expression level of AbHY5 in both tissues of dark red leaves was significantly higher than that in non-red and light red leaves, and the expression level in the marginal albino tissue was significantly higher than that in the corresponding central green tissue. The expression levels of anthocyanin synthesis structural genes such as AbCHS, AbCHI, and AbDFR in the central green tissue of the three types of leaves were relatively low and did not change significantly, but increased significantly in the marginal albino tissue with the deepening of red, especially the expression levels of AbCHS and AbDFR were 3 times and 4 times that of non-red leaves, respectively. The expression level of AbF3'5'H was the highest in non-red leaves, and it showed a downward trend with the deepening of red.

[0079] 5. Correlation analysis

[0080] IBM SPSS Statistics 27 software was further used to perform Pearson correlation analysis between variables for the data of gene expression levels and physiological indicators. The results are shown in Table 4. In the central green tissue, the expression level of AbHY5 was extremely significantly positively correlated with the content of chlorophyll and anthocyanin, and significantly positively correlated with the content of carotenoids; in the marginal albino tissue, the expression level of AbHY5 was extremely significantly positively correlated with the content of anthocyanin, flavonoids, sucrose and starch, and the content of sucrose and starch was also extremely significantly positively correlated with the content of anthocyanin and flavonoids. The expression level of AbHY5 was negatively correlated with the content of chlorophyll and carotenoids, but not significantly, and was also extremely significantly positively correlated with the expression levels of anthocyanin synthesis structural genes AbCHS and AbDFR.

[0081] Table 4 Pearson correlation analysis of different detection indicators of leaves with different color types

[0082]

[0083] Note: The table with green background is the correlation coefficient of each index of green tissue in the center of the leaf, and the table with yellow background is the correlation coefficient of each index of white tissue at the edge of the leaf. * represents significant correlation at the 0.05 level, and ** represents extremely significant correlation at the 0.01 level. Fla: flavonoids, Cane: sucrose.

[0084] Example 3 Analysis of response conditions of AbHY5 gene and promoter

[0085] 1. Identification of promoter plant expression vector

[0086] The extracted PBI121 vector plasmid was double-digested with restriction endonucleases Xba I and BamH I, and then ligated and recombined with the purified product of the promoter with restriction sites. A 3mm monoclonal colony was picked for PCR positive clone identification, and the positive bacterial solution was sent to Sangon Biotechnology for sequencing. After alignment and consistency with the target fragment size, P AbHY5 -gus recombination vector plasmid.

[0087] 2. P AbHY5 GUS tissue staining analysis of tobacco transiently transformed with -gus

[0088] pBI121 empty plasmid and P AbHY5 -gus recombinant plasmid was transformed into GV3101 Agrobacterium. Different tissues of tobacco such as roots, stems and leaves were instantly transformed by vacuum infiltration method, and GUS histochemical staining was performed after 48 hours of culture.

[0089] The staining results are as follows Figure 6 As shown, the negative control CK was not stained blue, the positive control 35S:GUS and the experimental group P AbHY5::GUS The blue color was the darkest in the positive control. The GUS enzyme activity assay showed that the negative control CK had almost no activity, while the GUS activity of the positive control 35S∷GUS was significantly higher than that of the experimental group, which was consistent with the staining results. The above results indicate that the endogenous GUS activity of tobacco did not interfere with the experimental results. AbHY5::GUS It can drive the expression of GUS reporter gene and has the initiation transcription activity of the promoter. The blue staining of tobacco root, stem and leaf tissues is close, indicating that P AbHY5::GUS The promoter had no significant tissue specificity in the three tobacco tissues: roots, stems and leaves.

[0090] 3. Dark processing P AbHY5 GUS Activity Analysis of Transiently Transformed Tobacco

[0091] Preliminary prediction of the main cis-acting elements of the AbHY5 promoter showed that the AbHY5 promoter has a light-responsive element G-box, an abscisic acid-responsive element ABRE and a gibberellin-responsive element P-box. The deep red leaves of P. chinensis were selected as plant materials for dark treatment, and the non-red leaves were selected as plant materials for hormone treatment. The transiently expressed tobacco leaves were treated with darkness for 48 hours, and the GUS enzyme activity was measured. After 15 days of darkness treatment, the leaves were restored to light for 15 days to analyze the changes in the pigments of P. chinensis leaves under darkness.

[0092] The results are as follows Figure 7 As shown, compared with the instantaneous conversion P without any treatment AbHY5 Compared with tobacco leaves, dark-treated leaves have a lighter blue color ( Figure 7 A), GUS enzyme activity was also significantly reduced ( Figure 7 B), indicating that the AbHY5 promoter responds to light induction and darkness inhibits its activity. The blue color treated with abscisic acid (ABA) is deeper, and the GUS protease activity is significantly increased, which is close to the enzyme activity of the positive control 35S:GUS, indicating that ABA can positively regulate the activity of the AbHY5 promoter. The gibberellin (GA3) treatment group was almost not stained blue, the GUS protein was only weakly expressed in a few parts, and the GUS protease activity was significantly reduced, indicating that gibberellin can negatively regulate the activity of the AbHY5 promoter.

[0093] 4. Analysis of AbHY5 gene expression in the dark

[0094] Given that P AbHY5::GUS The GUS activity of transiently transformed tobacco changed significantly under dark conditions. We shaded the leaves of P. truncatula to explore whether shading would affect leaf color and the expression of the AbHY5 gene.

[0095] The results of treating the leaves of golden-edged red-bristled pineapple under different light conditions are as follows: Figure 8 As shown, compared with the light treatment ( Figure 8 A), after 15 days of dark treatment, the leaves of the golden-edged red-bristled pineapple curled significantly, and the central green tissue turned yellow ( Figure 8 B); Further testing of the pigment content of golden-edged red-bud pineapple leaves in the dark resulted in Fig. 9 As shown, the chlorophyll content decreased significantly by 70% ( Fig. 9 A), carotenoids decreased significantly by 22% ( Fig. 9 B), and no significant changes in anthocyanin content ( Fig. 9 C). The red color of the edge albino tissue faded, and the anthocyanin content decreased significantly by 71%. The chlorophyll content and carotenoid content did not change significantly. After 15 days of darkness and then 15 days of light restoration, the leaf color changed significantly ( Figure 8C). The chlorophyll content of the central green tissue increased significantly by 50%, but was far lower than the content before the dark treatment; the carotenoid content and anthocyanin content did not change significantly. The marginal albino tissue showed signs of reddening, but the red color was lighter than that of the leaves before the dark treatment. The anthocyanin content increased significantly, but was lower than that before the dark treatment, and the chlorophyll content and carotenoid content did not change significantly.

[0096] This shows that the pigment synthesis of the leaves of the golden-edged red-bristled pineapple depends on light, and the dark treatment significantly inhibits the pigment synthesis, resulting in changes in leaf color. After the light is restored, the accumulation of pigments will increase, but it is lower than the pigment level of the leaves under normal light.

[0097] In addition, the results of AbHY5 gene expression analysis in the dark are as follows Fig.10 As shown in the figure, after 15 days of dark treatment, the expression level of AbHY5 in the central green tissue of Golden Edge Red Bract pineapple decreased, but not significantly; after 15 days of restoration of light, the expression level of AbHY5 increased significantly, which was equivalent to the expression level before dark treatment. After 15 days of dark treatment, the expression level of AbHY5 in the edge albino tissue decreased significantly by 90%, and after 15 days of restoration of light, the expression level of AbHY5 increased significantly, but was lower than the expression level before dark treatment. The above results show that AbHY5 can respond to light, and the expression level of AbHY5 decreases significantly under dark conditions.

[0098] Example 4: Transgenic material with overexpression of AbHY5 gene

[0099] Through the above analysis of the expression pattern of AbHY5 in leaves, it was found that the expression of AbHY5 was closely related to physiological indicators such as leaf color change, and it may be involved in the synthesis and accumulation of pigments in leaves. To further explore the function of AbHY5 in regulating pigments, we constructed an AbHY5 plant expression vector and stably genetically transformed it into Nicotiana benthamiana. By analyzing the physiological and biochemical indicators of transgenic plants and the gene expression level, we explored its function in regulating the synthesis and accumulation of pigments and determining the formation of leaf color, providing theoretical support for studying the relationship between the synergistic and competitive accumulation of pigments in Golden Edged Red-Bracted Bromeliad.

[0100] 1. Identification of pCAMBIA2300-AbHY5-eGFP plant expression vector

[0101] The CDS sequence of the AbHY5 gene without the stop codon was constructed into the vector pCAMBIA-2300-eGFP. The vector plasmid was digested by enzymes and then detected by gel electrophoresis. The linearized vector and the target gene were recombined and connected using T4 ligase. The recombinant plasmid was transformed into DH5α Escherichia coli competent cells and cultured overnight. The positive clones were identified and expanded in liquid culture medium before being sent to the company for sequencing.

[0102] The sequencing results were compared and analyzed. Fig.11 As shown, the recombinant plasmid was identified to be correctly constructed, and the overexpression vector plasmid of AbHY5 was successfully obtained, which was named pCAMBIA2300-AbHY5-eGFP and used in subsequent genetic transformation experiments.

[0103] 2. Identification of Agrobacterium transformed with overexpression vector

[0104] The plasmid of the recombinant overexpression vector pCAMBIA2300-AbHY5-eGFP was transformed into GV3101 Agrobacterium competent cells by freeze-thaw method. After the colonies grew out at 28°C, single clones were picked for propagation. Specific primers were designed with fragments containing the vector and target gene sequences, and bacterial liquid PCR was performed to screen positive clones. The test results showed that the recombinant plasmid containing the AbHY5 gene was successfully inserted into the Agrobacterium GV3101 competent cells.

[0105] 3. Identification of genetically modified tobacco

[0106] The obtained pCAMBIA2300-AbHY5-eGFP positive bacterial liquid was genetically transformed into Nicotiana benthamiana by leaf disc method. After callus induction and bud induction, the transformed plants that can survive and root on the screening medium were tested. Leaves of wild-type plants and transformed plants were cut to extract DNA, and primers were designed using the GFP tag unique to the vector plasmid. PCR positive seedlings were identified using the vector plasmid as a positive control.

[0107] Gel electrophoresis results Fig.12 As shown, among the 8 randomly selected seedlings for testing, 3 PCR amplification product bands were consistent with the positive control length, and the negative control had no band, indicating that 1, 3, and 6 of the 8 tobacco plants were transgenic positive plants and were used for subsequent experiments.

[0108] Example 5 Functional study of AbHY5 gene

[0109] 1. Analysis of transgenic tobacco phenotype and pigment content

[0110] According to the analysis of the transgenic positive plants obtained above, it was found through naked eye observation that Fig.13 As shown in Figure 5, the transgenic plants grew robustly (right figure), and the leaves of the transgenic plants were darker than those of the wild-type plants. The chromaticity values ​​of the leaves of the negative plants and the transgenic plants were measured using a colorimeter. The results are shown in Table 5, and the L* value of the transgenic tobacco leaves was significantly reduced, indicating that the brightness of the transgenic tobacco leaves decreased. While the a* value did not change significantly, the b* value decreased significantly, indicating that the yellowness of the transgenic tobacco leaves was reduced as the L* value decreased.

[0111] Table 5 Chromaticity analysis of transgenic tobacco leaves

[0112]

[0113] To understand the reasons for the changes in leaf chromaticity values ​​of transgenic plants, we measured the pigment and flavonoid content of tobacco leaves. Fig.14 As shown, the chlorophyll a ( Fig.14 A) Carotenoids ( Fig.14 B) anthocyanins ( Fig.14 C) and flavonoids ( Fig.14 D) content increased significantly, and there was no significant difference in chlorophyll b content. Chlorophyll content accounts for about 83% of the total amount of the three types of pigments and is the dominant pigment of the leaves. The significant increase in chlorophyll a content is the main reason for the significant decrease in L* and b* values, which in turn leads to a decrease in leaf brightness. The carotenoid content of transgenic plants is as high as 0.12 mg / g, which is significantly lower than the chlorophyll content. The flavonoid content increased the most, reaching a maximum of about 3.4 mg / g, indicating that AbHY5 significantly promoted the synthesis rate of flavonoids in Nicotiana benthamiana. However, the anthocyanin content is extremely low and has not increased significantly due to the high flavonoid content, indicating that the anthocyanin synthesis pathway has not been fully activated and flavonoids have flowed more to other downstream branches.

[0114] 2. Analysis of sugar content in transgenic tobacco

[0115] Sugars can provide carbon skeletons for the biosynthesis of flavonoids and are also important basic substances for glycosylation modification. To explore the effect of AbHY5 on sugar metabolism, we measured the content of sucrose, fructose and starch in transgenic plants.

[0116] The results are as follows Fig.15 As shown, the fructose content of transgenic plants was significantly reduced ( Fig.15 A), while the content of sucrose and starch increased significantly ( Fig.15 B, C), among which the increase in starch content was the largest, indicating that AbHY5 can significantly promote the accumulation of endogenous sucrose and starch in tobacco leaves.

[0117] 3. Analysis of photosynthetic indicators of transgenic tobacco

[0118] In view of the significant increase in the content of photosynthetic pigments and sugar substances in transgenic tobacco, we speculated whether AbHY5 had an effect on the photosynthesis of tobacco and used a portable photosynthetic meter to measure the photosynthetic indicators of transgenic plants and negative plants.

[0119] The results are as follows Fig.16 As shown in the figure, compared with the negative plants, the net photosynthetic rate of transgenic tobacco leaves increased from 12.94 μmolCO2 m -2 s-1 Significantly increased to 16.85 μmol CO2 m -2 s -1 ( Fig.16 A), stomatal conductance is 0.15H2O m -2 s -1 Significantly increased to 0.28 mol H2O m -2 s -1 ( Fig.16 B), the intercellular CO2 concentration is 235.76 μmol CO2 mol -1 Significantly increased to 259.96 μmol CO2 mol -1 ( Fig.16 C), the evaporation rate is 2.07mmol H2O m -2 s -1 Significantly increased to 2.95mmol H2O m -2 s -1 ( Fig.16 D).

[0120] The above results show that several indicators of photosynthesis influence and promote each other. The stomatal conductance of transgenic tobacco increased significantly, which improved the ability of tobacco leaves to absorb water and CO2, and significantly increased the intercellular CO2 concentration, but did not exceed the capacity of leaves for photosynthesis, providing more sufficient substrates for photosynthesis energy conversion, significantly increasing the photosynthetic rate, and thus producing more energy substances such as sugar in the leaves. In addition, chlorophyll is an important light-harvesting pigment, which can absorb and transmit light energy and promote energy conversion during photosynthesis. The chlorophyll content of transgenic tobacco increased significantly, which promoted the photosynthetic rate of leaves. The photosynthetic rate increased significantly, generating more heat in the plant body, and the stomatal conductance increased, which significantly increased the transpiration rate. The increase in transpiration rate in turn promoted the efficiency of photosynthesis. When the intercellular CO2 concentration is too high, the stomata will close quickly, affecting the photosynthetic rate of the plant. It can be seen that overexpression of AbHY5 reasonably increased the photosynthetic rate of tobacco leaves.

[0121] 4. Oxidative stress analysis of transgenic tobacco

[0122] Non-enzymatic system components such as carotenoids, flavonoids, and phenolic substances have the function of scavenging ROS. In order to detect the effect of overexpressing AbHY5 on the ROS balance in tobacco plants, we detected the hydrogen peroxide content in transgenic tobacco leaves and prepared 3,3'-diaminobenzidine tetrahydrochloride (DAB) solution to perform DAB staining on transgenic tobacco leaves. The darker the staining, the higher the peroxide content in the leaves.

[0123] The results are as follows Fig.17As shown, leaves of tobacco plants overexpressing AbHY5 were stained lighter than those of negative plants ( Fig.17 A), the hydrogen peroxide content was also significantly reduced ( Fig.17 B), indicating that overexpression of AbHY5 significantly promoted the content of flavonoids and carotenoids, thereby enhancing the ability of the non-enzymatic system of transgenic tobacco to eliminate ROS, thereby promoting the balance of ROS in tobacco leaves.

[0124] 5. Expression analysis of transgenic tobacco AbHY5 and related genes

[0125] To explore the intrinsic mechanism of how overexpression of AbHY5 affects the physiological metabolism of transgenic tobacco, we extracted RNA from leaves of transgenic tobacco plants and negative control plants, reverse transcribed it into cDNA, and then performed RT-qPCR detection. Fig.18 As shown, the expression of AbHY5 was not detected in wild-type tobacco plants, and the expression level of AbHY5 was the highest in the transgenic tobacco OE2 line ( Fig.18 A).

[0126] Considering that the pigment and flavonoid contents of transgenic tobacco were significantly increased, in order to explore whether overexpression of AbHY5 affected the expression levels of related structural genes in the pigment synthesis pathway and to explore the potential target genes downstream of AbHY5, we performed RT-qPCR detection on the related genes involved in pigment synthesis in transgenic plants: chlorophyll synthesis-related structural gene NbDVR, carotenoid synthesis-related structural gene NbPSY, anthocyanin synthesis-related structural genes NbCHS and NbF3'H.

[0127] The results are as follows Fig.18 As shown in BF, the expression levels of chlorophyll synthesis-related structural genes NbDVR, carotenoid synthesis-related structural genes NbPSY, anthocyanin synthesis-related structural genes NbCHS and NbF3'H were significantly increased, up to 2 times, 2.5 times, 32 times and 3.8 times of those in negative plants, respectively, among which the expression level of NbCHS increased the most, which was consistent with the result that the flavonoid content in the leaves of transgenic plants increased the most. This shows that AbHY5 significantly promotes the expression level of genes related to pigment synthesis and affects the synthesis and accumulation of leaf pigments.

[0128] 6. Analysis of the content of enzymes encoded by genes related to pigment synthesis in transgenic tobacco

[0129] Since the expression levels of genes related to pigment synthesis in transgenic tobacco were significantly changed, it was determined whether the contents of the enzymes encoded by them were changed in transgenic plants.

[0130] The results are as follows Fig.19As shown in the figure, overexpression of AbHY5 significantly increased the expression level and encoding enzyme content of tobacco NbDVR, indicating that AbHY5 can promote the synthesis of chlorophyll by affecting the expression of NbDVR gene ( Fig.19 A). PSY is considered to be the key rate-limiting enzyme in the carotenoid biosynthesis pathway. Overexpression of AbHY5 significantly increased the expression level of tobacco NbPSY and the content of its encoding enzyme, indicating that AbHY5 can affect the expression of tobacco NbPSY and promote the synthesis of carotenoids ( Fig.19 B). Overexpression of AbHY5 significantly increased the expression level of tobacco NbCHS and the content of its encoding enzyme, indicating that AbHY5 can promote the significant expression of NbCHS and thus promote the synthesis of tobacco flavonoids and anthocyanins ( Fig.19 C).

[0131] In summary, based on the transcriptome data, the present invention cloned a light signal transcription factor AbHY5 in the golden-edged red-brimmed pineapple for the first time. By analyzing the pigment synthesis accumulation rules of the central green tissue and the edge white tissue of the golden-edged red-brimmed pineapple leaves and the expression characteristics of AbHY5, it was shown that the expression of AbHY5 has obvious tissue specificity and is specifically expressed in petals and red leaves; and the expression level of AbHY5 is extremely significantly positively correlated with the content of anthocyanins, flavonoids, sucrose and starch.

[0132] In addition, the present invention also reveals the effect of pigment synthesis accumulation on leaf color formation. The expression level of AbHY5 in both tissues of dark red leaves is significantly higher than that in non-red and light red leaves, and the expression level in the edge albino tissue is significantly higher than that in the corresponding central green tissue; the promoter activity characteristics of AbHY5 are also analyzed. The AbHY5 promoter responds to light induction, and the expression level of AbHY5 decreases significantly under dark conditions. At the same time, the function of AbHY5 in regulating the synthesis of three major types of pigments is verified by transgenic. The study shows that overexpression of AbHY5 can not only reduce the yellow degree of transgenic tobacco leaves, but also significantly promote the synthesis rate of transgenic plant flavonoids, the accumulation of endogenous sucrose and starch, and increase the content of pigments such as flavonoids, chlorophyll a, anthocyanins, and carotenoids, and improve the photosynthetic rate of tobacco leaves and the ability of transgenic tobacco non-enzymatic system to remove ROS, thereby promoting the balance of ROS in tobacco leaves. It shows that the AbHY5 gene can also be used as a candidate gene for pineapple resistance molecular breeding to improve the stress resistance of pineapples. The present invention explores the mechanism of action of AbHY5 in regulating the synthesis and accumulation of three major types of pigments, which will provide support for explaining the synergistic competitive relationship and regulatory mechanism of the three major pigments of golden-edged red-brimmed pineapple, and provide a theoretical basis for breeding new leaf color varieties.

[0133] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A transcription factor AbHY5 that regulates the formation of colorful leaf colors in golden-edged red-bract pineapple, characterized in that: Its nucleic acid sequence is shown in SEQ ID NO.

1.

2. The encoded protein of the transcription factor AbHY5 according to claim 1, characterized in that Its amino acid sequence is shown in SEQ ID NO.

2.

3. Use of the transcription factor AbHY5 or its expression promoter according to claim 1, or the encoded protein according to claim 2 in promoting pigment synthesis in plant leaves and promoting the expression of pigment synthesis-related structural genes.

4. Use of the transcription factor AbHY5 or its expression promoter according to claim 1, or the encoded protein according to claim 2 in improving plant photosynthetic efficiency.

5. Use of the transcription factor AbHY5 or its expression promoter according to claim 1, or the encoded protein according to claim 2, in promoting the synthesis of plant flavonoids, or in increasing the content of plant flavonoids.

6. Use of the transcription factor AbHY5 or its expression promoter according to claim 1, or the encoded protein according to claim 2 in breeding new varieties of plants with multiple leaf colors.

7. A recombinant expression vector, characterized in that: Contains the transcription factor AbHY5 according to claim 1.

8. A genetically engineered bacterium, characterized in that: Contains the recombinant expression vector according to claim 6.

9. A product for improving plant photosynthetic efficiency, characterized in that: An expression promoter containing the transcription factor AbHY5 according to claim 1.

10. A method for promoting pigment synthesis in plant leaves or improving plant photosynthetic efficiency, characterized in that: The recombinant vector of claim 7 or the genetically engineered bacteria of claim 8 is transformed into plants, or the plants are treated with an expression promoter of the transcription factor AbHY5 that regulates the formation of colorful leaf colors of golden-edged red-bract pineapple.

Images