Rice TGW7 gene, encoding protein thereof and application of rice TGW7 gene in increasing plant yield breeding

Abstract

The invention relates to a rice TGW7 gene, a mutant thereof, an encoding protein thereof and an application of the rice TGW7 gene in breeding for improving the yield of plants.

Description

Technical Field

[0001] The present invention relates to a rice TGW7 gene and a mutant thereof, a protein encoded therein and an application thereof in breeding for increasing plant yield. Specifically, the present invention relates to a mutant of the TGW7 gene capable of increasing the width of rice seeds and a method for increasing the width of rice seeds and rice yield. Background Art

[0002] Rice is one of the most important food crops in China and even in the world, feeding nearly 60% of the world's population. From the 1960s to the 1970s, dwarfing breeding and hybrid breeding achieved a substantial increase in rice yields, alleviating the problem of food shortages caused by population growth. In recent years, with the increase in population, the reduction in cultivated land and the intensification of environmental problems, continuously increasing yields has become a major challenge facing rice production. Cultivating high-yield rice varieties is of great significance to ensuring national food security and solving the problem of cultivated land shortage.

[0003] The three determining factors of rice yield include the number of effective panicles per plant, the number of grains per panicle and grain weight, while grain size is the main determinant of 1,000-grain weight, which directly affects yield. Therefore, cloning genes related to grain shape and deeply studying and clarifying the molecular and genetic mechanisms that control grain size can provide important gene resources and molecular breeding strategies for high-yield rice breeding, laying the foundation for breeding high-yield rice varieties.

[0004] The present invention provides a new mutant of the gene TGW7. Unexpectedly, the inventors first discovered that the width of rice seeds can be significantly increased by inactivating the C-terminus of the rice TGW7 protein, and that rice plants with significantly increased rice seed width and 1000-grain weight can be obtained by inactivating the C-terminus of the rice TGW7 protein. Summary of the invention

[0005] The invention relates to a mutant of rice TGW7 gene and use thereof for increasing rice seed width and rice yield, as well as a method for obtaining high-yield rice and increasing rice yield.

[0006] In a first aspect, the present invention provides a nucleic acid molecule, which is a mutant of a TGW7 gene, comprising a mutation that inactivates the C-terminus of the encoded TGW7 protein compared to the wild-type TGW7 gene of SEQ ID NO: 1.

[0007] In a preferred embodiment, the mutation includes: deletion of bases AA at positions 1699 and 1700 of sequence SEQ ID NO: 1; or deletion of bases TCTCATAT at positions 1678-1685; or insertion of a base T after position 1600; or insertion of a base A after position 1601.

[0008] In a second aspect, the present invention relates to a protein expressed by the mutated TGW7 gene of the first aspect.

[0009] In a third aspect, the present invention relates to a gRNA molecule for gene editing the TGW7 gene having a sequence of SEQ ID NO: 1 to obtain the aforementioned mutated TGW7 gene.

[0010] In a preferred embodiment, the sequence of the gRNA includes SEQ ID NO:5 or SEQ ID NO:13.

[0011] In a fourth aspect, the present invention relates to a method for obtaining the mutated TGW7 gene of the first aspect, comprising using the gRNA molecule of the third aspect to perform gene editing on a wild-type TGW7 gene of sequence SEQ ID NO: 1.

[0012] In a fifth aspect, the present invention relates to a vector comprising the gRNA molecule of the third aspect.

[0013] In a preferred embodiment, the vector is a pYL-HU-U3-CCDB-tRNA (K1) vector (Wuhan Boyuan Biotechnology Co., Ltd., catalog number #REC40-1: Monocot Gene Editing Vector Kit (Hyg)) comprising the gRNA molecule.

[0014] In a sixth aspect, the present invention relates to the use of the mutated TGW7 gene or protein or gRNA molecule or vector of the aforementioned aspects for increasing the width of rice seeds or increasing rice yield.

[0015] In a seventh aspect, the present invention relates to a method for increasing rice seed width or increasing rice yield, comprising inactivating the C-terminus of the TGW7 protein encoded by the TGW7 gene of SEQ ID NO: 1, thereby increasing rice seed width or increasing rice yield.

[0016] In a preferred embodiment, the method comprises mutating the rice TGW7 gene of sequence SEQ ID NO: 1 by chemical mutagenesis or gene editing, thereby inactivating the C-terminus of the encoded TGW7 protein.

[0017] In a more preferred embodiment, the mutation of the rice TGW7 gene includes: deleting the bases AA at positions 1699 and 1700 of the rice TGW7 gene; or deleting the bases TCTCATAT at positions 1678-1685 of the rice TGW7 gene; or inserting a base T after the 1600th position of the rice TGW7 gene; or inserting a base A after the 1601st position of the rice TGW7 gene.

[0018] In a more preferred embodiment, the gene editing method comprises using the gRNA molecule of the third aspect to mutate the rice TGW7 gene.

[0019] In a more preferred embodiment, the chemical mutagenesis method comprises radiation mutagenesis.

[0020] In a more preferred embodiment, the method comprises transforming callus tissue or plant cells with the vector according to the fifth aspect, and then regenerating rice plants from the callus tissue or plant cells, thereby obtaining rice plants with increased seed width or yield.

[0021] In an eighth aspect, the present invention relates to a method for preparing a rice plant, comprising transforming a callus or a plant cell with the vector of the fifth aspect, and then regenerating a rice plant from the callus or the plant cell.

[0022] In the ninth aspect, the present invention relates to rice plant seeds, Oryza sativa subsp. keng, which are deposited in the General Microbiological Center of China Microorganism Culture Collection Committee with the deposit number CGMCC No. 46090, and the deposit date is August 26, 2024. Compared with wild-type rice seeds, the seeds and their progeny seeds have significantly increased grain width and thousand-grain weight.

[0023] In a tenth aspect, the present invention relates to use of the aforementioned preserved rice seeds for increasing rice yield.

[0024] In an eleventh aspect, the present invention relates to a method for increasing rice yield, comprising growing the aforementioned deposited rice seeds, and harvesting seeds of the resulting rice plants.

[0025] In a twelfth aspect, the present invention relates to a method of preparing a rice plant, comprising growing the aforementioned deposited rice seeds into a rice plant.

[0026] In summary, the inventors first discovered that the rice seed width can be significantly increased by inactivating the C-terminus of the rice TGW7 protein, thereby significantly increasing the rice yield. Based on this, the inventors further obtained rice plants with significantly increased yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The rice phenotypes and grain width results of different TGW7 gene mutations are shown. Figure 1 A shows the mutation positions of different mutants. Figure 1 B shows a photograph of the obtained rice seed grain length and grain width. Figure 1 C and D are photos of the obtained rice plant height phenotypes. Figure 1EH is the grain length, grain width, length / width ratio and thousand-grain weight of the obtained rice. Among them, cr-tgw7#1 and cr-tgw7#2 strains are two homozygous editing strains obtained in Example 2, and their protein translation is terminated prematurely, consisting of the original 558 amino acids and the newly synthesized 16 amino acids; cr-tgw7#3 strain has 2 amino acids missing at the N-terminal site; cr-tgw7#4 strain protein translation is terminated prematurely, consisting of the original 8 amino acids and the newly synthesized 4 amino acids ( Figure 1 A), which is close to the reported mutation sites of Osftip7-1 and Osftip7-2 (Shiyong Song et al., OsFTIP7 determines auxin-mediated anther dehiscence in rice, Nature Plants. Vol 4. July 2018: 495-504), showing a completely sterile phenotype. It can be seen that the mutant TGW7 protein of the present application has not completely lost its function but only lost its C-terminal function.

[0028] Figure 2 The electrophoresis diagram for detecting the transformation positive rate of multiple gene-edited rice is shown, wherein the DNA molecular weight standards are 1000, 750, 500, 250, and 100 bp.

[0029] Figure 3 The plasmid map of the knockout vector in Example 1 is shown.

[0030] Figure 4 The rice genetic transformation process in Example 2 is shown: A, callus induction; B, co-cultivation; C, screening stage; D, differentiation and emergence of seedlings.

[0031] Figure 5 The electrophoresis diagram of the recovered gRNA in Example 1 is shown. The fragment size is 366 bp, and the DNA molecular weight standard is 5000, 3000, 2000, 1500, 1000, 750, 500, 250, and 100 bp.

[0032] Figure 6 The electrophoresis diagram shows the results of identifying the knockout vector transformed E. coli by plaque PCR in Example 1. The fragment size is about 1200 bp, and the DNA molecular weight standards are 6000, 5000, 3000, 2000, 1500, 1000, 750, 500, 250, and 100 bp.

[0033] FIG. 7 shows the comparison results of grain length and grain width of wild-type and mutant rice of TGW7 gene in Example 3-4. Fig. 7A This is a photo of rice seeds. Figure 7B Based on Fig. 7ASpecific length, width and aspect ratio data of medium rice seeds.

[0034] Figure 8 The comparison results of grain length and grain width of another batch of wild-type and mutant rice with TGW7 gene in Example 5 are shown. Figure 8 This is a photo of rice seeds.

[0035] Fig. 9 The plasmid map of the knockout vector in Example 3 is shown.

[0036] Fig.10 The differentiation and emergence of rice seedlings in Example 3 are shown.

[0037] Fig.11 The results of the transgenic complementation function verification in Example 4 are shown. DETAILED DESCRIPTION

[0038] The present invention provides a novel mutant of gene TGW7. The inventors found that by inactivating the C-terminus of rice TGW7 protein, rice plants with significantly increased seed width and thousand-grain weight can be obtained.

[0039] “TGW7 gene” refers to rice gene LOC_Os05g30750 (SEQ ID NO: 1) (National Rice Data Center (MSU)). “Mutation of TGW7 gene” refers to a mutation of TGW7 gene that results in loss of function of the C-terminus of the encoded protein.

[0040] "gRNA" refers to guide RNA, which guides Cas9 nuclease or other Cas proteins to recognize and cut specific DNA sequences in the CRISPR / Cas9 gene editing system.

[0041] The present invention provides the following embodiments:

[0042] Embodiment 1: A mutant TGW7 gene, which comprises a mutation that inactivates the C-terminus of the encoded TGW7 protein compared to the wild-type TGW7 gene of SEQ ID NO: 1;

[0043] Preferably, the mutation includes: deletion of base AA at positions 1699 and 1700 of the sequence SEQ ID NO: 1; or deletion of base TCTCATAT at positions 1678-1685; or insertion of a base T after position 1600; or insertion of a base A after position 1601.

[0044] Embodiment 2: A protein expressed by the mutated TGW7 gene described in Embodiment 1.

[0045] Embodiment 3: A gRNA molecule, the sequence of which includes SEQ ID NO:5 or SEQ ID NO:13.

[0046] Embodiment 4: A method for obtaining the mutated TGW7 gene described in Embodiment 1, comprising using the gRNA molecule described in Embodiment 3 to perform gene editing on the wild-type TGW7 gene of sequence SEQ ID NO: 1.

[0047] Embodiment 5: A vector comprising the gRNA molecule described in Embodiment 3; preferably, the vector is a pYL-HU-U3-CCDB-tRNA (K1) vector comprising the gRNA molecule.

[0048] Embodiment 6: Use of the mutated TGW7 gene described in Embodiment 1 or the protein described in Embodiment 2 or the gRNA molecule according to Embodiment 3 or the vector according to Embodiment 5 for increasing rice seed width or increasing rice yield.

[0049] Embodiment 7: A method for increasing the width of rice seeds or increasing rice yield, comprising inactivating the C-terminus of the TGW7 protein encoded by the TGW7 gene of SEQ ID NO: 1, thereby increasing the width of rice seeds or increasing rice yield.

[0050] Embodiment 8: The method according to embodiment 7, wherein the rice TGW7 gene of sequence SEQ ID NO: 1 is mutated by chemical mutagenesis or gene editing, thereby inactivating the C-terminus of the encoded TGW7 protein;

[0051] Preferably, the mutation of the rice TGW7 gene includes: deleting the bases AA at positions 1699 and 1700 of the rice TGW7 gene; or deleting the bases TCTCATAT at positions 1678-1685 of the rice TGW7 gene; or inserting a base T after the 1600th position of the rice TGW7 gene; or inserting a base A after the 1601st position of the rice TGW7 gene;

[0052] More preferably, the gene editing method comprises using the gRNA molecule according to Embodiment 3 to mutate the rice TGW7 gene.

[0053] More preferably, the chemical mutagenesis method comprises radiation mutagenesis.

[0054] Embodiment 9: The method according to Embodiment 7, wherein the method comprises transforming callus tissue or plant cells with the vector according to Embodiment 5, and then regenerating rice plants from the callus tissue or plant cells, thereby obtaining rice plants with increased seed width or yield.

[0055] Embodiment 10: A method for preparing a rice plant, comprising transforming a callus or plant cell with the vector according to Embodiment 5, and then regenerating a rice plant from the callus or plant cell. Alternatively, a method for preparing rice plant seeds, comprising transforming a callus or plant cell with the vector according to Embodiment 5, and then regenerating a rice plant from the callus or plant cell, and harvesting the seeds of the rice plant.

[0056] Embodiment 11: A rice plant seed, deposited in the General Microbiological Center of China Microorganism Culture Collection Administration Committee with the deposit number CGMCC No. 46090, and the deposit date is August 26, 2024. Compared with wild-type rice seeds, the seed and its progeny seeds have significantly increased grain width and thousand-grain weight.

[0057] Embodiment 12: Use of the aforementioned preserved rice seeds for increasing rice seed width or increasing rice yield.

[0058] Embodiment 13: A method for increasing the grain width of rice seeds or increasing rice yield, comprising growing the aforementioned stored rice seeds, and harvesting seeds of the resulting rice plants.

[0059] Embodiment 14: A method of preparing a rice plant, comprising growing the aforementioned stored rice seeds into a rice plant.

[0060] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The reagents used in this application are all available to those skilled in the art through conventional means or commercial means.

[0061] The following examples are intended to be illustrative rather than limiting.

[0062] Example 1 Construction of a knockout vector for the rice TGW7 gene

[0063] 1. gRNA and PCR Primer Design

[0064] Three target sites were designed on the TGW7 gene (SEQ ID NO: 1) using the online software CCTop (https: / / cctop.cos.uni-heidelberg.de / ):

[0065] TGGATGTTGACTCTCATATG TGG(SEQ ID NO:2)

[0066] GGCAAACTTTTTCCGTATCATGG(SEQ ID NO:3)

[0067] GTGGAGCATGCGGAAGAGCA AGG(SEQ ID NO:4)

[0068] Three gRNA units (SEQ ID NO: 5) were synthesized in tRNA tandem mode and used to edit the TGW7 gene to delete the 8 bases TCTCATAT at positions 1678-1685, resulting in a newly translated protein consisting of the original 558 amino acids and the newly synthesized 16 amino acids compared to the wild-type 774 amino acid protein translated from the gene.

[0069] tggatgttgactctcatatggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcaggcaaacttttt ccgtatcagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagaccgggttcgattcccggctggtgcagtggagcatgcggaagagca(SEQ IDNO:5)

[0070] Synthesize the following target gene amplification primers:

[0071] D5013-F:cagtGGTCTCatgcatggatgttgactctcatatggttttagagctag(SEQ ID NO:6)

[0072] D5013-R:cagtGGTCTCaaaactgctcttccgcatgctccactg(SEQ ID NO:7)

[0073] 2. PCR Amplification

[0074] The gRNA unit after full gene synthesis was used as the amplification template. 1 μL of amplification template, 2 μL of 100 μM D5013-F and D5013-R primers, 20 μL ddH2O, and 25 μL PCR MIX (Wuhan Boyuan Biotechnology Co., Ltd.) were added to a 50 μL PCR system.

[0075] Element volume Nuclease-free water 20μL 2x Biorun pfu PCR Mix (#RBC00) 25μL D5013-F(100μM) 2μL D5013-R(100μM) 2μL template 1μL total 50μL

[0076] Use PCR instrument to amplify according to the program

[0077]

[0078]

[0079] 3. Electrophoresis recovery

[0080] The PCR amplification product was subjected to 1.5% agarose gel electrophoresis (5 V / cm voltage, 20 min) and 366 bp (electrophoresis pattern as shown in Figure 5 ) was cut out under ultraviolet light, and the DNA was recovered by gel recovery using a DNA gel recovery kit (Axygen), and the DNA was dissolved in a total volume of 30 μL of water.

[0081] 4. Restriction Digestion and Ligation

[0082] The empty vector pYL-HU-U3-CCDB-tRNA (K1) (Wuhan Boyuan Biotechnology Co., Ltd., Catalog #REC40-1: Monocot Gene Editing Vector Kit (Hyg)) was ligated to the fragment by the BSAI one-step method (see Figure 3 ), the system and reaction conditions are as follows:

[0083] Enzyme Digestion and Ligation System Element volume Nuclease-free water 8μL 10x Buffer 2μL BsaI / Eco31I(#RCA02) 1μL T4 Ligase 1μL pYL-HU-U3-CCDB-tRNA(K1) 4μL Recovering DNA 4μL total 20μL

[0084] Reaction conditions of enzyme digestion and ligation Number of cycles 37℃ 20min 1 37℃ 10min 5 20℃ 10min 5 37℃ 20min 1 80℃ 5min 1

[0085] 5. Transformation of competent cells with ligation products

[0086] According to the manufacturer's instructions, 5-10 μL of the ligation product was transformed into competent E. coli DH5α (produced by Shanghai Weidi Biotechnology Co., Ltd.), transformed into a plate coated with (kanamycin) resistance LB medium, and cultured at 37° C. for 12 hours.

[0087] 6. Plaque PCR Identification

[0088] Select 10 plaques, inoculate the bacteria in 1.5ml EP tube and perform PCR identification. The identification primers are as follows:

[0089] Pbw2_F:accggtaaggcgcgccgtagt(SEQ ID NO:8)

[0090] Pbw2_R:gcgattaagttgggtaacgccaggg(SEQ ID NO:9)

[0091] Amplify according to the following reaction system and procedure:

[0092] Reaction system:

[0093] Element volume Nuclease-free water 9.5μL 2x Biorun Magic PCR Mix(#RAA00) 12.5μL Pbw2_F(100μM) 1μL Pbw2_R(100μM) 1μL template 1μL total 25μL

[0094] Reaction Procedure

[0095] step Number of cycles 94℃ 5min 1 94℃ 30sec 30 50℃ 45sec 30 72℃ 22sec 30 72℃ 10min 1 16℃ 30min 1

[0096] The target band is about 1200 bp (see Figure 6 ), take the bacterial solution corresponding to the three positive bands for sequencing, and use the bacterial solution with correct sequencing to extract the plasmid.

[0097] Example 2 Transformation of Rice Callus to Obtain Rice Mutants

[0098] 1. Agrobacterium Preparation

[0099] 1.1 Plasmid transformation

[0100] Take 1 μL of the plasmid prepared in Example 1 and add it to 50 μL EHA105 Agrobacterium competent cells (Wuhan Boyuan Biotechnology Co., Ltd.), mix it thoroughly and then pipette it into an electroporation cup, add 1 mL of LB liquid culture medium after electroporation, mix it thoroughly and then pipette it into a 1.5 mL centrifuge tube, and culture it on a shaker at 30 ° C and 180 rpm for 30 min. Pipette 50 μL of the activated Agrobacterium liquid and inoculate it on LB solid culture medium, and culture it in the dark at 30 ° C for 48 h.

[0101] 1.2 Agrobacterium detection

[0102] 1.2.1 Synthesize the corresponding detection primers;

[0103] cas9pl(pyl)-393F:TCGAGAACGGTCGTAAGAGGA(SEQ ID NO:10)

[0104] cas9pl(pyl)-393R:TGTAACGCTTCCTGTCGATGGT(SEQ ID NO:11)

[0105] 1.2.2 Select plaques for PCR identification. Prepare the PCR amplification system as shown in the table below, mix thoroughly after preparation, use a PCR instrument for amplification, and set the amplification program according to the primer information.

[0106] Components volume Forward primer (10 μM) 1μL Negative primer (10 μM) 1μL 2×Taq PCR Mix (#RAB00) 10μL <![CDATA[ddH2O]]> 7μL template 1μL total 20μL

[0107] 1.2.3 Gel electrophoresis detection: prepare 1% agarose gel (weigh 1.5g agarose powder and dissolve it in 150mL 1×TAE buffer, heat it in a microwave oven for about 3 minutes until the liquid becomes transparent. Add EB to the gel plate, pour the dissolved agarose liquid into the gel plate, mix well, insert a comb, let it stand for 40 minutes, and when the gel turns milky white, it is ready), spot the sample, and complete the electrophoresis process.

[0108] 1.2.4 Check the PCR amplification results. If the electrophoresis bands of the positive control and sample are clear and of the correct size, and the negative control has no bands, it indicates that the sample can proceed to the next step.

[0109] 2. Rice genetic transformation

[0110] 2.1 Callus induction

[0111] Select Kitaake strain rice grains without mold spots and normal buds, disinfect them with 75% alcohol for 1 min, wash them with sterile water for 1 min each time; disinfect them with 15% sodium hypochlorite for 20 min, soak them in sterile water for 30 min, wash them 3 times for 1 min each time; the disinfected rice grains are inoculated into induction medium (N6B5 medium) and induced under full light at 27°C for 6-7 days.

[0112] The composition of the induction medium is as follows:

[0113]

[0114] 2.2 Agrobacterium infection

[0115] Pick Agrobacterium in the infection solution and prepare OD 600 = 0.2 of Agrobacterium resuspension, pick the callus tissue in 2.1 and place it in a triangular flask, add the Agrobacterium resuspension, infect for 10-15 minutes, discard the bacterial solution and place it on the filter paper board to blow dry the bacterial solution on the callus surface for 1-2 hours, then transfer the callus tissue to a layer of filter paper (co-culture medium) with infection solution for co-cultivation, and after air-drying for about half an hour, place it at 20℃ for co-cultivation for 48-72 hours.

[0116] The composition of the infection solution is as follows:

[0117]

[0118]

[0119] 2.3 Callus screening

[0120] Wash the callus in 2.2 with cephalosporin water for 6 to 7 times, soak for 2 hours, blow dry on filter paper, inoculate on screening medium, and culture in the dark at 30℃ for 20-30 days; inoculate the positive callus grown on the screening medium to the secondary screening medium. Be sure to pick the single clone callus during the callus picking process, and culture in the dark at 30℃ for 7-10 days.

[0121] The screening medium components are as follows:

[0122]

[0123]

[0124] 2.4 Differentiation and rooting

[0125] The positive callus was inoculated into differentiation medium (MS medium + 2 mg / L (6-BA) + 0.5 mg / L naphthaleneacetic acid + 1 mg / L kinetin + 30 g / L sucrose + 3% sorbitol + 4 g / L phytogel, the final pH of the differentiation medium = 5.8), cultured at 27-30°C in full light for 15-20 days, and inoculated into rooting medium (1 / 2 MS medium) after 2-5 cm buds were differentiated, and cultured at 30°C in light for 7-10 days until the seedling stage (see Figure 4 ).

[0126] The components of differentiation medium are as follows:

[0127] The composition of the rooting medium is as follows:

[0128]

[0129]

[0130] 2.5 Positive seedling detection

[0131] 2.5.1 Extraction of rice genomic DNA

[0132] Place leaves of about 2CM in the seedling stage in a centrifuge tube, put it in a -80℃ refrigerator and freeze it for 1h, break the sample with a tissue crusher, add 300μL of extraction solution containing 200mM PH8.0 Tris-HCL, 25mM PH8.0 EDTA, and 1% SDS, mix thoroughly, add 150μL 7.5M NH4AC solution, shake gently for 2min, centrifuge at 4000r / min for 15min, extract 200μL of supernatant and place it in a new centrifuge tube, add 2 times the volume of frozen anhydrous ethanol, centrifuge at 4000r / min for 15min, discard the supernatant, dry it thoroughly at room temperature, add double distilled water to dissolve the DNA, which is the genomic DNA of the sample to be tested, and store it at 4℃ for later use.

[0133] 2.5.2 Perform PCR detection (PCR primers are the same as 1.2.1), and the detection method is the same as 1.2 Agrobacterium detection ( Figure 2 ).

[0134] 2.5.3 The sample genomic DNA was sequenced (Beijing Bokaisen Biotechnology Co., Ltd.) to confirm the mutation. The sequencing results showed that the bases TCTCATAT at positions 1678-1685 of the TGW7 gene sequence SEQ ID NO: 1 in the rice genome were missing.

[0135] 3. Rice cultivation and grain width detection

[0136] The gene-edited strains were planted in an artificial climate chamber until maturity, and 10 strains of wild-type Kitaake strain and tgw7 mutant strain were collected. The grain length, grain width and thousand-grain weight ( Figure 1 The results showed that the grain length of the tgw7 mutant strains was basically the same as that of the wild-type strains (cr-tgw7#1 and cr-tgw7#2 strains), and the grain width was significantly larger than that of the wild-type strains ( Figure 1 B and 1F, the thousand-grain weight was significantly greater than that of the wild-type strain ( Figure 1 H). This indicates that the C-terminus of the TGW7 gene can regulate rice seed shape and yield, and has the potential for production application.

[0137] The reagents involved in the above culture medium formulas are all commercially available.

[0138] Example 3 Preparation of Rice TGW7 Gene Mutants cr-tgw7#5 and cr-tgw7#6

[0139] The following target site was designed on the TGW7 gene: CCAACATTGTATCAACAAGG (SEQ ID NO: 12), and gRNA was synthesized for gene editing of the TGW7 gene to obtain the following two mutants:

[0140] 1) cr-tgw7#5: An A base was inserted after the 1601th position of the TGW7 gene, resulting in the premature termination of TGW7 protein translation. The mutant protein consisted of the original 532 amino acids and the newly synthesized 25 amino acids.

[0141] 2) cr-tgw7#6: A base T was inserted after the 1600th position of the TGW7 gene, resulting in premature termination of TGW7 protein translation. The mutant protein consisted of the original 532 amino acids and the newly synthesized 25 amino acids (532+25).

[0142] CCTTGTTGATACAATGTTGGGTTTTAGAGCTAGAAATAGCAA GTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACC GAGTCGGTGCTTTTTTT(SEQ ID NO:13)

[0143] Synthesize the following target gene amplification primers:

[0144] D705-F:cagtggtctcatgcaCCAACATTGTATCAACAAGG(SEQ ID NO:14)

[0145] D750-R:cagtggtctcaaaacCCTTGTTGATACAATGTTGG(SEQ ID NO:15)

[0146] 2. PCR Amplification

[0147] Add 1 μL of amplification template, 5 μL of 100 μM D750-F and D750-R primers, and 40 μL of ddH2O to a 50 μL PCR system, and obtain the PCR product of sgRNA: CCAACATTGTATCAACAAGG (SEQ ID NO: 12) by denaturation annealing.

[0148] Element volume Nuclease-free water 40μL D750-F(100μM) 5μL D750-R(100μM) 5μL total 50μL

[0149] Use PCR instrument to amplify according to the program

[0150] step Number of cycles 95℃10min 1 55℃10min 1 14℃5min 1

[0151] The PCR product obtained by denaturation annealing was taken out from the PCR instrument and stored at 4°C to facilitate connection with the vector pYL-HU-U3-CCDB-tRNA (K1) (Wuhan Boyuan Biotechnology Co., Ltd., catalog number #REC40-1: Monocotyledon Gene Editing Vector Kit (Hyg)).

[0152] 4. Restriction Digestion and Ligation

[0153] The empty vector pYL-HU-U3-CCDB-tRNA (K1) (Wuhan Boyuan Biotechnology Co., Ltd., Catalog #REC40-1: Monocot Gene Editing Vector Kit (Hyg)) was ligated to the fragment by the BSAI one-step method (see Fig. 9 ), the system and reaction conditions are as follows:

[0154] Enzyme Digestion and Ligation System Element volume Nuclease-free water 8μL 10x Buffer 2μL BsaI / Eco31I(#RCA02) 1μL T4 Ligase 1μL pYL-HU-U3-CCDB-tRNA(K1) 4μL Recovering DNA 4μL total 20μL

[0155] Reaction conditions of enzyme digestion and ligation Number of cycles 37℃ 20min 1 37℃ 10min 5 20℃ 10min 5 37℃ 20min 1 80℃ 5min 1

[0156] 5. Transformation of competent cells with ligation products

[0157] According to the manufacturer's instructions, 5-10 μL of the ligation product was transformed into competent E. coli DH5α (produced by Shanghai Weidi Biotechnology Co., Ltd.), transformed into a plate coated with (kanamycin) resistance LB medium, and cultured at 37° C. for 12 hours.

[0158] 6. Plaque PCR Identification

[0159] Select 10 plaques, inoculate the bacteria in 1.5ml EP tube and perform PCR identification. The identification primers are as follows:

[0160] Hz5F:accggtaaggcgcgccgtagt(SEQ ID NO:16)

[0161] Hz5R:gcgattaagttgggtaacgccaggg(SEQ ID NO:17)

[0162] Amplify according to the following reaction system and procedure:

[0163] Reaction system:

[0164] Element volume Nuclease-free water 9.5μL 2x Biorun Magic PCR Mix(#RAA00) 12.5μL Hz5_F(100μM) 1μL Hz5_R(100μM) 1μL template 1μL total 25μL

[0165] Reaction Procedure

[0166] step Number of cycles 94℃ 5min 1 94℃ 30sec 30 50℃ 45sec 30 72℃ 22sec 30 72℃ 10min 1 16℃ 30min 1

[0167] The target band was 1035 bp. The bacterial solutions corresponding to the three positive bands were sent for sequencing, and the plasmids were extracted using the bacterial solutions with correct sequencing.

[0168] 7. Agrobacterium Preparation

[0169] 7.1 Plasmid transformation

[0170] Take 1 μL of the prepared plasmid and add it to 50 μL EHA105 Agrobacterium competent cells (Wuhan Boyuan Biotechnology Co., Ltd.), mix it thoroughly and then pipette it into an electroporation cup. After electroporation, add 1 mL of LB liquid culture medium, mix it thoroughly and then pipette it into a 1.5 mL centrifuge tube, and culture it in a shaker at 30°C and 180 rpm for 30 min. Pipette 50 μL of the activated Agrobacterium liquid and inoculate it on LB solid culture medium, and culture it in the dark at 30°C for 48 h.

[0171] 7.2 Agrobacterium detection

[0172] 7.2.1 Synthesize the corresponding detection primers;

[0173] F:gatcaccgacgagtacaagg(SEQ ID NO:18)

[0174] R:gggtacttctcgtggtaggc(SEQ ID NO:19)

[0175] Fragment size: 339 bp

[0176] 7.2.2 Select plaques for PCR identification. Prepare the PCR amplification system as shown in the following table. Mix thoroughly after preparation. Use a PCR instrument for amplification. Set the amplification program according to the primer information.

[0177] Components volume Forward primer (10 μM) 1μL Negative primer (10 μM) 1μL 2×Taq PCR Mix (#RAB00) 10μL <![CDATA[ddH2O]]> 7μL template 1μL total 20μL

[0178] 7.2.3 Gel electrophoresis detection: prepare 1% agarose gel (weigh 1.5g agarose powder and dissolve it in 150mL 1×TAE buffer, heat in a microwave oven for about 3 minutes until the liquid becomes transparent. Add EB to the gel plate, pour the dissolved agarose liquid into the gel plate, mix well, insert a comb, let it stand for 40 minutes, and when the gel turns milky white, it is ready), spot the sample, and complete the electrophoresis process.

[0179] 7.2.4 Check the PCR amplification results. If the electrophoresis bands of the positive control and sample are clear and of the correct size, and there are no bands in the negative control, it indicates that the sample can proceed to the next step.

[0180] 8. Rice genetic transformation

[0181] 8.1 Callus induction

[0182] Select Kitaake strain rice grains without mold spots and normal buds, disinfect them with 75% alcohol for 1 min, wash them with sterile water for 1 min each time; disinfect them with 15% sodium hypochlorite for 20 min, soak them in sterile water for 30 min, wash them 3 times for 1 min each time; the disinfected rice grains are inoculated into induction medium (N6B5 medium) and induced under full light at 27°C for 6-7 days.

[0183] The composition of the induction medium is as follows:

[0184]

[0185]

[0186] 8.2 Agrobacterium infection

[0187] Pick Agrobacterium in the infection solution and prepare OD 600= 0.2 of Agrobacterium resuspension, pick the callus tissue in 2.1 and place it in a triangular flask, add the Agrobacterium resuspension, and after infecting for 10-15 minutes, discard the bacterial solution and place it on the filter paper board to blow dry the bacterial solution on the callus surface for 1-2 hours, and then transfer the callus tissue to a layer of filter paper (co-culture medium) with infection solution for co-cultivation, and after air-drying for about half an hour, place it at 20℃ for co-cultivation for 48-72 hours.

[0188] The composition of the infection solution is as follows:

[0189]

[0190] 8.3 Callus screening

[0191] Wash the callus in 8.2 with cephalosporin water for 6 to 7 times, soak for 2 hours, blow dry on filter paper, inoculate on screening medium, and culture in the dark at 30℃ for 20-30 days; inoculate the positive callus grown on the screening medium to the secondary screening medium. Be sure to pick the single clone callus during the callus picking process, and culture in the dark at 30℃ for 7-10 days.

[0192] The screening medium components are as follows:

[0193]

[0194] 8.4 Differentiation and Rooting

[0195] The positive callus was inoculated into differentiation medium (MS medium + 2 mg / L (6-BA) + 0.5 mg / L naphthaleneacetic acid + 1 mg / L kinetin + 30 g / L sucrose + 3% sorbitol + 4 g / L phytogel, the final pH of the differentiation medium = 5.8), cultured at 27-30°C in full light for 15-20 days, and inoculated into rooting medium (1 / 2 MS medium) after 2-5 cm buds were differentiated, and cultured at 30°C in light for 7-10 days until the seedling stage (see Figure 4 ).

[0196] The components of differentiation medium are as follows:

[0197]

[0198]

[0199] The composition of the rooting medium is as follows:

[0200]

[0201] 8.5 Positive seedling detection

[0202] 8.5.1 Extraction of Rice Genomic DNA

[0203] Place leaves of about 2CM in the seedling stage in a centrifuge tube, put it in a -80℃ refrigerator and freeze it for 1h, break the sample with a tissue crusher, add 300μL of extraction solution containing 200mM PH8.0 Tris-HCL, 25mM PH8.0 EDTA, and 1% SDS, mix thoroughly, add 150μL 7.5M NH4AC solution, shake gently for 2min, centrifuge at 4000r / min for 15min, extract 200μL of supernatant and place it in a new centrifuge tube, add 2 times the volume of frozen anhydrous ethanol, centrifuge at 4000r / min for 15min, discard the supernatant, dry it thoroughly at room temperature, add double distilled water to dissolve the DNA, which is the genomic DNA of the sample to be tested, and store it at 4℃ for later use.

[0204] 8.5.2 Carry out PCR detection (PCR primers are the same as 1.2.1), and the detection method is the same as 7.2 Agrobacterium detection.

[0205] 8.5.3 The sample genomic DNA was sequenced (Beijing Bokaisen Biotechnology Co., Ltd.) to confirm the mutation. The results showed that two mutants were successfully obtained, cr-tgw7#5: one base A was inserted after the 1601st position of the TGW7 gene; and cr-tgw7#6: one base T was inserted after the 1600th position of the TGW7 gene.

[0206] 9. Rice cultivation and grain width detection

[0207] The gene-edited strains were planted in an artificial climate chamber until maturity, and 10 strains of wild-type Kitaake strain and tgw7 mutant strain were collected. The grain length, grain width and thousand-grain weight ( Fig. 7A and 7B The results showed that the grain length of the tgw7 mutant strains cr-tgw7#5 and cr-tgw7#6 was basically the same as that of the wild-type strain, and the grain width was significantly larger than that of the wild-type strain ( Fig. 7A and 7B ), and the thousand-grain weight was significantly greater than that of the wild-type strain ( Figure 7B ).

[0208] The reagents involved in the above culture medium formulas are all commercially available.

[0209] Example 4 Preparation of Rice TGW7 Gene Mutant (566+22)

[0210] 1. Chemical mutagenesis of rice panicles at the flowering stage of Kitaake rice strain

[0211] The panicles of the rice variety "Kitaake" were chemically mutagenized with a 1 mM MNU solution (N-methyl-N-nitrosourea) at pH 4.8 and a 1 mM phosphate buffer for 40 minutes during the flowering period of rice, specifically from 10:30 to 11:30 noon during the flowering period of rice. The pretreated "Kitaake" plants were moved from the field to pots of appropriate size, and 5 panicles were selected from each pot for marking. In order to control the panicle reproductive cells to be at the same growth stage during the MNU solution mutagenesis treatment, the unflowered spikelets in the marked panicles were cut off with small scissors.

[0212] 2. The plants with chemical mutations in the ear were grown in an artificial climate chamber (30°C, 12 h of light during the day; 22°C, 12 h of light at night; 60% humidity) until maturity and the seeds were harvested.

[0213] 3. Plant the seeds harvested by chemical mutagenesis in step 2, harvest the progeny rice seeds at maturity, compare the grain width and grain weight of the progeny seeds, select the progeny seeds with significantly increased grain width and thousand-grain weight, and name the mutant strain corresponding to the seed tgw7 (see Fig. 7A , Figure 7B , Figure 8 ). At the same time, the progeny seeds were deposited in the General Microbiology Center of China Microbiological Culture Collection Administration with the deposit number CGMCC No.46090, and the deposit date was August 26, 2024.

[0214] 3. By hybridizing the tgw7 mutant and the wild-type Kitaake rice plants, F1 seeds were obtained. The F1 seeds showed a phenotype similar to the wild type. The F2 generation population was further planted. Genetic analysis showed that the seeds of plants with wild-type phenotype and the seeds of plants with mutant phenotype had a 3:1 segregation ratio, indicating that the mutant phenotype was controlled by a single recessive nuclear gene.

[0215] 4. We further selected 76 typical individual strains with the mutant phenotype of the tgw7 mutant as a mixed pool, and performed genome resequencing comparative analysis simultaneously with the wild-type Kitaake (Beijing Bokaisen Biotechnology Co., Ltd.). We found that the TGW7 gene was missing two bases AA at positions 1699 and 1700 in its sequence, resulting in premature termination of protein translation, resulting in premature termination of TGW7 protein translation. The mutant protein was composed of the original 566 amino acids and the newly synthesized 22 amino acids (566+22).

[0216] 5. Verification of transgenic complementary function

[0217] The wild-type TGW7 gene (SEQ ID NO: 1) was transferred into the mutant by conventional methods, and the grain phenotype was observed to be restored (for results, see Fig.11 ). This indicates that the grain shape phenotype is caused by the TGW7 gene mutation.

[0218] 5.1 Vector construction

[0219] The plant binary expression plasmid pCAMBIA3300-UBI (Miaoling Biotechnology) was used to construct the TGW7 gene overexpression vector. Primers 750F / R were designed, and the full-length CDS sequence of the TGW7 gene (the gene has no introns) was amplified using rice Kitaake DNA as a template. At the same time, the pCAMBIA3300-UBI vector and gene fragment were double-digested with SacI and BamHI, and the linearized fragment was obtained after recovery. The full-length CDS of the TGW7 gene and the linearized vector were connected with T4 ligase. Enzyme digestion and sequencing verified the correct overexpression vector: pCAMBIA3300-UBI-TGW7.

[0220] pCAMBIA3300-UBI-TGW7 was transformed into competent Agrobacterium tumefaciens EHA105 to obtain pCAMBIA3300-UBI-TGW7 Agrobacterium culture liquid.

[0221] The primer sequences are as follows:

[0222] 750F:CAGgagctcATGATGCAGAGGCCGTTCCG (SEQ ID NO: 20)

[0223] 750R:AGAggatccTTACAACATGCTATCAGTTC(SEQ ID NO:21)

[0224] 5.2 Genetic transformation (specific transformation is the same as in Example 2)

[0225] In order to obtain the overexpression material of TGW7 gene, the overexpression vector pCAMBIA3300-UBI-TGW7 was transferred into the mutant tgw7 variety by Agrobacterium-mediated genetic transformation, and the grain shape phenotype was restored.

[0226] The primers for positive plant detection are:

[0227] UBI-F: CCTGCCTTCATACGCTAT(SEQ ID NO:22)

[0228] 750JCR:TGAGTACCCATCCAAACG(SEQ ID NO:23)

[0229] Detection fragment size 584bp

[0230] If the mutation is known, the above mutation can also be achieved in the rice TGW7 gene using conventional gene editing methods.

Claims

1. A mutant TGW7 gene, which comprises a mutation that inactivates the C-terminus of the encoded TGW7 protein compared to the wild-type TGW7 gene of SEQ ID NO: 1; Preferably, the mutation comprises: The AA bases at positions 1699 and 1700 of the sequence SEQ ID NO: 1 are deleted; or the TCTCATAT bases at positions 1678-1685 are deleted; or one base T is inserted after the 1600th position; or one base A is inserted after the 1601st position.

2. A protein expressed by the mutated TGW7 gene according to claim 1.

3. A gRNA molecule, the sequence of which includes SEQ ID NO:5 or SEQ ID NO:

13.

4. A method for obtaining the mutated TGW7 gene according to claim 1, comprising using the gRNA molecule according to claim 3 to perform gene editing on the wild-type TGW7 gene of sequence SEQ ID NO:

1.

5. A vector comprising the gRNA molecule according to claim 3; preferably, the vector is a pYL-HU-U3-CCDB-tRNA (K1) vector comprising the gRNA molecule.

6. Use of the mutated TGW7 gene according to claim 1, the protein according to claim 2, the gRNA molecule according to claim 3, or the vector according to claim 5 for increasing rice seed width or increasing rice yield.

7. A method for increasing the width of rice seeds or increasing rice yield, comprising inactivating the C-terminus of the TGW7 protein encoded by the wild-type TGW7 gene of SEQ ID NO: 1, thereby increasing the width of rice seeds or increasing rice yield.

8. The method according to claim 7, wherein the wild-type rice TGW7 gene of SEQ ID NO: 1 is mutated by chemical mutagenesis or gene editing, thereby inactivating the C-terminus of the encoded TGW7 protein; Preferably, the mutation of the rice TGW7 gene includes: The AA bases at positions 1699 and 1700 of the rice TGW7 gene are deleted; or the TCTCATAT bases at positions 1678-1685 of the rice TGW7 gene are deleted; or a T base is inserted after the 1600th position of the rice TGW7 gene; or a A base is inserted after the 1601st position of the rice TGW7 gene; More preferably, the gene editing method comprises using the gRNA molecule according to claim 3 to mutate the rice TGW7 gene; More preferably, the chemical mutagenesis method comprises radiation mutagenesis.

9. The method according to claim 7, wherein the method comprises transforming callus tissue or plant cells with the vector according to claim 5, and then regenerating rice plants from the callus tissue or plant cells, thereby obtaining rice plants with increased seed width or yield.

10. A method for preparing a rice plant, comprising transforming a rice callus or a plant cell with the vector according to claim 5, and then regenerating a rice plant from the callus or the plant cell.

Images