Tea tree CsTLP30 gene and application thereof in enhancing anthracnose resistance

Abstract

The invention discloses a tea tree CsTLP30 gene and application of the tea tree CsTLP30 gene in enhancing anthracnose resistance of tea trees, and belongs to the technical field of gene engineering. The nucleotide sequence of the CDS region of the tea tree CsTLP30 gene is as shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is as shown in SEQ ID NO.2. The tea tree CsTLP30 gene has the beneficial effects that the tea tree CsTLP30 gene has different expression quantities in regulation and control of tea tree anthracnose infection at different time points of anthracnose infected tea trees and can respond to germ infection at different time points, so that the biological function of mediating the anthracnose resistance of the tea trees is verified, and a key gene resource is provided for disease-resistant breeding of the tea trees.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a tea tree CsTLP30 gene and an application thereof in enhancing the anthracnose resistance of tea trees. Background Art

[0002] Tea is a major cash crop in my country. Tea contains a variety of nutrients such as flavonoids, theanine, and purine alkaloids. It is one of the most popular non-alcoholic beverages in the world and brings many health benefits to humans. However, with economic development and changes in tea garden management, tea gardens are threatened by diseases. Tea anthracnose is one of the main leaf fungal diseases, which mainly harms mature and old leaves, causing serious economic losses to tea production.

[0003] At present, research on tea anthracnose mainly focuses on differential expression analysis based on transcriptomics and proteomics. However, in the tea genome, many genes involved in defense have yet to be discovered, and their biological functions in mediating tea disease resistance are still unclear.

[0004] The Chinese patent application document with publication number CN118440954A discloses a tea tree CsLAC23 gene and its application in anti-anthracnose infection. The patent also proposes the application of the tea tree CsLAC23 gene in regulating tea tree anthracnose infection and in breeding new tea tree anthracnose resistant varieties. An antisense oligonucleotide for inhibiting the expression of the CsLAC23 gene is also proposed. After inhibiting the expression of the CsLAC23 gene and infecting the anthracnose bacteria, through tissue staining and determination of active oxygen content, it is found that the DAB and NBT staining effects of tea leaves after inhibiting the expression of the CsLAC223 gene are more obvious than those of the control group, and the activities of the key enzymes POD and SOD of the ROS scavenging system are lower than those of the control group. This shows that after inhibiting the expression of the CsLAC23 gene, the tea tree is more sensitive to infection by pathogens and more susceptible to anthracnose infection, indicating that CsLAC23 mediates the regulation of tea trees to resist anthracnose stress. There are no reports on whether other tea tree genes also have the effect of resisting anthrax infection. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to propose a new tea tree gene that can resist anthrax and apply it to resist anthrax infection.

[0006] The present invention solves the above technical problems through the following technical means:

[0007] The first aspect of the present invention provides a tea plant CsTLP30 gene, the nucleotide sequence of the CDS region of which is shown in SEQ ID NO.1.

[0008] The second aspect of the present invention provides a protein encoded by the tea plant CsTLP30 gene, whose amino acid sequence is shown in SEQ ID NO.2.

[0009] The third aspect of the present invention proposes the use of the above-mentioned tea plant CsTLP30 gene in regulating the sensitivity of tea plants to anthracnose.

[0010] The fourth aspect of the present invention proposes the use of the above-mentioned tea plant CsTLP30 gene in breeding to improve the anthracnose resistance of tea plants.

[0011] A fifth aspect of the present invention provides a tea tree model susceptible to anthracnose, which contains a product that inhibits the expression of the CsTLP30 gene.

[0012] Preferably, the product comprises an antisense oligonucleotide having a sequence as shown in SEQ ID NO.3.

[0013] A sixth aspect of the present invention provides a tobacco model resistant to anthrax, the model comprising a product of overexpressing the tea plant CsTLP30 gene in tobacco.

[0014] The seventh aspect of the present invention provides a tea plant expression vector pCAMBIA1305-CsTLP30, which is obtained by enzymatically cutting the fragment shown in SEQ ID NO: 1 into the pCAMBIA1305 vector.

[0015] The eighth aspect of the present invention provides a method for breeding anthracnose-resistant plant varieties, in which the tea plant CsTLP30 gene is introduced into the target plant to obtain a transgenic plant with improved anthracnose resistance.

[0016] Preferably, the method specifically comprises the following steps:

[0017] (1) Cloning of the tea plant CsTLP30 gene;

[0018] (2) Construction of tea plant CsTLP30 gene overexpression vector;

[0019] (3) The target plants were transformed with the tea plant CsTLP30 gene overexpression vector, and transgenic plants with improved anthracnose resistance were obtained after identification.

[0020] Preferably, the plants include tea trees and tobacco.

[0021] The beneficial effects of the present invention are:

[0022] 1. The present invention proposes the role of the tea tree CsTLP30 gene in regulating the anthracnose infection of tea trees. Its expression levels are different at different time points when the tea trees are infected with anthracnose, and it can respond to the infection of pathogens at different time points, thereby verifying its biological function of mediating the tea tree's resistance to anthracnose, and providing key gene resources for disease-resistant breeding of tea trees.

[0023] 2. The present invention inhibits the expression of CsTLP30 gene in tea trees and infects them with anthrax fungi. It is found that the lesion area is significantly larger than that of the control group. After NBT and DAB staining, it is found that the staining effect of tea leaves after inhibiting the expression of CsTLP30 gene is more obvious. The key enzymes POD and SOD for ROS scavenging activity are significantly lower than those in the control group, and the hydrogen peroxide content is significantly increased.

[0024] 3. The present invention transiently overexpressed the CsTLP30 gene in Nicotiana benthamiana and infected it with anthrax, and found that compared with the control, the yellowing and necrosis areas of the leaves were significantly reduced; the key enzymes POD and SOD for ROS scavenging activity were significantly higher than those in the control group, and the hydrogen peroxide content was significantly reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a diagram showing the expression pattern of the tea plant CsTLP30 gene at different time points of anthrax infection in Example 1 of the present invention;

[0026] Figure 2 This is a diagram showing the expression pattern of the tea plant CsTLP30 gene in different tissues in Example 1 of the present invention;

[0027] Figure 3 This is the subcellular localization map of the tea tree CsTLP30 protein in tobacco in Example 1 of the present invention;

[0028] Figure 4 The diagrams are histochemical staining, lesion area and antioxidant enzyme activity of leaves infected with anthrax and antisense inhibition of CsTLP30 gene in Example 1 of the present invention, wherein a is a phenotypic diagram of leaves under different treatment conditions after pathogen infection, b is a diagram of lesion area of ​​leaves in the treatment group (AsODN) and the control group (H2O and sODN), c is a diagram of H2O2 content in leaves of the treatment group (AsODN) and the control group (H2O and sODN), d is a diagram of POD enzyme activity in leaves of the treatment group (AsODN) and the control group (H2O and sODN), and e is a diagram of SOD enzyme activity in leaves of the treatment group (AsODN) and the control group (H2O and sODN);

[0029] Figure 5 1 is a graph showing the phenotype, lesion area and antioxidant enzyme activity of leaves after the CsTLP30 gene is transiently overexpressed in tobacco and infected with anthrax in Example 1 of the present invention, wherein a is a graph showing the position of tobacco leaves injected with the vector bacterial solution in the treatment group and the control group, b is a graph showing the leaf phenotype under natural light conditions, c is a graph showing the leaf phenotype under fluorescent irradiation, d is a statistical graph showing the lesion area of ​​tobacco leaves injected with the fusion expression vector (treatment group) and the empty vector (control), e is a graph showing the H2O2 content in tobacco leaves in the treatment group and the control group, f is a graph showing the POD enzyme activity in tobacco leaves in the treatment group and the control group, and g is a graph showing the SOD enzyme activity in tobacco leaves in the treatment group and the control group. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0031] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0032] If no specific technology or conditions are specified in the examples, they can be carried out according to the technology or conditions described in the literature in the field or according to the product instructions. Unless otherwise specified, the quantitative tests in the following examples are repeated more than three times, and the results are averaged.

[0033] Embodiment 1:

[0034] 1. Cloning of the CsTLP30 gene from tea plant

[0035] (1) Rapidly transfer the fresh or -85℃~-65℃ frozen Shucha Zaocha tea tree samples into a centrifuge tube with steel balls pre-added, and grind them into powder using a ball mill. RNA was extracted according to the instructions of Universal Plant Total RNA Isolation Kit (Novagen).

[0036] (2) Reverse transcription to generate the first strand: According to the instructions of the PrimeScript II 1st Strand cDNA Synthesis Kit (Takara Biotech, China), 1 μg of RNA was used as a template, 1 μL of Random 6mers, 1 μL of dNTP Mixture, and RNase-Free H2O were added to make up to 10 μL, and denatured at 65°C for 5 min, and immediately placed on ice for 2 min; then 4 μL of 5× PrimerScript buffer, 0.5 μL of RNase Inhibitor, 1 μL PrimerScript RTase, and ddH2O were added to the above reaction solution to make up to 20 μL, and incubated at 30°C for 10 min, 42°C for 1 h, 95°C for 5 min, and 70°C for 15 min. An appropriate amount of reverse transcription product (i.e., cDNA) was taken for subsequent PCR amplification.

[0037] (3) Using the first strand of cDNA as a template, the CsTLP30 gene was amplified by PCR.

[0038] The upstream primer is: 5'-TCCCAATATTGCTCCCAATCCA-3' (SEQ ID NO. 4),

[0039] Downstream primer: 5'-GTGCACATCACTACATGTGCTT-3' (SEQ ID NO. 5).

[0040] The 25 μL reaction system was: 12.5 μL LA Taq premix, 1 μL upstream and downstream primers, 1 μL template, 9.5 μL ddH2O. The PCR amplification program was: 94°C for 3 min, 94°C for 30 sec, 60°C for 30 sec, 72°C for 45 sec, 72°C for 10 min, 30 cycles.

[0041] (4) The PCR product obtained in (3) was recovered using a gel recovery kit and connected to a pEASY-T1 vector (Promega, Shanghai, China) to obtain a recombinant plasmid (denoted as pEASY-T1::CsTLP30), which was transformed into Escherichia coli competent cells Trans1-T1 and sent to Universal Biotechnology for sequencing to obtain the nucleotide sequence of the CsTLP30 gene, as specifically shown in SEQ ID NO.1. The amino acid sequence encoded by the CsTLP30 gene is specifically shown in SEQ ID NO.2.

[0042] 2. Expression pattern of CsTLP30 gene under anthrax infection

[0043] Select 2-year-old 'Longjing 43' cuttings with consistent growth and no diseases and insect pests, and culture them in the artificial climate room of Anhui Agricultural University (temperature 25°C, humidity 70%, 16h light, 8h dark). Use an inoculation needle to carefully inoculate the anthrax mycelium blocks on the PDA plate and culture them in the dark at 28°C for 7 to 10 days. Perform aseptic operations throughout the process. Add ddH2O to the plate, use a sterile coating stick to scrape the pathogen spores on the plate, filter with sterilized gauze, and transfer them to a sterile conical flask. Vortex with a vortexer to evenly distribute the fungal spores in the liquid. Count with a hemocytometer under an optical microscope, add sterile water for dilution, and prepare 10 7CFU / mL spore suspension. Wipe the second leaf of the tea seedling with 75% ethanol, and then wipe it with ddH2O, and let it stand until the water on the leaves evaporates. Use a pin to poke a plum blossom-shaped hole on the leaf, add 50ul of spore suspension on each side, and use sterile water for the control group; then wrap the leaf with plastic wrap, and then cover the entire tea seedling with a large plastic bag, and culture it in an artificial climate chamber, keeping the humidity above 70%. Take samples at 1, 4, 7, 10, and 13 days respectively and immediately put them into liquid nitrogen for quick freezing, and store them at -80℃ for later use.

[0044] The RNA was extracted and reverse transcribed into cDNA. The reverse transcription product was diluted 9 times as a template and used in 2×AceQUniversal qPCR. Master Mix (Vazyme, Nanjing, China), prepare 10 μL reaction system: 5 μL 2×AceQ Universal qPCR Master Mix, 1.2 μL diluted reverse transcription product, 0.3 μL upstream and downstream primers, 3.2 μL ddH2O, three biological replicates and three technical replicates for each sample. Then quantitative analysis was performed on the Bio-rad CFX instrument, the program included: 95℃3min, 95℃10sec, 54℃30sec, 65℃5sec, 95℃5sec, 39 cycles. qRT-PCR technology was used to detect the expression changes of CsTLP30 gene at different time points of anthrax infection. Figure 1 As shown in the figure, it can be seen that compared with the control group (clean water treatment), the expression level of CsTLP30 gene in the treatment group (anthracnose infection treatment) was significantly increased at 4, 7, 10, and 13 days, among which the expression level in the treatment group increased most significantly at 7 days.

[0045] 3. Expression pattern and subcellular localization of CsTLP30 gene in different tissues of tea plant

[0046] (1) Expression pattern of the CsTLP30 gene in different tissues of tea plants

[0047] Different tissues including buds, one leaf, two leaves, three leaves, mature leaves, stems, flowers and roots were obtained from the national tea tree variety 'Shucha Zao'. Samples of eight organs were used for total RNA extraction and first-strand cDNA synthesis. Quantitative analysis was as described above, and the results were as follows Figure 2 As shown, the CsTLP30 gene was expressed in eight organs, with the highest expression in fruit and stem and the lowest expression in root.

[0048] The upstream primer is: 5'-TCCCAATATTGCTCCCAATC-3' (SEQ ID NO.6),

[0049] Downstream primer: 5′-GTCAAGTTGTCGACCACCA-3′ (SEQ ID NO. 7).

[0050] (2) Subcellular localization of CsTLP30 protein in tea plant

[0051] ①Construction of target gene expression vector

[0052] The pCAMBIA1305 vector was double-digested with SpeⅠ and BamHI restriction endonucleases, reacted at 37℃ for 30min, and then subjected to agarose gel electrophoresis and gel recovery to obtain a linearized vector with restriction sites. The target gene plasmid was used as a template, and the plasmid was amplified with primers with restriction sites to obtain the target gene fragment with restriction sites. The upstream primer was 5'-GACAGCCCAGATCACTAGTATGAACTTCTTTAAATCTCTTTCC-3' (SEQ ID NO.8), and the downstream primer was 5'-CTTGCTCACCATGGATCCAGGGCAAAACACAACCTT ATA-3' (SEQ ID NO.9). The product with the restriction site linker sequence and the linearized vector were recombined with a recombinase, wherein the reaction system was 10 μL: 4 μL of the linearized pCAMBIA1305 vector, 3 μL of the product with the restriction site linker sequence, 1 μL of the recombinase E×naseⅡ, and 2 μL of 5×CEⅡBuffer were added to a 200 μL PCR tube. The reaction was carried out at 37℃ for 40 minutes. The recombined product was transformed into the competent E. coli cell Trans1-T1 and sent to General Biotech for sequencing to obtain the pCAMBIA1305-CsTLP30 plasmid.

[0053] ② Agrobacterium transformation and tobacco infection

[0054] Add 1uL of the above recombinant plasmid to the competent EHA105 Agrobacterium, place on ice for 5min, incubate at 37℃ for 5min, place on ice for 5min, add 400uL of liquid LB medium, shake on a shaker at 28℃ for 2h, and finally apply 200uL of bacterial solution on solid LB medium containing Kan+ resistance, and culture at 28℃ in the dark for 48h. Pick a single colony for PCR verification, and add 400uL of the colony containing Kan+ resistance to the one whose verification band position is consistent with the target band position. + Liquid LB medium with resistance was incubated at 28℃ for 8h. 100uL of bacterial solution was pipetted into 50mL containing Kan +The resistant liquid LB medium was cultured on a shaking platform at 28℃ for 12 hours until the OD value was between 0.8 and 1. The bacterial solution was centrifuged (5000r / min, 10min), the supernatant was discarded, the bacteria were resuspended with Agrobacterium resuspension solution, and the OD value of the resuspended bacterial solution at 600nm was 0.4-0.6 using a UV spectrophotometer. It was left to stand at room temperature for 1 hour. The bacterial solution was injected into the tobacco leaves with a syringe to fill the entire leaf, and placed in the dark in an artificial climate chamber for 48 hours.

[0055] Carefully cut off the infected tobacco leaves with a blade, make a glass slide with the back facing up, and observe the GFP signal under laser confocal microscope. Figure 3 As shown, the bright field shows the outline of tobacco cells, the GFP signal shows the cell location of the CsTLP 30 protein, and DAPI is the positive control. The merging of the bright field, DAPI and GFP signal images shows that the luminescent position of the CsT LP30 recombinant protein is consistent with the positive control, which shows that CsTLP30 is localized in the cell nucleus.

[0056] 4. Antisense inhibition to verify the anti-anthrax function of CsTLP30

[0057] (1) Design of antisense inhibition probes

[0058] Three antisense oligonucleotides and a control sense oligonucleotide were designed according to the gene sequence of CsLAC23. The specific names and sequences are as follows:

[0059] AsODN1: 5'-TGTTCCATCAAAAGTGCAGC-3'; (SEQ ID NO.3)

[0060] AsODN2: 5'-GTTGTTGAATTGGTTTAGTG-3'; (SEQ ID NO.10)

[0061] AsODN3: 5'-AGTCTGATCATCCTTGGGGT-3'; (SEQ ID NO. 11)

[0062] sODN:5'-CTATGCACGGGAAGAGGTGG-3'. (SEQ ID NO.12)

[0063] The designed probe was sent to Shanghai Sangon Biotechnology Co., Ltd. for synthesis and diluted to a concentration of 100 μM with ddH2O.

[0064] (2) Antisense inhibition and anthrax infection

[0065] ① Select one-year-old 'Longjing 43' cuttings with consistent growth potential and no pests and diseases, inject the diluted probe into the second leaf with a 1mL syringe, use water and random strands as controls, take the second leaf 12 hours later and put it into liquid nitrogen for quick freezing, extract RNA, and use the cDNA obtained by reverse transcription as a template for qPCR verification and screening of the best probe (SEQ ID NO.3). Inject the tea seedlings with the best probe screened in the above step, and inject water and random strand primers at the same time, extract RNA at 8, 12, and 24 hours, and perform fluorescence quantitative PCR verification after reverse transcription to screen out the time point with the best inhibition effect.

[0066] ② Treat tea seedlings with the best antisense probes, and use water and random chains as controls. 12 hours later, infect tea leaves with anthrax spore suspension. Take leaves 3 days after infection and leaves in the control group and measure their Fv / Fm using IMAGE-PAM modulated fluorescence instrument (WALZ, Germany).

[0067] ③ Histochemical staining of tea leaves after antisense inhibition

[0068] Tea leaves whose CsTLP30 gene had been suppressed for 12 hours were taken and infected with anthrax spore suspension. After 3 days, the infected leaves were carefully removed to analyze the degree of damage. The specific steps are as follows: prepare 50mM sodium phosphate buffer (16mL 1M sodium dihydrogen phosphate, 84mL 1M sodium dihydrogen phosphate, pure water to 2L, pH adjusted to 7.5), nitro blue tetrazolium (NBT) staining solution (0.1g NBT dissolved in 50mL sodium phosphate buffer), 3,3'-diaminobenzidine (DAB) staining solution (0.05g DAB dissolved in 45mL sodium phosphate buffer, pH adjusted to 3.8, and finally made up to 50mL with sodium phosphate buffer); take the inoculated leaves and put them into NBT and DAB staining solutions respectively, where NBT staining was incubated at 37℃ for 3h and DAB staining was incubated at 37℃ for 8h; the stained leaves were placed in 95% alcohol to remove chlorophyll and the leaf phenotype was observed. According to Figure 4 It can be seen that the color of the lesions on the tea leaves treated with AsODN1 solution is darker than that of the control group (sODN) and the blank group (ddH2O), and the lesion area is significantly higher than that of the control group and the blank group.

[0069] ④Determination of peroxidase activity and hydrogen peroxide content

[0070] The activities of peroxidase (POD) and superoxide dismutase (SOD) were measured on tea leaves after antisense inhibition and 3 days of pathogen infection. The specific steps are as follows: extract the total protein of the sample, weigh 0.06g of the sample and grind it into powder with liquid nitrogen, then transfer it to a mortar pre-cooled on ice, add 540uL 10×PBS, and grind it into a homogenate on ice; centrifuge at 12,000g for 10 minutes, and take the supernatant for testing; detect the activity of POD and SOD enzymes according to the instructions of the POD and SOD test kit (Nanjing Jiancheng). The results are as follows Figure 4 As shown in the figure, after anthracnose fungi infect tea leaves, the POD and SOD enzyme activities decreased significantly, and the H2O2 content decreased significantly after inhibiting the expression of the CsTLP30 gene, compared with the ddH2O and sODN treatments. It is speculated that after the CsTLP30 gene is inhibited, the tea leaves accumulate more ROS, which makes them more sensitive to the infection of pathogens and more susceptible to anthracnose infection, indicating that CsTLP30 mediates the regulation of tea trees to resist anthracnose stress.

[0071] 5. Tobacco transient expression to verify the anti-anthracnose function of CsTLP30

[0072] (1) Transform the pCAMBIA1305-CsTLP30 plasmid into Agrobacterium and shake it after verification. Select Nicotiana benthamiana leaves that have grown for about 3 weeks and have the same growth pattern. Divide the tobacco leaves into 4 parts, namely:

[0073] ①pCAMBIA1305-CsTLP30+Blank②pCAMBIA1305+Blank

[0074] ③pCAMBIA1305-CsTLP30+Cg④pCAMBIA1305+Cg. Use a syringe to inject the bacterial solution of pCAMBIA1305 and pCAMBIA1305-CsTLP30 into the tobacco plant, ensuring that the injection volume of the two bacterial solutions is equal.

[0075] (2) After 48 hours, a plum blossom-shaped hole was pierced at the injection site with a pin, and then the leaves were infected with anthrax hyphae blocks, wrapped with plastic wrap, and blank culture medium was used as a control. After 2 days, the tobacco phenotype was observed and photographed. The results showed that the tobacco leaves that were not infected with anthrax hyphae blocks had no obvious phenotype, and the corresponding chlorophyll fluorescence did not change significantly; after infection with anthrax hyphae blocks, the tobacco leaves turned yellow significantly, and the leaves in the control area were very dark yellow and had begun to necrotize. Chlorophyll fluorescence showed that compared with the pCAMBIA-1305 empty load, the lesion area of ​​tobacco leaves after overexpressing CsTLP30 became smaller, the degree of lesions was milder, and the number of yellow areas was also less. The calculation of the lesion area found that after overexpressing CsTLP30, the lesion area of ​​tobacco leaves was significantly reduced compared with the control group.

[0076] (3) Determination of peroxidase activity and hydrogen peroxide content

[0077] Tobacco leaves were sampled from different areas and immediately frozen in liquid nitrogen. The contents of active oxygen and hydrogen peroxide were then determined according to the method in 5 above. Figure 5 Compared with the control, the activities of POD, SOD and H2O2 increased significantly after anthrax treatment; compared with the pCAMBIA-1305 empty load, tobacco leaves were less damaged after overexpressing CsTLP30, and its peroxidase POD and superoxide dismutase SOD activities increased significantly, while the H2O2 content decreased significantly, indicating that CsTLP30 mediates tea plants' resistance to anthrax infection.

[0078] The nucleotide sequence shown in SEQ ID NO.1 of the present invention is specifically:

[0079] 5’-ATGAACTTCTTTAAATCTCTTTCCCTTCCCATTTTCTTTTTCATTGCTCTCCTC TCCACCTACAGCCATGCAGCCACTATCAACATCATAAACAATTGCCCTTTTACTGTTTGGGCTGCTGCCGTACCCGGTGGTGGTCGACAACTTGACCGCGGCCAAACATGGGCCATCAACCCTCCTGCAGGCACAAAGGGAGCCCGGGTATGGGCCCGGACCGGCTGCACCTTTGATGGAACAGGTCGGGGCAGGTGCCAGACCGGTGACTGTAACGGGCTCCGCGAGTGCCAAGCTTATGGTGCACCCCCTAACACACTAGCTGAATATGCACTAAACCAATTCAACAACTTAGACTTCTTTGACATATCCCTGGTGGACGGGTTCAATGTGCCGATGGATTTTAGCCCTACCTCCAATGGGTGCACCCGGGGTATCAAATGTACTGTGGATATAAAAGGGCAGTGCCCGAATGAGTTGCGGGCACCGGGCGGGTGTAATAACCCGTGTACCGTATTTAAGACCGATCAGTATTGTTGCAATTCTGGAAACTGTGGACCCACAAATTATTCAAGGTTTTTCAAGGATAGATGCCCAGATGCATATAGTTACCCTAAGGATGATCAGACAAGCACATTTACTTGCAATGGGGGAACCAACTATAAGGTTGTGTTTTGCCCTTAA-3’

[0080] The amino acid sequence shown in SEQ ID NO.2 according to the present invention is specifically: MNFFKSLSLPIFFFIALLSTYSHAATINIINNCPFTVWAAAVPGGGRQLDRGQTWAINPPAGTKGARVWARTGCTFDGTGRGRCQTGDCNGLRECQAYGAPPNTLAEYALNQFNNLDFFDISLVDGFNVPMDFSPTSNGCTRGIKCTVDIKGQCPNELRAPGGCNNPCTVFKTDQYCCNSGNCGPTNYSRFFKDRCPDAYSYPKDDQTSTFTCNGGTNYKVVFCP

[0081] The nucleotide sequence shown in SEQ ID NO.3 of the present invention is specifically: 5'-TGTTCCATCAAAGGTGCAGC-3'

[0082] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Tea tree CsTLP30 gene, characterized in that The nucleotide sequence of its CDS region is shown in SEQ ID NO.

1.

2. The protein encoded by the tea plant CsTLP30 gene according to claim 1, characterized in that Its amino acid sequence is shown in SEQ ID NO.

2.

3. Use of the tea plant CsTLP30 gene according to claim 1 in regulating the sensitivity of tea plants to anthracnose.

4. Use of the tea plant CsTLP30 gene according to claim 1 in breeding for improving tea plant anthracnose resistance.

5. A tea tree model susceptible to anthrax, characterized in that: The model contains a product that inhibits the expression of the tea plant CsTLP30 gene as described in claim 1.

6. The anthrax-sensitive tea tree model according to claim 5, characterized in that: The product comprises an antisense oligonucleotide having a sequence as shown in SEQ ID NO.

3.

7. A tobacco model resistant to anthrax, characterized in that: The model contains the product of overexpressing the tea tree CsTLP30 gene of claim 1 in tobacco.

8. A tea plant expression vector pCAMBIA1305-CsTLP30, characterized in that: The fragment is obtained by enzymatically cutting the fragment shown in SEQ ID NO: 1 into the pCAMBIA1305 vector.

9. A method for breeding anthracnose-resistant plant varieties, characterized in that: The tea plant CsTLP30 gene described in claim 1 is introduced into the target plant to obtain a transgenic plant with improved anthracnose resistance.

10. The cultivation method according to claim 9, characterized in that: The specific steps include: (1) Cloning of the tea plant CsTLP30 gene; (2) Construction of tea plant CsTLP30 gene overexpression vector; (3) The target plants were transformed with the tea plant CsTLP30 gene overexpression vector, and transgenic plants with improved anthracnose resistance were obtained after identification.

Images