Rice grain weight and zinc content coordinated regulation gene GZ and application thereof

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice grain weight and zinc content synergistic regulation gene GZ and application thereof. The invention discloses a rice grain weight and zinc content coordinated regulation gene GZ. The nucleotide sequence of the gene GZ is shown as SEQ ID NO: 1; the CDNA sequence of the gene GZ is as shown in SEQ ID NO: 2. The application of the gene GZ is to increase the weight and zinc content of rice grains.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a rice grain weight and zinc content coordinated regulatory gene GZ and an application thereof. Background Art

[0002] Some people in the world are facing the threat of "hidden hunger", that is, people are full but suffer from various deficiency diseases due to unbalanced nutrition, such as stunted growth and development and decreased immunity caused by zinc or iron deficiency. Rice, as a staple food, mainly provides most of the required calories through carbohydrates, but the content of essential micronutrients such as zinc and iron is low, which cannot meet the comprehensive nutritional needs. By regulating the plant absorption and transport process, rice biofortification can increase the content of essential micronutrients such as zinc and iron, thereby enriching these nutrients in the grain. Overexpression of ZRT and IRT-like protein 9 (OsZIP9) can significantly increase the zinc content in brown rice and other tissues. Overexpression of OsIRT1, which encodes a ferrous ion transporter, can simultaneously increase the zinc and iron content in grains. The synthesis of metal ion chelator nicotinamide (NA), which helps maintain metal homeostasis, plays a key role in increasing mineral content; overexpression of NA synthase can increase the iron and zinc content in brown rice. In addition, the rice NA aminotransferase mutant naat1 blocked the biosynthesis of xylan-based plant siderophores, thereby enhancing the absorption of Fe(II), resulting in an increase in the iron content of both brown and polished rice. However, improving the nutritional level of rice often comes at the expense of biomass, so balancing grain nutrition and weight is an effective strategy for developing high-yield and nutritious rice varieties. Grain weight is a key factor affecting yield, which is mainly determined by the dimensions of the grain, such as width, length, and thickness. GS3 encodes the γ subunit of the G protein and negatively regulates grain length and thousand-grain weight. The qGL3.3 / qTGW3 gene, which encodes a glycogen synthase kinase 3-like protein kinase, also negatively regulates these traits. The RING-type E3 ubiquitin ligases encoded by GW2, WLG, and CLG1 regulate rice grain size / weight. In addition, by clustering quantitative trait loci / genes such as gw8 and GW7TFA with gs3, high-yield and high-quality rice varieties can be bred. Currently, there are few reports on how to simultaneously control essential micronutrients and grain weight, and how to conveniently obtain energy and nutrition at the same time remains a major challenge.

[0003] As the staple food source for a large number of people around the world, rice (Oryza sativa) is of great importance. In order to address the widespread "hidden hunger" problem worldwide, identifying genes that can synergistically regulate zinc content and grain weight and cultivating new rice varieties that are both high-yielding and rich in nutrition has become a key task and urgent need in current agricultural scientific research. The realization of this goal will not only bring revolutionary changes to global food production, but also provide strong support for solving health problems caused by unbalanced nutrition.

[0004] The accession number of the Os01g0142100 genome in the GenBank is 34833 (its nucleotide sequence is shown in SEQ ID NO: 4), but its function is currently unknown. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a rice grain weight and zinc content coordinated regulatory gene GZ and its application.

[0006] In order to solve the above technical problems, the present invention provides a rice grain weight and zinc content coordinated regulatory gene GZ, the nucleotide sequence of gene GZ is shown in SEQ ID NO: 1. The CDNA sequence of gene GZ is shown in SEQ ID NO: 2.

[0007] As an improvement of the gene of the present invention: the nucleotide sequence also includes mutants, alleles or derivatives generated by adding, replacing, inserting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO:1.

[0008] The present invention also provides a protein encoded by the rice grain weight and zinc content coordinated regulatory gene GZ, the amino acid sequence of which is as described in SEQ ID NO:3.

[0009] As an improvement of the protein of the present invention: the amino acid sequence also includes an amino acid sequence or derivative generated by adding, replacing, inserting or deleting one or more amino acids or homologous sequences of other species in the amino acid sequence shown in SEQ ID NO: 3.

[0010] The invention also provides plasmids, plant expression vectors, recombinant vectors and transformants containing the gene.

[0011] The invention also provides the use of the rice grain weight and zinc content coordinated regulatory gene GZ: increasing the rice grain weight and zinc content.

[0012] As an improvement on the use of the rice grain weight and zinc content coordinated regulatory gene GZ of the present invention: the gramineous plant is rice, and the thousand-grain weight and zinc content of the rice grains are increased, thereby improving the rice yield and nutritional quality.

[0013] The present invention also provides a method for coordinated regulation of gramineous plant grain morphology and quality: comprising transforming gramineous plant (eg, rice) cells with the above-mentioned gene GZ, and then cultivating the transformed gramineous plant cells into plants, wherein the grains of the plants increase in weight and zinc content.

[0014] As an improvement to the coordinated regulation method for grain morphology and quality of Gramineae plants of the present invention: the size and zinc content of the grains are increased.

[0015] The present invention also provides a plasmid containing the above gene, and an engineered bacterium or a host cell containing the gene or the vector.

[0016] The engineered bacteria and host cells can be understood as the engineered bacteria or host cells used by those skilled in the art in the transgenic process. However, with the development of science and technology, the selection of the engineered bacteria and host cells may change, or in the application field of non-transgenic purposes, the use of vectors and engineered bacteria is also involved, but as long as they contain the gene or vector of the present invention, they are within the protection scope of the present invention.

[0017] Furthermore, the present invention also provides a host cell, which contains a gene sequence and is an Escherichia coli cell, an Agrobacterium cell or a plant cell.

[0018] Another object of the present invention is to provide the use of the above gene in genetically modified crops.

[0019] The present invention also provides a method for influencing rice grain weight and zinc content by transforming plant cells using a plant expression vector, specifically, influencing rice yield and nutritional quality by transforming plant cells using a plant expression vector.

[0020] The preparation of transgenic rice is a conventional technical means in the art, and the present invention is not otherwise limited thereto. Technical solutions for rice transgenic using the gene of the present invention are all within the protection scope of the present invention.

[0021] Specifically, the present invention relates to a method for isolating a gene in rice that positively regulates both grain weight and zinc content by using map-based cloning technology. G RAIN WEIGHT AND Z INC CONTENT (GZ), and the use of transgenic complementation and overexpression experiments to identify the function of the gene; it also involves using the gene to study the molecular mechanism of the coordinated regulation of rice grain size and zinc content, in order to increase rice yield and improve rice nutritional quality, in order to solve the "hidden hunger" caused by nutritional imbalance, and provide a new zinc biofortification strategy to ensure food safety and health safety.

[0022] The specific technical steps for implementing the present invention are as follows:

[0023] 1. Isolation and genetic analysis of mutant gz:

[0024] The rice grain weight mutant gz of the present invention is a mutation induced by EMS (Ethyl Methyl Sulfonate) in the indica rice Taichung Native 1 (TN1). Through forward and reverse cross experiments with the wild type, it is proved that the mutant is controlled by a recessive single gene, such as Figure 1 and Figure 2 shown.

[0025] 2. Comparison of mutant gz and wild-type grains

[0026] The grain size of mutant gz and wild type was observed at maturity. Compared with wild type, the length, width and thousand-grain weight of mutant gz grains were significantly reduced (e.g. Figure 1 shown).

[0027] 3. Map-based cloning of GZ gene:

[0028] 1) Preliminary localization of the GZ gene

[0029] In order to isolate the GZ gene, the present invention first constructed a positioning population, which was formed by hybridizing gz with the japonica rice variety Wuyunjing No. 7 (W7) to form an F2 positioning population, and then the GZ locus was preliminarily located using molecular markers by the method of positional cloning, and was preliminarily located between markers B1-2 and B1-3 on chromosome 1 ( Figure 2 shown).

[0030] 2) Fine positioning of the GZ gene

[0031] By analyzing the sequence between markers B1-2 and B1-3, developing new polymorphic markers will eventually accurately locate the GZ gene between markers D1-5 and 1D-4, within a range of approximately 39 kb ( Figure 2 ), and candidate genes were predicted by analyzing the open reading frames (ORFs) in this segment.

[0032] 3) GZ gene function analysis

[0033] Through transgenic technology, the results showed that the present invention obtained a transgenic rice that restored the mutant's grain size and zinc content to normal phenotypes ( Figure 2 and Figure 4 ), proving that the present invention correctly cloned the GZ gene, and amino acid sequence analysis and enzyme activity experiments showed that GZ encodes a zinc-dependent metalloenzyme protein ( Figure 4and SEQ ID No: 3). At the same time, overexpression was performed to transform wild-type plants, and it was found that the grain weight and zinc content of transgenic positive plants increased significantly ( Figure 4 ).

[0034] In summary, the phenomenon of "hidden hunger" is severe worldwide, and the problem of nutritional imbalance is becoming increasingly prominent. As a staple food, rice lacks key trace elements such as zinc and iron, which has become a bottleneck restricting the comprehensiveness of nutrition. In order to meet this challenge, the present invention actively seeks genes that can simultaneously regulate rice grain weight and zinc content, in order to cultivate new rice varieties that are both high-yielding and nutritious. Against this background, an important breakthrough came into being: the present invention successfully cloned the GZ gene with the help of rice grain weight mutants and the use of map-based cloning technology. The GZ gene uniquely encodes a zinc-dependent metalloenzyme protein, which can effectively increase the zinc content in rice while promoting the increase in grain weight. This discovery not only opens up a new path for the improvement of rice varieties, but also contributes valuable scientific and technological resources to global food security and nutritional health protection, and promotes the development of the food production system in a healthier and more sustainable direction.

[0035] Therefore, in order to solve the "hidden hunger" caused by nutritional imbalance, the present invention provides a new zinc biofortification strategy to ensure food safety and health safety. That is, the present invention provides a gene and its protein that can simultaneously positively regulate rice grain weight and zinc content, thereby obtaining transgenic plant cells, and at the same time using the gene to synergistically improve rice yield and nutritional quality through molecular marker-assisted selection or transgenic methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0037] Figure 1 is the phenotype of wild-type and gz mutant kernels;

[0038] Figure 1 Middle: A is the phenotype diagram of grain length (left) and grain width (right) of TN1 and gz; BD are the statistical diagrams of grain length, grain width and 1000-grain weight, respectively; t-test, P<0.05 is *, P<0.01 is **.

[0039] Figure 2 It is the cloning and verification of the GZ gene;

[0040] Figure 2 Middle: A is the positional cloning map of the GZ gene; B is the phenotype of grain length (left) and grain width (right) of TN1, gz and complementary plant GZ-CO1 / 2; CE are statistical graphs of grain length, grain width and 1000-grain weight, respectively. t-test, P<0.05 is *, P<0.01 is **.

[0041] Figure 3 is the grain size analysis of GZ gene overexpressing plants;

[0042] Figure 3 Middle: A is the phenotype of grain length (left) and grain width (right) of TN1 and overexpression plant GZ-OE1 / 2; BD are statistical graphs of grain length, grain width and 1000-grain weight, respectively; t-test, P<0.05 is *, P<0.01 is **.

[0043] Figure 4 is the analysis of GZ protease activity and zinc content in grains of overexpressing plants;

[0044] Figure 4 Middle: A is the analysis of GZ metalloproteinase activity; B is the statistical graph of zinc content in the grains of TN1, gz and overexpression plant GZ-OE1 / 2; Lane 1, before incubation (1.25 μM Zn-Ac); Lanes 2-6, incubated with Zn-Ac (0-5 μM) for 1 hour; Lane 7, incubated without GST-ZG for 1 hour; t-test, P<0.05 is *, P<0.01 is **. DETAILED DESCRIPTION

[0045] The nucleotide sequence of TN1 (Os01g0142100 genome) is shown in SEQ ID NO:4; the cDNA of TN1 is shown in SEQ ID NO:5.

[0046] Embodiment 1:

[0047] 1. Rice materials:

[0048] Rice (Oryza sativa L.) mutant gz, the original wild-type material is the indica rice variety TN1. The gz mutant is a mutation generated by EMS (Ethyl Methyl Sulfonate) mutagenesis of TN1 ( Figure 1 ).

[0049] The specific mutagenesis process is as follows: first soak TN1 seeds in deionized water for 5 hours, then pour out the water. Treat the soaked seeds with 0.8% to 1% EMS for 10 to 12 hours, then pour out the EMS treatment solution. Then rinse the seeds with tap water for 8 to 10 hours, then germinate and sow, and obtain the gz mutant through offspring screening.

[0050] The grain size of the mutant gz and the wild type (TN1) was observed at maturity. Compared with the wild type, the length, width and thousand-grain weight of the mutant gz grains were significantly reduced ( Figure 1 ).

[0051] 2. Analyze and position the group:

[0052] Through the reciprocal cross experiment between the gz mutant and W7, it was shown that the mutant was controlled by a recessive single gene. The homozygous gz mutant was crossed with the japonica rice variety W7, the F1 generation was self-pollinated, and 583 individuals with small grain phenotype were selected from the F2 population as the positioning population. About 1 gram of young leaves were taken from each plant at the heading stage to extract total DNA.

[0053] 3. DNA extraction

[0054] The genomic DNA for gene localization was extracted from rice leaves using a rapid rice trace DNA extraction method. About 0.5 g of rice leaves were taken, frozen by liquid nitrogen, ground into powder in a small mortar with a diameter of 5 cm, and transferred to a 2.0 ml centrifuge tube to extract DNA. The obtained DNA precipitate was dissolved in 600 μl of ultrapure water. 1.0 μl of DNA sample was used for each PCR reaction.

[0055] 4. Preliminary localization of the GZ gene

[0056] 96 recessive individuals were randomly selected from the 583 recessive individuals in the F2 population of the cross combination of the gz mutant and W7, and a small population was formed for polymorphism analysis. According to the primers evenly distributed on the 12 chromosomes in this laboratory, PCR amplification was performed according to the known reaction conditions for linkage analysis. The PCR amplification conditions are as follows: the total PCR reaction system is 10μl: 100ng / μl rice genomic DNA 1μl, 10×PCR Buffer 1μl, 2mM dNTP 1μl, 10uM primer 2μl, 5U / μl rTaq 0.05μl, ddH2O 4.95μl. The specific PCR amplification conditions were as follows: 94°C pre-denaturation for 5 minutes; 94°C denaturation for 30 seconds, 55°C annealing for 30 seconds, 72°C extension for 30 seconds, 35 cycles, 4% agarose gel electrophoresis separation and Gelred nucleic acid dye staining to detect the polymorphism of PCR products, and the GZ gene was preliminarily located between markers B1-2 and B1-3 on chromosome 1 ( Figure 2 ).

[0057] 5. Fine positioning of the GZ gene

[0058] Using the remaining 487 recessive individuals in the F2 population of the gz mutant combined with W7, molecular markers were further designed based on the initial positioning, and the GZ gene was finally accurately located in the approximately 39kb interval between markers D1-5 and 1D-4 ( Figure 2 ). The primer sequences are shown in Table 1:

[0059] Table 1 Location marker sequence of LGS1 gene

[0060] Tag Name Forward primer (5'-3') Back primer (5'-3') B1-2 TTCTCAGCTGCTTGTGCATC CCTCCAAGGTAAAGGGGTTC B1-3 ATCCCAACTCTAAGCCACCC CTACCCGTCACCAACTCACC D1-5 TTGAACAAGTTAACAAAAGGTAGCTC TTGGGAGAACGTGACAAGGT 1D-4 AACCTGTGGTACCAAAACATGTAA CCACCCAGCTTCTTTCCTAA

[0061] 6. Gene prediction and comparative analysis:

[0062] According to the results of fine mapping, within the 39kb range, according to the prediction of the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / ), 13 candidate genes were found in the interval. By designing sequencing primers, the candidate genes were amplified from the gz mutant and wild-type TN1 genomes by PCR and sequenced. It was found that the gz mutant had a single base mutation on the Os01g0142100 genome (SEQ ID NO: 4), resulting in the mutation of glycine to aspartic acid. The results were verified three times and the same results were obtained, proving its accuracy (such as Figure 2 According to the gene annotation information of the sequence (NCBI), it is predicted that this gene encodes an expressed protein. The GZ gene has a nucleotide sequence as shown in SEQ ID NO: 1, a cDNA sequence as shown in SEQ ID NO: 2, and the protein it encodes has an amino acid sequence as shown in SEQ ID NO: 3.

[0063] The PCR reaction system is: 100ng / μl rice genomic DNA 2μl, GXL Buffer 10μl, 2.5mM dNTP 4μl, 10μM primer 4μl, GXL DNA Polymerase 4μl, ddH2O 26μl, total system 50μl. PCR amplification conditions are as follows: 94℃ pre-denaturation for 2 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 15 seconds, 68℃ extension for 70 seconds, 30 cycles, 1% agarose gel electrophoresis, gel excision, transfer into Escherichia coli, and selection of positive single clones for sequencing. GZ gene sequencing primers are as follows: GZCX-1F:GCAGGTCGACTCTAGAGCTTCTTGCTTTGCATGGTCG and GZCX-1R:ATTCGAGCTCGGTACCGACTCGCCCAACTGCCTT. The sequencing results show that Os01g0142100 mutates from glycine to aspartic acid in the mutant, thus proving that Os01g0142100 is a candidate gene for GZ.

[0064] 7. Analysis of enzyme activity and zinc content:

[0065] The proteolytic activity of ZG was tested using β-casein as a substrate. The method was as follows: GZ-GST recombinant protein was expressed in Escherichia coli and purified by GST affinity column. The protease activity assay was performed at 37°C, and the reaction buffer contained 50 mM Tris-acetate (pH 8.0), 80 mM NaCl, 5 mM magnesium acetate, 12.5 μM zinc acetate, and 100 μg / ml bovine serum albumin (BSA). Two protease inhibitors were used during the reaction: o-phenanthroline (10 mM, Sigma) and Complete (EDTA-free). After the reaction, the samples were analyzed by SDS-PAGE using 12%–20% acrylamide gels and then stained with Coomassie Brilliant Blue R-250. Finally, β-casein was quantified using ImageJ.

[0066] In the absence of zinc ions, the metalloproteinase activity of ZG protein was significantly reduced ( Figure 4 ). At the same time, the present invention measured the zinc content in the grains of TN1, zg and the overexpression plant GZ-OE1 / 2. The zinc content of the grains of GZ-OE1 / 2 increased significantly, while the zinc content of zg was lower than that of the wild type ( Figure 4 ).

[0067] Example 2

[0068] Plant transformation:

[0069] By using homologous recombination and PCR technology, the restriction sites of Xba1 and Kpn1 were introduced into the amplification primers respectively. The amplification primers were: GZcom-1F: GCAGGTCGACTCTAGAGCTTCTTGCTTTGCATGGTCG, GZcom-1R: ATTCGAGCTCGGTACCGACTCGCCCAACTGCCTT, and the annealing temperature was 60°C. The front primer contained a HindIII restriction site, and the rear primer contained an EcoRI restriction site. The primers were used to PCR amplify the DNA of TN1 (SEQ ID NO: 4), and the 9982bp fragment was recovered and purified after electrophoresis. At the same time, the pCAMBIA1300 vector was also double-digested with Xba1 and Kpn1, and the recovered and purified fragments of the correct size were connected to the vector after restriction digestion for Escherichia coli transformation, and the positive single clones were selected for sequencing. The correct transformation vector pCA1300-GZ was obtained and transferred into the Agrobacterium tumefaciens strain LBA4404 by electroporation to transform the rice gz mutant. The callus tissue induced by the mutant seeds was cultured in the induction medium for 3 weeks, and the vigorously growing callus was selected as the recipient of transformation. The rice callus was infected with the LBA4404 strain containing the recombinant plasmid vector, and after co-cultured in the dark and 25°C for 3 days, it was cultured on the screening medium containing 300mg / L G418. The resistant callus was cultured on the pre-differentiation medium containing 250mg / L G418 for about 10 days. The pre-differentiated callus was transferred to the differentiation medium and cultured under light and 25°C. Resistant transgenic plants (complementary plants GZ-CO1 and GZ-CO2) were obtained in about one month, and then transplanted into the field for continued growth. The plants were phenotypically identified and observed at the heading and maturity stages, and it was found that the abnormal seed size returned to normal. The above transgenic results show that the present invention has obtained transgenic rice that restores the gz mutant to a normal phenotype. The comparison between the seeds obtained from GZ-CO1 and GZ-CO2 and TN1 is as follows: Figure 2 shown.

[0070] At the same time, homologous recombination and PCR technology were used to introduce Kpn1 single restriction sites into amplification primers respectively, and the amplification primers were: GZOE-1F: ACTTCTGCAGGGATCCATGCAATTACCCGCCATGAGT, GZOE-1R: GCCTCACGTGGGATCCCAAGTCAAAATCAGTTAGTTGTG, and the annealing temperature was 60°C, wherein the front and rear primers contained Kpn1 restriction sites. The primers were used to PCR amplify the cDNA of TN1 (SEQ ID NO: 5), and the 1641bp fragment was recovered and purified after electrophoresis. At the same time, the pCAMBIA1301 vector was also digested with Kpn1, and the recovered and purified fragments with the correct size were connected to the vector after digestion for Escherichia coli transformation, and the positive single clones were selected for sequencing. The correct transformation vector pCA1301-GZOE was obtained, and was transformed into the Agrobacterium tumefaciens strain LBA4404 by electric shock to transform the rice wild type TN1. Callus tissue induced by mutant seeds was cultured in induction medium for 3 weeks, and then vigorously growing callus was selected as the recipient of transformation. Rice callus was infected with LBA4404 strain containing recombinant plasmid vector, and after co-cultured in the dark and 25°C for 3 days, it was cultured on screening medium containing 300mg / L G418. The selected resistant callus was cultured on pre-differentiation medium containing 250mg / L G418 for about 10 days. The pre-differentiated callus was transferred to differentiation medium and cultured under light and 25°C. Resistant transgenic plants (overexpression plants GZ-OE1 and GZ-OE2) were obtained in about a month, and then transplanted into the field for continued growth. The plants were phenotypically identified and observed at the heading and maturity stages, and it was found that the grains became larger, and the thousand-grain weight and zinc content increased; specifically: the seeds obtained from GZ-OE1 and GZ-OE2 were compared with TN1. Figure 3 As shown, the zinc content of seeds obtained from GZ-OE1 and GZ-OE2 was compared with that of TN1. Figure 4 shown.

[0071] The above transgenic results show that the present invention has obtained transgenic rice (such as Figure 3-4 The above research provides important genes and germplasm for improving rice yield and enhancing rice functional quality.

[0072] The above are only some specific embodiments of the present invention. It is necessary to point out that the present invention is not limited to the above embodiments, and all variations that can be directly derived or associated with the contents disclosed by ordinary technicians in this field should be considered as the protection scope of the present invention.

Claims

1. A rice grain weight and zinc content coordinated regulatory gene GZ, characterized in that: The nucleotide sequence of gene GZ is shown in SEQ ID NO:

1.

2. The rice grain weight and zinc content coordinated regulatory gene GZ according to claim 1, characterized in that: The cDNA sequence of gene GZ is shown in SEQ ID NO:

2.

3. The gene according to claim 1 or 2, characterized in that: The nucleotide sequence also includes mutants, alleles or derivatives generated by adding, replacing, inserting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO:

1.

4. The protein encoded by gene GZ according to any one of claims 1 to 3, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO:

3.

5. The protein according to claim 4, characterized in that: The amino acid sequence also includes amino acid sequences or derivatives generated by adding, substituting, inserting or deleting one or more amino acids or homologous sequences of other species in the amino acid sequence shown in SEQ ID NO:

3.

6. A plasmid and a plant expression vector containing the gene according to any one of claims 1 to 3.

7. A host cell, characterized in that: The host cell contains the gene according to any one of claims 1 to 3.

8. The use of gene GZ according to claims 1 to 3, characterized in that: Synergistic regulation of rice grain weight and zinc content.

9. The use of gene GZ according to claim 8, characterized in that: Increase rice yield and improve the functional nutritional quality of rice.

10. A method for coordinated regulation of rice grain weight and zinc content, characterized in that: The gene GZ overexpression vector is transformed into rice to obtain transgenic rice plants, thereby synergistically regulating rice grain weight and zinc content.

Images