Construction method of donor fragment for gene knockout and knockin

Abstract

The invention relates to the field of gene engineering, in particular to a construction method of a donor fragment for gene knockout and knockin. The construction method comprises the following steps: (1) designing a primer pair according to a genome sequence, and carrying out PCR (Polymerase Chain Reaction) on a genome; (2) designing a primer according to a plasmid sequence, and carrying out PCR (Polymerase Chain Reaction) on the plasmid or a target cell carrying the plasmid; (3) purifying the genome segment obtained in the step (1) and the linearized plasmid obtained in the step (2), and then carrying out Gibsen assembly; (4) screening target cells transformed from the recombinant plasmids to obtain successfully recombined transformants; (5) designing a primer pair, carrying out PCR amplification on the transformant obtained in the step (4), purifying, and carrying out Gibsen assembly; (6) transforming the fragment in the step (5) into a target cell, and screening to obtain a transformant carrying the donor fragment; and (7) carrying out PCR (Polymerase Chain Reaction) or enzyme digestion on the transformant in the step (6) to obtain a donor fragment. The method provided by the invention can effectively reduce the number of times of gene amplification and transformation, reduce the probability of mutation, shorten the construction time of donor fragments, reduce the labor intensity of experimenters and save reagents.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to a method for constructing a donor fragment for gene knockout and knock-in. Background Art

[0002] Homologous recombination refers to the recombination between non-sister chromatids or between or within DNA molecules containing homologous sequences on the same chromosome. Genome editing based on homologous recombination has the advantages of few or even no off-target effects and no residues.

[0003] In the field of Escherichia coli genetic engineering, the red homologous recombination system based on the red operon of λ phage is one of the most widely used homologous recombination systems.

[0004] When using the E. coli red system homologous recombination system for E. coli gene insertion, it is necessary to construct a donor fragment, introduce the fragment, and then use overlap-PCR to construct the upstream fragment, downstream fragment, and insert fragment into a complete donor fragment. The construction process has a high failure rate and a high possibility of mutation. Summary of the invention

[0005] The present invention proposes a method for constructing a donor fragment required for homologous recombination for knockout and knock-in based on Gibson assembly and PCR, which can effectively reduce the risk of mutation of the donor fragment during the construction of the donor fragment and improve the success rate of the donor fragment construction. The preliminary construction of the knockout and knock-in donor fragments can be completed in 2 rounds of PCR, i.e., 3 days at the fastest.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A method for constructing a donor fragment for gene knockout and knock-in comprises the following steps:

[0008] (1) Designing primers 1 and 2 according to the genome sequence, performing PCR on the genome, and obtaining genome fragments;

[0009] (2) designing primers 3 and 4 according to the plasmid sequence, and subjecting the plasmid or target cells carrying the plasmid to PCR to obtain a linearized plasmid;

[0010] (3) purifying the genomic fragment obtained in (1) and the linearized plasmid obtained in (2) and performing Gibson assembly to obtain a recombinant plasmid;

[0011] (4) Screening the target cells transformed with the recombinant plasmid to obtain transformants with successful recombination;

[0012] (5) designing primers 5 and 6 to perform PCR amplification on the transformants obtained in (4), and assembling the fragments obtained by primers 5 and 6 by Gibson after purification;

[0013] (6) transforming the fragment in (5) into target cells and screening to obtain transformants carrying the donor fragment;

[0014] (7) The transformant in (6) is subjected to PCR or restriction digestion to obtain the donor fragment.

[0015] According to an embodiment of the present invention, in step (5), primers 7 and 8 are designed to add the fragments of the gene to be inserted and the transformant after PCR amplification, and after purification, the recombinant plasmid is obtained by Gibson assembly; the primers 7 and 8 are designed based on the sequence of the junction of the PCR fragment to be knocked in and the integration donor fragment.

[0016] According to an embodiment of the present invention, in the step (3), the recombinant plasmid is cut by using DpnI enzyme when PCR is performed on the plasmid.

[0017] According to an embodiment of the present invention, the primers 1 and 2 in step (1) are designed based on the sequences at both ends of the sequences to be knocked out or knocked in. The design basis of primers 1 and 2 is the requirement of genome site-specific knock-in. The primers are designed at both ends of the genome segment where the sequence is to be inserted. Gibson assembly relies on homology arms, which can be on the inserted fragment (note: in this case, primers 3 / 4 carry homology arms of the fragment to be inserted) or on the plasmid backbone (note: in this case, primers 1 / 2 carry homology arms of the plasmid).

[0018] According to an embodiment of the present invention, the primers 3 and 4 in step (2) are designed based on the sequence of the integration site of the PCR linearized plasmid and the donor fragment. The design basis of primers 3 and 4 is to integrate the fragment obtained by PCR of primers 1 and 2 into the plasmid to be integrated, so the design basis of primers 3 and 4 is the insertion site on the plasmid.

[0019] According to an embodiment of the present invention, the primers 5 and 6 in step (5) are designed based on the sequences at both ends that need to be knocked out or knocked in.

[0020] According to an embodiment of the present invention, the target cells are A673 cells, CHO-S cells, CHO cells, Vero cells, sf9 cells, 293F cells, HEK293T cells, plant cells, Saccharomyces cerevisiae, oleaginous yeast, tea yeast, Saccharomyces cerevisiae, St. Petersburg oleaginous yeast, red Phaffia saccharomyces, Candida albicans, Brettia heteromorpha, fission yeast, Uva yeast, Veihachamo yeast, Pichia pastoris, toruloid red winter spore yeast, bifid yeast, Kluyveromyces cerevisiae, Cryptococcus albicans, Aspergillus oryzae, Carbonyl Aspergillus, Cephalosporium acrosporum, Botrytis cinerea, Penicillium chrysogenum, Rhizopus niger, Rhizopus, Tetrasporic acid mold, Trichoderma harzianum, Rhizopus microphyllus, Pseudomonas aeruginosa, Trichoderma polysporum, Nepalese mold, Aspergillus awamori, Penicillium griseo-yellow, Aspergillus ochraceus, Aspergillus fischeri, Trichoderma deliquescent , pink trichothecene, mucor, short scopolamine, Aspergillus weihennii, Aspergillus niger, agrobacterium, variant mold, tomi trichoderma, citron trichoderma, sclerotium penicillium, uvea aspergillus, short penicillium, italian penicillium, citrus penicillium, aspergillus flavus, aspergillus fumigatus, trichoderma reesei, monascus, aspergillus flavus, aspergillus nidulans, venezuelae, streptomyces posse, white streptomyces, gray streptomyces, white mustard streptomyces, thermophilic streptococcus, microflavour streptomyces, rose spore streptomyces, staphylococcus, vibrio cholerae, pseudomonas aeruginosa, pseudomonas syringae, listeria monocytogenes, pseudomonas fluorescens, porphyromonas gingivalis, pseudomonas cepacia, pseudomonas motilium, pseudomonas whitmore, pseudomonas stutzeri, pseudomonas alcaligenes, pseudomonas putida, klebsiella pneumoniae, legionella pneumoniae, cloak Enterobacter, Escherichia coli, Escherichia coli Nissle, Acetobacter pasteurianus, Enterococcus faecalis, Enterobacter citrate, Brucella, Streptococcus suis, Pectin Bacillus, Bacillus anthracis, Klebsiella pneumoniae, Corynebacterium glutamicum, Salmonella enteritidis, Serratia marcescens, Salmonella, Lactobacillus rhamnosus, Bacillus coagulans, Clostridium botulinum, Bacillus brevis, Bacillus alkaliphilus, Bacillus arthritis, Bacillus spp., Bacillus spp., Bacillus licheniformis, Bacillus megaterium, Bacillus thuringiensis, Bacillus subtilis, Bacillus violaceus, Bacillus pasteurianus, Bacillus cereus, Streptomyces coelicolor, Helicobacter pylori, Candida albicans, Candida paradida, Candida intermedia, Candida glabrata, Candida, Thiobacillus ferrooxidans, Tuberculosis Mycobacterium, Lactobacillus acidophilus, Enterococcus gallinarum, Lactococcus lactis, Lactococcus garvei, Lactobacillus casei, Rhodococcus, Rhodococcus edulis, Haemophilus parasuis, Mycobacterium smegmatis, Agrobacterium tumefaciens, Lactobacillus brevis, Thiobacillus ferrooxidans, Agrobacterium carcinoma, Pasteurella, Lactobacillus reuteri, Acinetobacter baumannii, Bifidobacterium lactis, Photobacterium luminescentis, Lactobacillus helveticus, Lactobacillus plantarum, Streptococcus lactis, Lactobacillus, Malassezia kangpi, Malassezia, Serratia juquanensis, Xanthomonas vesicularis, Xanthomonas arborescens, Aeromonas vernix, Aeromonas hydrophila, Aeromonas salmonicida, Aeromonas sobria, Xanthomonas oryzae, Fusarium lanceolata, Fusarium xylosus, Fusarium graminearum, Fusarium solani, Fusarium proliferating, Sinorhizobium, Brachyrhizobium thunbergii, Shigella,Shigella dysenteriae, Botrytis cinerea, Cryptococcus gattii, Claviceps ergotis, Lysodesella fluvira, Ancylostoma glutinosa, Micrococcus lysodeikticus, Micrococcus luteus, Fusobacterium nucleatum, Echinococcus, Streptococcus equine, Echinococcus, Pediococcus pentosaceus, Beauveria bassiana, Metarhizium anisopliae, Vibrio qinghaiensis, Vibrio harveyi, Vibrio natrii, Schizochytrium, Clostridium difficile, Chlamydomonas, Volvox vulgaris, Synechococcus, Erythrozoon, Proactinomycetes, Actinomycetes precious, Actinomycetes motile, Amycolatopsis orientalis, Azotobacter nitrofusus, Shewanella putrefaciens.

[0021] According to an embodiment of the present invention, the screening method in step (4) or (6) is any one of antibiotic plate screening, fluorescence screening, gas production screening, and colorimetric screening.

[0022] The beneficial effects of the present invention are:

[0023] 1. Reduce the number of PCR times and reduce the possibility of mutation during vector construction.

[0024] 2. Reduce labor intensity and reagent usage.

[0025] 3. This method can effectively reduce the number of transformations. When used for the construction of site-directed editing donor fragments, the preparation of donor fragments can be completed within two rounds of PCR at the fastest, which can significantly shorten the construction time of donor fragments. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a schematic diagram of the construction process of the method of the present invention.

[0027] Figure 2 This is a schematic diagram of the construction process of the Escherichia coli thrA gene knockout donor in Example 1.

[0028] Figure 3 This is a graph showing the electrophoresis results of PCR verification of the construction of the PUC57-kan plasmid carrying the thrA gene in Example 1.

[0029] Figure 4 This is a graph showing the electrophoresis results of PCR verification of the construction of the knockout gene donor in Example 1.

[0030] Figure 5 This is a schematic diagram of the Escherichia coli thrA gene knockout-penicillin resistance gene knockout donor construction process of Example 2.

[0031] Figure 6 This is a graph showing the electrophoresis results of PCR verification of the construction of the PUC57-kan plasmid carrying the thrA gene in Example 2.

[0032] Figure 7This is a graph of the electrophoresis results of PCR verification for constructing an Escherichia coli thrA gene knockout-penicillin resistance gene knockout donor in Example 2. DETAILED DESCRIPTION

[0033] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0034] A method for constructing a donor fragment for gene knockout and knock-in comprises the following steps:

[0035] (1) Designing primers 1 and 2 according to the genome sequence, performing PCR on the genome, and obtaining genome fragments;

[0036] (2) designing primers 3 and 4 according to the plasmid sequence, and subjecting the plasmid or target cells carrying the plasmid to PCR to obtain a linearized plasmid;

[0037] (3) purifying the genomic fragment obtained in (1) and the linearized plasmid obtained in (2) and performing Gibson assembly to obtain a recombinant plasmid;

[0038] (4) Screening the target cells transformed with the recombinant plasmid to obtain transformants with successful recombination;

[0039] (5) designing primers 5 and 6 to perform PCR amplification on the transformants obtained in (4), and assembling the fragments obtained by primers 5 and 6 by Gibson after purification;

[0040] (6) transforming the fragment in (5) into target cells and screening to obtain transformants carrying the donor fragment;

[0041] (7) The transformant in (6) is subjected to PCR or restriction digestion to obtain the donor fragment.

[0042] When a gene fragment needs to be knocked in, step (3) designs primers 7 and 8, adds the gene to be knocked in and the genomic fragment, and purifies the linearized plasmid, and then performs Gibson assembly to obtain a recombinant plasmid; the specific process is as follows: Figure 1 shown.

[0043] Example 1

[0044] E. coli thrA gene knockout donor construction:

[0045] Find the thrA gene related sequence from the gene database, and select the PUC57-kan plasmid as the vector;

[0046] Primer 1: gaattcgagctcggtacctcaacgggcaatatgtctctgtgtgg (SEQ ID NO: 1)

[0047] Primer 2: ggatccgatatctagatgcagagcctaagcccgaaccgattggc (SEQ ID NO: 2)

[0048] Primer 3: tgcatctagatatcggatcccgg (SEQ ID NO: 3)

[0049] Primer 4: cgcgaggtaccgagctcgaattcac (SEQ ID NO: 4)

[0050] Primer 5 (for knockout): caatatcagcgatgccgaactgaagattgccgaagtggatgg (SEQ ID NO: 5)

[0051] Primer 6 (for knockout): gttcggcatcgctgatattggg (SEQ ID NO: 6)

[0052] The primers used above were all at a concentration of 10 pmol / L.

[0053] thrA gene related sequences:

[0054]

[0055] (SEQ ID NO: 7)

[0056] PUC57-kan Plasmid

[0057]

[0058] (SEQ ID NO: 8)

[0059] The PCR system is:

[0060]

[0061]

[0062] The PCR program is:

[0063]

[0064] The Gibson assembly system is:

[0065]

[0066] Gibson assembly conditions: incubate in a 50°C water bath or metal bath for 20 minutes

[0067] like Figure 2 The specific process shown is:

[0068] (1) Primer 1 and Primer 2 were used to amplify a genomic fragment containing the full length of the thrA gene in Escherichia coli BL21 according to the PCR system and reaction conditions shown.

[0069] (2) Primers 3 and 4 were used to amplify E. coli cells carrying the pUC57-kan plasmid according to the PCR system and reaction conditions shown.

[0070] (3) Gibson assembly of the fragments obtained by primers 1-2 and primers 3-4 (the fragments must be purified using a purification kit before assembly).

[0071] (4) The plasmid obtained in heat shock transformation (3) was screened on kan antibiotic plates for colonies with successful recombination.

[0072] (5) (4) The obtained colonies were verified by PCR using universal primers M13 fwd and M13 rev. If the length of the electrophoresis result was close to 3113 bp, the vector was considered to be successfully constructed. Figure 3 shown.

[0073] (6) Primers 5 and 6 were used to amplify the E. coli transformant cells verified to be correct in (5), and the fragment obtained by Gibson assembly of primers 5-6 was purified using a purification kit before the fragment was assembled.

[0074] (7) The plasmid obtained in heat shock transformation (6) was screened on kan antibiotic plates for colonies with successful recombination.

[0075] (8)(7) The obtained colonies were verified by PCR using universal primers M13 fwd and M13 rev. If the length of the electrophoresis result was close to 1009 bp, the vector was considered to be successfully constructed. Figure 4 shown.

[0076] (9) The correctly verified transformants obtained are transformants carrying the knockout donor fragment plasmid, and the donor fragment required for homologous recombination can be subsequently obtained by PCR or enzyme digestion.

[0077] Example 2

[0078] Escherichia coli thrA gene knockout-penicillin resistance gene knockout donor construction:

[0079] The thrA gene related sequence was found from the gene database, and the vector was selected as the PUC57 plasmid.

[0080] Primer 1: gaattcgagctcggtacctcaacgggcaatatgtctctgtgtgg (SEQ ID NO: 9)

[0081] Primer 2: ggatccgatatctagatgcagagcctaagcccgaaccgattggc (SEQ ID NO: 10)

[0082] Primer 3: tgcatctagatatcggatcccgg (SEQ ID NO: 11)

[0083] Primer 4: cgcgaggtaccgagctcgaattcac (SEQ ID NO: 12)

[0084] Primer 5 (for insertion): tgaagattgccgaagtggatgg (SEQ ID NO: 13)

[0085] Primer 6 (for insertion): gttcggcatcgctgatattggg (SEQ ID NO: 14)

[0086] Primer 7 (penicillin resistance insert): caatatcagcgatgccgaacttaccaatgcttaatcagtgaggc (SEQ ID NO: 15)

[0087] Primer 8 (penicillin resistance insertion): atccacttcggcaatcttcataaacaaataggggttccgcg. (SEQ ID NO: 16)

[0088] Penicillin resistance gene:

[0089] ttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcg(SEQ ID NO:17)

[0090] The PCR system is:

[0091] Components Dosage (50μL system) Final system concentration 5× PrimeSTARGXL Buffer 10μL 1× dNTP Mixture (2.5 mM each) 4μL 200μM 10 μM forward primer 10-15 pmol 0.2-0.3μM 10 μM post primer 10-15 pmol 0.2-0.3μM Template DNA*1 XμL (50-100ng) / DNA Polymerase 2μL 1.25U / 50μL <![CDATA[Sterile water ddH2O]]> (20-X)μL /

[0092] The PCR program is:

[0093]

[0094] The Gibson assembly system is:

[0095]

[0096] Gibson assembly conditions: incubate in a 50°C water bath or metal bath for 20 minutes

[0097] like Figure 5 The specific process shown is:

[0098] (1) Primer 1 and Primer 2 were used to amplify a genomic fragment containing the full length of the thrA gene in Escherichia coli BL21 according to the PCR system and reaction conditions shown.

[0099] (2) Primers 3 and 4 were used to amplify E. coli cells carrying the pUC57-kan plasmid according to the PCR system and reaction conditions shown.

[0100] (3) Gibson assembly of the fragments obtained by primers 1-2 and primers 3-4 (the fragments must be purified using a purification kit before assembly)

[0101] (4) The plasmid obtained in heat shock transformation (3) was screened on kan antibiotic plates for colonies with successful recombination.

[0102] (5) (4) The obtained colonies were verified by PCR using universal primers M13 fwd and M13 rev. If the electrophoresis result showed a length close to 3113 bp, the vector was considered to be successfully constructed. Figure 6 shown.

[0103] (6) Primers 5 and 6 were used to amplify the E. coli transformant cells verified to be correct in (5), and primers 7 and 8 were used to amplify the penicillin resistance gene. The fragments obtained by primers 5-6 and primers 7-8 were assembled using Gibson (the fragments must be purified using a purification kit before assembly).

[0104] (7) The plasmid obtained in heat shock transformation (6) was screened on kan antibiotic plates for colonies with successful recombination.

[0105] (8)(7) The obtained colonies were verified by PCR using universal primers M13 fwd and M13 rev. If the length of the electrophoresis result was close to 2000 bp, the vector was considered to be successfully constructed. Figure 7 shown.

[0106] (9) The correctly verified transformants obtained are transformants carrying the knockout donor fragment plasmid, and the donor fragment required for homologous recombination can be subsequently obtained by PCR or enzyme digestion.

[0107] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present invention.

Claims

1. A method for constructing a donor fragment for gene knockout and knock-in, comprising the following steps: (1) Designing primers 1 and 2 according to the genome sequence, performing PCR on the genome, and obtaining genome fragments; (2) designing primers 3 and 4 according to the plasmid sequence, and subjecting the plasmid or target cells carrying the plasmid to PCR to obtain a linearized plasmid; (3) purifying the genomic fragment obtained in (1) and the linearized plasmid obtained in (2) and performing Gibson assembly to obtain a recombinant plasmid; (4) Screening the target cells transformed with the recombinant plasmid to obtain transformants with successful recombination; (5) designing primers 5 and 6 to perform PCR amplification on the transformants obtained in (4), and assembling the fragments obtained by primers 5 and 6 by Gibson after purification; (6) transforming the fragment in (5) into target cells and screening to obtain transformants carrying the donor fragment; (7) The transformant in (6) is subjected to PCR or restriction digestion to obtain the donor fragment.

2. The method according to claim 1, characterized in that In the step (5), primers 7 and 8 are designed to add the fragments of the gene to be inserted and the transformant after PCR amplification, and after purification, the recombinant plasmid is obtained by Gibson assembly; the primers 7 and 8 are designed based on the sequence of the junction of the PCR to be knocked in fragment and the integration donor fragment.

3. The method according to claim 1 or 2, characterized in that: In the step (3), when the recombinant plasmid is subjected to PCR, it is cut with the DpnI enzyme.

4. The method according to claim 1 or 2, characterized in that: The primers 1 and 2 in step (1) are designed based on the sequences at both ends that need to be knocked out or knocked in.

5. The method according to claim 1 or 2, characterized in that: Primer 3 and Primer 4 in step (2) are designed based on the sequence of the integration site of the PCR linearized plasmid and the donor fragment.

6. The method according to claim 1 or 2, characterized in that: Primer 5 and primer 6 in step (5) are designed based on the sequences at both ends that need to be knocked out or knocked in.

7. The method according to claim 1 or 2, characterized in that: The target cells are A673 cells, CHO-S cells, CHO cells, Vero cells, sf9 cells, 293F cells, HEK293T cells, plant cells, Saccharomyces cerevisiae, oleaginous yeast, tea yeast, Saccharomyces cerevisiae, Lipomyces strewingii, Phaffia rhodozyma, Candida ruanensis, Brettia heterotypica, Schizosaccharomyces pombe, Saccharomyces ulmoides, Saccharomyces veyci, Pichia pastoris, Rhodosporium toruloides, Saccharomyces bisporus, Saccharomyces cerevisiae, Cryptococcus albicans, Aspergillus oryzae, Aspergillus carbonicus, Cephalosporium acrosporum, Botrytis cinerea, Penicillium chrysogenum, Rhizopus nigricans, Rhizopus tetrasporus, Trichoderma harzianum, Rhizopus microplus, Trichoderma pseudotrichoderma, Trichoderma polysporum, Aspergillus awamori, Penicillium griseo-yellow, Aspergillus ochraceus, Aspergillus fischeri, Trichoderma deliquescent, Trichothecene pink, Mucor, Aspergillus brevis, Aspergillus weihennii, Aspergillus niger, Agrobacterium, Mutant mold, Trichoderma tomi, Trichoderma citron, Penicillium sclerotium, Aspergillus wuwa, Penicillium brevis, Penicillium italicum, Penicillium citrinum, Aspergillus flavus, Aspergillus fumigatus, Trichoderma reesei, Monascus, Aspergillus flavus, Aspergillus nidulans, Streptomyces venezuelae, Streptomyces posse, Streptomyces albus, Streptomyces griseus, Streptomyces white mustard, Streptococcus thermophilus, Streptomyces microflavus, Streptomyces roseospore, Staphylococcus, Vibrio cholerae, Pseudomonas aeruginosa, Pseudomonas syringae, Listeria monocytogenes, Pseudomonas fluorescens, Porphyromonas gingivalis, Pseudomonas cepacia, Pseudomonas motil, Pseudomonas whitmore, Pseudomonas stutzeri, Pseudomonas alcaligenes, Pseudomonas putida, Klebsiella pneumoniae, Legionella pneumoniae, Enterobacter cloacae, Escherichia coli, Escherichia coli Nissle, Acetobacter pasteurianus, Enterococcus faecalis, Enterobacter citrate, Brucella, Streptococcus suis, Pectinobacillus, Bacillus anthracis, Klebsiella pneumoniae, Corynebacterium glutamicum, Salmonella enteritidis, Serratia marcescens, Salmonella, Lactobacillus rhamnosus, Bacillus coagulans, Clostridium botulinum, Bacillus brevis, Bacillus alkaliphilus, Arthrobacter, Paenibacillus, Bacillus licheniformis, Bacillus megaterium, Bacillus thuringiensis, Bacillus subtilis, Bacillus violaceus, Bacillus pasteurianus, Bacillus cereus, Streptomyces coelicolor, Helicobacter pylori, Candida albicans, Candida paradida, Candida intermedia, Candida glabrata, Candida, Thiobacillus ferrooxidans, Mycobacterium tuberculosis, Lactobacillus acidophilus, Gallina Enterococci, Lactococcus lactis, Lactococcus garvei, Lactobacillus casei, Rhodococcus, Rhodococcus edulis, Haemophilus parasuis, Mycobacterium smegmatis, Agrobacterium, Lactobacillus brevis, Thiobacillus ferrooxidans, Agrobacterium carcinoma, Pasteurella, Lactobacillus reuteri, Acinetobacter baumannii, Bifidobacterium lactis, Photobacterium luminescentis, Lactobacillus helveticus, Lactobacillus plantarum, Streptococcus lactis, Lactobacillus, Malassezia kangpi, Malassezia, Serratia juquanensis, Xanthomonas vesicularis, Xanthomonas arborescens, Aeromonas vernix, Aeromonas hydrophila, Aeromonas salmonicida, Aeromonas sobria, Xanthomonas oryzae, Fusarium lanceolata, Fusarium graminearum, Fusarium solani, Fusarium proliferating, Sinorhizobium, Brachyrhizobium thunbergii, Shigella, Shigella dysenteriae, Botrytis cinerea,Any one of Cryptococcus gattii, Claviceps ergotis, Lysodesella fluvira, Ancylostoma glutinosa, Micrococcus lysodeikticus, Micrococcus luteus, Fusobacterium nucleatum, Echinococcus, Streptococcus equine, Echinococcus, Pediococcus pentosaceus, Beauveria bassiana, Metarhizium anisopliae, Vibrio qinghaiensis, Vibrio harveyi, Vibrio natrii, Schizochytrium, Clostridium difficile, Chlamydomonas, Volvox vulgaris, Synechococcus, Erythrozoon, Proactinomycetes, Actinomycetes precious, Actinomycetes motile, Amycolatopsis orientalis, Azotobacter nitrofusus, and Shewanella putrefaciens.

8. The method according to claim 1 or 2, characterized in that: The screening method in step (4) or (6) is any one of antibiotic plate screening, fluorescence screening, gas production screening, and colorimetric screening.

Images