Method for regulating and controlling tea tree alkaloid accumulation by inhibiting CsAP2.7 gene expression

Abstract

The invention belongs to the technical field of biology. The invention particularly relates to a method for regulating and controlling two alkaloids, namely theobromine and theophylline, of a tea tree by influencing CsAP2.7 gene expression of the tea tree. The invention provides application of a CsAP2.7 gene. The CsAP2.7 gene is used for regulating and controlling alkaloid accumulation in plants, and the nucleotide sequence of the CsAP2.7 gene is as shown in SEQ ID NO: 1. The invention also provides a method for regulating and controlling the alkaloid accumulation of the tea tree. The alkaloid accumulation of the plant is regulated and controlled by inhibiting the expression of the CsAP2.7 gene. A tea tree CsAP2.7 gene antisense inhibition gene silencing plant is constructed for the first time, functional research is carried out, and it is found that the tea tree CsAP2.7 gene plays a negative regulation role and a positive regulation role in theobromine and theophylline accumulation respectively.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and specifically relates to a method for influencing the expression of CsAP2.7 gene of tea tree to regulate two alkaloids of tea tree, theobromine and theophylline. Background Art

[0002] Tea is one of the three most important non-alcoholic beverages in the world. my country has rich tea germplasm resources, and the tea industry has a high output value and a large scale. Tea tree leaf buds, as the source of tea raw materials, have rich metabolic components. Purine alkaloids are abundant and important metabolites in tea. The purine alkaloids of tea trees include theobromine, caffeine (caffeine) and theophylline. Among them, theophylline has the effects of antagonizing caffeine such as anti-inflammatory, analgesic, sedative, hypnotic, and antidepressant. These three alkaloids belong to the same metabolic pathway. Theobromine synthesizes caffeine through 3,7-dimethylxanthine transferase, and caffeine synthesizes theophylline through oxidation and N9 methyltransferase. Transcription factors have the function of binding to the promoter of the target gene to regulate the expression of the synthase type target gene, and then regulate the accumulation of metabolites synthesized by the target gene. Using this function of transcription factors to regulate the accumulation of tea alkaloids is a feasible biotechnology means. Existing studies have shown that transcription factors such as NAC and MYB regulate the caffeine content of tea trees through this function, but there are few reports on AP2 / ERF type transcription factors that regulate caffeine. Secondly, the key synthase of theophylline has only been identified in recent years, and there have been no reports on the transcription factors that regulate theophylline. Summary of the invention

[0003] The technical problem to be solved by the present invention is to provide an application of a technology for influencing the expression of CsAP2.7 gene in regulating the accumulation of two alkaloids, theobromine and theophylline, from tea trees.

[0004] In order to solve the above technical problems, the present invention provides the use of CsAP2.7 gene: regulating alkaloid accumulation in plants, the nucleotide sequence of CsAP2.7 gene is as shown in SEQ ID NO: 1. The amino acid sequence of the protein encoded by CsAP2.7 gene is as shown in SEQ ID NO: 2.

[0005] As an improvement on the use of the CsAP2.7 gene of the present invention: the plant is tea plant; the alkaloids include theobromine and theophylline.

[0006] As a further improvement of the use of the CsAP2.7 gene of the present invention: negatively regulating the accumulation of theobromine in tea plants (especially the young leaves and young buds of tea plants in the one bud and one leaf period), and positively regulating the accumulation of theophylline in tea plants (especially the young leaves and young buds of tea plants in the one bud and one leaf period).

[0007] The present invention also provides a method for regulating the accumulation of tea plant alkaloids: regulating the accumulation of plant alkaloids by inhibiting the expression of CsAP2.7 gene, wherein the nucleotide sequence of the CsAP2.7 gene is as described in SEQ ID NO:1.

[0008] As an improvement of the method for regulating the accumulation of tea alkaloids of the present invention: the theobromine content of the tea tree is increased and the theophylline content is suppressed.

[0009] As a further improvement of the method for regulating the accumulation of tea alkaloids of the present invention: the theobromine content of tea leaves is increased and the theophylline content is suppressed.

[0010] As a further improvement of the method for regulating tea plant alkaloid accumulation of the present invention: the theobromine content of tea leaves (tea tree leaf buds) obtained by silencing the CsAP2.7 gene is increased and the theophylline content is reduced.

[0011] The CsAP2.7 gene is used for antisense inhibition of tea leaves, which increases the theobromine content of tea leaves and decreases the theophylline content of tea leaves. That is, the theobromine content of tea leaves obtained by silencing the CsAP2.7 gene increases and the theophylline content decreases.

[0012] As a further improvement of the method for regulating tea tree alkaloid accumulation of the present invention: the antisense primer used for CsAP2.7 gene silencing is as follows:

[0013] The antisense primers used for CsAP2.7 gene silencing are as follows:

[0014] CsAP2.7 antisense primer-1: 5'ACACTGCACAAATGCGGACG 3'

[0015] CsAP2.7 antisense primer-2: 5'GACAAGGCTGCAATAAAATG 3'

[0016] CsAP2.7 antisense primer-3: 5'ACTTTGAGGCAAGCACATAT 3'

[0017] CsAP2.7 antisense primer-4: 5'GAGGCAAGCACATATGAAGA 3'

[0018] CsAP2.7 antisense primer-5: 5'TTACAACCTAGCAACAAAGC 3'.

[0019] The present invention also provides an antisense inhibition treatment solution for the CsAP2.7 gene, which is prepared by mixing equal amounts of the CsAP2.7 antisense primer-1, CsAP2.7 antisense primer-2, CsAP2.7 antisense primer-3, CsAP2.7 antisense primer-4, and CsAP2.7 antisense primer-5 described above, and then adding distilled water for dilution. The concentration of each primer in the antisense inhibition treatment solution is 20±2 μM.

[0020] The present invention constructs a tea plant CsAP2.7 gene antisense inhibitory gene silencing plant for the first time and conducts functional research. The two alkaloids, theobromine and theophylline, are determined by ultra-high performance liquid chromatography, and it is found that the tea plant CsAP2.7 gene plays a negative and positive regulatory role in the accumulation of theobromine and theophylline, respectively. That is, the expression of tea plant CsAP2.7 reduces the accumulation of theobromine and increases the accumulation of theophylline.

[0021] It should be noted that:

[0022] The currently known use of the CsAP2.7 gene is to participate in the flowering-related growth and development process and plant innate immunity, and therefore, it has no relevance to the use of the present invention.

[0023] At present, no gene that can simultaneously regulate the accumulation of two alkaloids, theobromine and theophylline, in tea trees has been reported. The gene that is known to regulate theobromine alone is CsMYB114, which belongs to a completely different gene family from CsAP2.7 of the present invention. There has also been no report on the upstream transcription factor type gene that regulates theophylline alone. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to make the objectives, technical solutions and advantages of the present invention more clear, specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0025] Figure 1 is the expression level of CsAP2.7 gene in tea leaves with antisense suppression of gene silencing;

[0026] Figure 2 The content of theobromine and theophylline in the leaves of tea plant with CsAP2.7 gene antisense inhibition gene silencing;

[0027] The left picture shows the theobromine content of tea leaves in different treatment groups, and the right picture shows the theophylline content of tea leaves in different treatment groups.

[0028] In the above figure:

[0029] Blank is the blank control group, CsAP2.7 AS is the antisense inhibition treatment group, and CsAP2.7 S is the negative control group. Different letters represent significant differences among different groups (p<0.05). DETAILED DESCRIPTION

[0030] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0031] 1. Obtaining the full-length sequence of the tea plant CsAP2.7 gene:

[0032] Primer Premier 6.0 was used to design whole gene amplification primers, and the cDNA of one bud and one leaf of Jianghua bitter tea, a tea variety grown in the Tea Research Institute of the Chinese Academy of Agricultural Sciences, was used as a template (cDNA was extracted using conventional techniques, for example, refer to CN 104561025A), specific primers CsAP2.7-F and CsAP2.7-R were designed, and the CsAP2.7 fragment was amplified using KOD-plus-NEO high-fidelity enzyme PCR.

[0033] Primer sequence: CsAP2.7-F: 5'-ATGAAGAATTTGACGAAGGAAGAAT-3'

[0034] CsAP2.7-R: 5'-TTAAACCCTAGGACTTGCGATTACG-3'

[0035] PCR amplification reaction system: 10xPCR Buffer 5ul, 2mM dNTP 5ul, 25mM MgSO4 3ul, KOD-plus-NEO 1ul, ddH2O 32ul, cDNA 1ul, upstream and downstream primers 1.5ul each, a total of 50ul. The PCR reaction program is: 94℃ pre-denaturation for 2 minutes; 98℃ denaturation for 10 seconds, 53℃ annealing for 30 seconds, 68℃ extension for 2 minutes, 35 cycles; finally 68℃ final extension for 5 minutes, the obtained PCR product was identified by 1% agarose gel electrophoresis, and then the amplified band was recovered and purified using the Axygen DNA gel kit, and the recovered product was constructed into the Peasy-Blunt-Zero vector, and the above recombinant plasmid was sent to Youkang Company for sequencing confirmation.

[0036] The nucleotide sequence of the obtained gene CsAP2.7 is shown in SEQ ID No: 1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID No: 2.

[0037] 2. Design and synthesis of CsAP2.7 gene antisense inhibitory primers and negative control sense primers

[0038] Soligo online design software was used to submit the obtained nucleotide sequence of SEQ ID No: 1. According to the calculation results, the length of the five regions in the nucleotide sequence of SEQ ID No: 1 was 20 bp oligonucleotides. The five regions (starting from the start codon) were 91-110 bp, 154-173 bp, 197-216 bp, 202-221 bp and 526-545 bp, respectively. In the five regions, an oligonucleotide chain with a lower oligonucleotide binding energy was selected. According to the oligonucleotide chain, a deoxynucleotide chain "CsAP2.7 antisense primer-1 to 5" was designed as an antisense inhibitory primer. The base complementary chain of the antisense inhibitory primer was used as a negative control sense primer. The corresponding primer with an OD value of 200 was synthesized at Youkang Company. The specific primer sequences are shown in Table 1 (primers are all in the 5' to 3' direction).

[0039] Table 1. Nucleotide sequences of antisense inhibitory primers and negative control sense primers for CsAP2.7 gene

[0040]

[0041] 3. Construction and detection of CsAP2.7 gene antisense inhibition materials:

[0042] The five CsAP2.7 antisense primers described in Table 1 were mixed in equal amounts, and distilled water was added to dilute them to prepare an antisense inhibition treatment solution containing 20 μM concentration of each primer; the five CsAP2.7 sense primers were mixed in equal amounts, and distilled water was added to dilute them to prepare a negative control treatment solution containing 20 μM concentration of each sense primer. At the same time, a blank control group containing no primers but only distilled water was set up.

[0043] One bud and one leaf of the tea variety Jianghua Kucha, located in the National Germplasm Hangzhou Tea Nursery Base in the Tea Research Institute of the Chinese Academy of Agricultural Sciences, were picked to ensure that the picked buds and leaves were healthy buds and leaves grown from the new shoots of the year, and the size and growth state were consistent. The picked buds and leaves were randomly divided into the above-mentioned blank control group (Blank), antisense inhibition treatment group (CsAP2.7AS) and negative control group (CsAP2.7 S), with at least eight biological replicates in each group. Placed in a light incubator, the culture conditions were about 25°C, 16h / 8h light / dark cycle. Replenish the treatment liquid of each group every day to prevent buds and leaves from drying out.

[0044] IV. Study on the antisense inhibition of theobromine and theophylline accumulation in tea plants by CsAP2.7 gene

[0045] On the fifth day of treatment, the buds and leaves were frozen in liquid nitrogen, ground in a ball mill, and RNA was extracted according to the Tiangen Polysaccharide Polyphenol RNA Kit method, and cDNA was extracted by reverse transcription. The expression level of CsAP2.7 gene in each group was determined using the fluorescence quantitative method. The results are shown in Figure 1According to Figure 1 , it can be seen that antisense inhibition treatment will reduce the expression of CsAP2.7 gene. Compared with the blank control group, the treatment of the negative control group did not significantly affect the expression of CsAP2.7 gene.

[0046] Determination of theobromine and theophylline. Weigh 0.1g of tea buds and leaves and grind them into a 15mL centrifuge tube. Add 10mL of 70% methanol (chromatographic grade) and mix thoroughly. Ultrasonicate at 80% power for 45 minutes in an ultrasonic cleaner, and shake every 15 minutes. After the ultrasound, place it at 4°C and let it settle for 2 hours. Take the supernatant and filter it through a 0.22μm membrane into a 1.5mL sample bottle. Use Waters ACQUITY H-Class ultra-high performance liquid chromatograph (equipped with 1290Infinity II high-speed pump, diode array detector, evaporative light scattering detector, workstation, etc.) (Waters, USA) as the detection instrument, and use ACQUITY UPLC HSS T3 C18 (1.8μm, 2.1mm×100mm, Waters) chromatographic column. The detection wavelength is 280nm, the column temperature is 41°C, the mobile phase A is 0.1% formic acid aqueous solution, the mobile phase B is acetonitrile, and the flow rate is 0.4mL·min -1 .

[0047] The separated substances were detected by mass spectrometry. The peak time of about 3 minutes was theobromine, and the peak time of about 8 minutes was theophylline. The same extraction and detection process was performed using theobromine and theophylline standards. The peak times of theobromine and theophylline standards were 3 minutes and 8 minutes, respectively, which were consistent with the mass spectrometry experiment. The gradient content regression curve with the peak area under liquid phase conditions was established using theobromine and theophylline standards. The theobromine and theophylline contents in the tea bud and leaf samples were calculated based on the peak areas at 3 minutes and 8 minutes in the experiment.

[0048] The results are as follows Figure 2 According to Figure 2 It can be seen that antisense inhibition of silencing the expression of CsAP2.7 gene will increase the theobromine content and reduce the theophylline content, while there is no significant difference in the alkaloid content between the negative control group (S) and the blank control group (Blank), indicating that the CsAP2.7 gene inhibits the accumulation of theobromine in tea buds and leaves, and promotes the accumulation of theophylline in tea buds and leaves.

[0049] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. The use of CsAP2.7 gene is characterized by: Regulating alkaloid accumulation in plants, the nucleotide sequence of the CsAP2.7 gene is as shown in SEQ ID NO:

1.

2. The use of the CsAP2.7 gene according to claim 1, characterized in that: The plant is tea tree; The alkaloids include theobromine and theophylline.

3. The use of the CsAP2.7 gene according to claim 2, characterized in that: It negatively regulates the accumulation of theobromine in tea trees and positively regulates the accumulation of theophylline in tea trees.

4. A method for regulating the accumulation of tea alkaloids, characterized in that: The alkaloid accumulation of plants is regulated by inhibiting the expression of CsAP2.7 gene, the nucleotide sequence of which is shown in SEQ ID NO:

1.

5. The method for regulating tea alkaloid accumulation according to claim 4, characterized in that: Increase the theobromine content of tea tree and inhibit theophylline content.

6. The method for regulating tea alkaloid accumulation according to claim 5, characterized in that: Increase the theobromine content of tea leaves and inhibit theophylline content.

7. The method for regulating the accumulation of tea alkaloids according to any one of claims 4 to 6, characterized in that: The theobromine content of tea leaves obtained by silencing the CsAP2.7 gene was increased and the theophylline content was reduced.

8. The method for regulating tea alkaloid accumulation according to claim 7, characterized in that Cs The antisense primers used for AP2.7 gene silencing are as follows: CsAP2.7 antisense primer-1: 5'ACACTGCACAAATGCGGACG 3' CsAP2.7 antisense primer-2: 5'GACAAGGCTGCAATAAAATG 3' CsAP2.7 antisense primer-3: 5'ACTTTGAGGCAAGCACATAT 3' CsAP2.7 antisense primer-4: 5'GAGGCAAGCACATATGAAGA 3' CsAP2.7 antisense primer-5: 5'TTACAACCTAGCAACAAAGC 3'.

9. The method for regulating tea alkaloid accumulation according to claim 8, characterized in that: The antisense inhibition treatment solution for the CsAP2.7 gene is prepared by mixing equal amounts of CsAP2.7 antisense primer-1, CsAP2.7 antisense primer-2, CsAP2.7 antisense primer-3, CsAP2.7 antisense primer-4, and EXO antisense primer-5 and then adding distilled water for dilution. The concentration of each primer in the antisense inhibition treatment solution is 20±2 μM.

Images