Method for regulating alkaloid accumulation in camellia sinensis by inhibiting expression of csap2.7 gene

Abstract

The application belongs to the technical field of biology, and particularly relates to a method for regulating two alkaloids, theobromine and theacrine, of tea trees by affecting the expression of a CsAP2.7 gene of the tea trees. The application provides the use of the CsAP2.7 gene in regulating alkaloid accumulation in plants, and the nucleotide sequence of the CsAP2.7 gene is shown as SEQ ID NO:1. The application also provides a method for regulating alkaloid accumulation in tea trees, i.e., regulating alkaloid accumulation in plants by inhibiting the expression of the CsAP2.7 gene. The application first constructs an antisense inhibition gene silencing plant of the CsAP2.7 gene of the tea trees and performs a functional study, and finds that the CsAP2.7 gene of the tea trees plays a negative regulation role in the accumulation of theobromine and a positive regulation role in the accumulation of theacrine.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology; in particular, it relates to a method for affecting the expression of CsAP2.7 gene of tea plant to regulate two alkaloids, theobromine and theacrine, of tea plant. BACKGROUND

[0002] Tea is one of the three most important non-alcoholic beverages in the world. China has rich tea germplasm resources, and the tea industry has high output value and large scale. Tea leaves, as the source of tea raw materials, have rich metabolic components. Purine alkaloids are important metabolic substances in tea. The purine alkaloids of tea plant include theobromine, caffeine and theacrine. Theacrine has the effects of anti-inflammatory and analgesic, sedative and hypnotic, and anti-depression, which antagonize the effects of caffeine. The three alkaloids belong to the same metabolic pathway. Theobromine is synthesized into caffeine by 3,7-dimethylxanthine transferase, and caffeine is synthesized into theacrine by oxidation and N9-methyltransferase. Transcription factors have the function of binding to the promoters of target genes to regulate the expression of target genes of the synthesis enzyme type, thereby regulating the accumulation of metabolites synthesized by target genes. It is feasible to use transcription factors to regulate the accumulation of alkaloids in tea plant. Existing studies have shown that NAC and MYB transcription factors regulate the content of caffeine in tea plant, but there are few reports on AP2 / ERF transcription factors regulating caffeine. In addition, the key synthesis enzyme of theacrine has just been resolved in recent years, and there is no report on transcription factors regulating theacrine. SUMMARY

[0003] The technical problem to be solved by the present application is to provide the application of CsAP2.7 gene expression technology in regulating the accumulation of theobromine and theacrine in tea plant.

[0004] To solve the above technical problem, the present application provides the use of CsAP2.7 gene in regulating the accumulation of alkaloids in plants. The nucleotide sequence of CsAP2.7 gene is shown in SEQ ID NO: 1. The amino acid sequence of the protein encoded by CsAP2.7 gene is shown in SEQ ID NO: 2.

[0005] As an improvement of the use of CsAP2.7 gene in the present application: the plant is tea plant; the alkaloids include theobromine and theacrine.

[0006] As a further improvement of the use of CsAP2.7 gene in the present application: negatively regulating the accumulation of theobromine in tea plant (especially the tender leaves and tender buds of tea plant at one bud and one leaf stage), and positively regulating the accumulation of theacrine in tea plant (especially the tender leaves and tender buds of tea plant at one bud and one leaf stage).

[0007] The application also provides a method for regulating the accumulation of alkaloids in tea plants: regulating the accumulation of alkaloids in plants by inhibiting the expression of the CsAP2.7 gene, wherein the nucleotide sequence of the CsAP2.7 gene is as shown in SEQ ID NO: 1.

[0008] As an improvement of the method for regulating the accumulation of alkaloids in tea plants of the application: increasing the theobromine content and inhibiting the theacrine content in tea plants.

[0009] As a further improvement of the method for regulating the accumulation of alkaloids in tea plants of the application: increasing the theobromine content and inhibiting the theacrine content in tea leaves.

[0010] As a further improvement of the method for regulating the accumulation of alkaloids in tea plants of the application: the theobromine content of tea leaves (tea leaf buds) obtained by silencing the CsAP2.7 gene is increased and the theacrine content is decreased.

[0011] The CsAP2.7 gene is used for antisense inhibition of tea leaves, and the theobromine content of antisense-inhibited tea leaves is increased and the theacrine content is decreased. That is, the theobromine content of tea plants obtained by silencing the CsAP2.7 gene is increased and the theacrine content is decreased.

[0012] As a further improvement of the method for regulating the accumulation of alkaloids in tea plants of the application: the antisense primer used for silencing the CsAP2.7 gene is as follows:

[0013] The antisense primer used for silencing the CsAP2.7 gene is as follows:

[0014] CsAP2.7 antisense primer-1: 5'ACACTGCACAAATGCGGACG 3'

[0015] CsAP2.7 antisense primer-2: 5'GACAAGGCTGCAATAAAATG 3'

[0016] CsAP2.7 antisense primer-3: 5'ACTTTGAGGCAAGCACATAT 3'

[0017] CsAP2.7 antisense primer-4: 5'GAGGCAAGCACATATGAAGA 3'

[0018] CsAP2.7 antisense primer-5: 5'TTACAACCTAGCAACAAAGC 3'.

[0019] The application also simultaneously provides an antisense inhibition treatment solution for the CsAP2.7 gene, which is prepared by mixing equal amounts of the CsAP2.7 antisense primer-1, the CsAP2.7 antisense primer-2, the CsAP2.7 antisense primer-3, the CsAP2.7 antisense primer-4 and the CsAP2.7 antisense primer-5 as described above, and then diluting and preparing by adding distilled water, wherein the concentration of each primer in the antisense inhibition treatment solution is 20±2 μM.

[0020] The application first constructs a tea tree CsAP2.7 gene antisense inhibition gene silencing plant and performs a function research. By determining theobromine and theacrine through ultra-high performance liquid chromatography, it is found that the tea tree CsAP2.7 gene plays a negative regulation and positive regulation role in theobromine and theacrine accumulation, respectively. That is, the expression of the tea tree CsAP2.7 makes theobromine accumulation decrease and theacrine accumulation increase.

[0021] It should be noted that:

[0022] The known use of the CsAP2.7 gene is to participate in the flowering-related growth and development process and plant innate immunity, and thus has no any relevance to the use of the application.

[0023] At present, no gene capable of simultaneously regulating theobromine and theacrine accumulation in tea trees has been reported. The known gene capable of regulating theobromine alone is CsMYB114, which belongs to a completely different gene family from the CsAP2.7 of the application. The gene of the upstream transcription factor type capable of regulating theacrine alone has not been reported. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to make the purpose, technical scheme and advantages of the application more clear, the specific embodiments of the application are further described in detail below with reference to the drawings.

[0025] Figure 1 is the expression amount of the CsAP2.7 gene in the CsAP2.7 gene antisense inhibition gene silencing tea tree leaf;

[0026] Figure 2 is the theobromine and theacrine content of the CsAP2.7 gene antisense inhibition gene silencing tea tree leaf;

[0027] The left graph is the theobromine content of the tea tree leaf in different treatment groups, and the right graph is the theacrine content of the tea tree leaf in different treatment groups.

[0028] In the above graphs:

[0029] Blank is a blank control group, CsAP2.7 AS is an antisense inhibition treatment group, and CsAP2.7 S is a negative control group. Different letters represent significant differences (p<0.05) between different groups. DETAILED DESCRIPTION

[0030] The application will be further described in connection with specific embodiments, but the scope of protection of the application is not limited thereto:

[0031] I. Obtain the full-length sequence of CsAP2.7 gene of tea plant

[0032] The full gene amplification primer was designed by Primer Premier 6.0, the cDNA of one bud and one leaf of tea plant variety Jianghuakuicha planted in the Tea Research Institute of Chinese Academy of Agricultural Sciences was taken as a template (the extraction method of cDNA was a conventional technology, for example, refer to CN 104561025A), the specific primers CsAP2.7-F and CsAP2.7-R were designed, and the CsAP2.7 fragment was amplified by KOD-plus-NEO high-fidelity enzyme PCR.

[0033] The primer sequence was: CsAP2.7-F: 5'-ATGAAGAATTTGACGAAGGAAGAAT-3'

[0034] CsAP2.7-R: 5'-TTAAACCCTAGGACTTGCGATTACG-3'

[0035] The PCR amplification reaction system was: 10x PCR Buffer 5ul, 2mM dNTP 5ul, 25mM MgSO4 3ul, KOD-plus-NEO 1ul, ddH2O 32ul, cDNA 1ul, 1.5ul of the upper and lower primers, a total of 50ul. The PCR reaction program was: 94℃ pre-denaturation for 2 minutes; 98℃ denaturation for 10 seconds, 53℃ annealing for 30 seconds, 68℃ extension for 2 minutes, 35 cycles; finally 68℃ terminal extension for 5 minutes, the obtained PCR product was identified by 1% agarose gel electrophoresis, then the amplification band was recovered and purified by Axygen DNA gel kit, the recovered product was constructed into Peasy-Blunt-Zero vector, and the above recombinant plasmid was sent to Huikang Company for sequencing confirmation.

[0036] The nucleotide sequence of the obtained gene CsAP2.7 is shown as SEQ ID No: 1; the amino acid sequence of the protein encoded by the gene is shown as SEQ ID No: 2.

[0037] II. Design and synthesis of CsAP2.7 gene antisense inhibition primer and negative control sense primer

[0038] Using Soligo online design software, the obtained SEQ ID No: 1 nucleotide sequence was submitted, and according to the calculation results, five 20bp oligonucleotides in the five regions of SEQ ID No: 1 nucleotide sequence were obtained, the five regions (starting with the start codon) were 91-110bp, 154-173bp, 197-216bp, 202-221bp and 526-545bp, respectively, and the oligonucleotide chain with lower binding energy was selected in each of the five regions, and the deoxynucleotide chain "CsAP2.7 antisense primer-1~5" was designed as an antisense inhibition primer according to the oligonucleotide chain, and the base complementary chain of the antisense inhibition primer was used as a negative control positive primer, and the corresponding primer with an OD value of 200 was synthesized by Kang Company. The specific primer sequences are shown in Table 1 (the primers are in the 5' to 3' direction).

[0039] Table 1, nucleotide sequences of CsAP2.7 gene antisense inhibition primers and negative control positive primers

[0040]

[0041] Three, construction and detection of CsAP2.7 gene antisense inhibition material:

[0042] Mix the five CsAP2.7 antisense primers in Table 1 in equal amounts, add distilled water to dilute to prepare an antisense inhibition treatment solution containing each primer at a concentration of 20μM; mix the five CsAP2.7 positive primers in equal amounts, add distilled water to dilute to prepare a negative control treatment solution containing each positive primer at a concentration of 20μM. At the same time, a blank control group containing only distilled water without primers is set.

[0043] One bud and one leaf of tea variety Jianghuakuocha from the National Germplasm Hangzhou Tea Garden Base in the Tea Research Institute of Chinese Academy of Agricultural Sciences were taken, ensuring that the taken one bud and one leaf were healthy buds and leaves grown from new shoots this year, and were uniform in size and growth state. The picked one bud and one leaf were randomly divided into groups and placed in the above-mentioned blank control group (Blank), antisense inhibition treatment group (CsAP2.7 AS) and negative control group (CsAP2.7 S), with at least eight or more biological replicates in each group. Place in a light incubator, with a culture condition of about 25℃, a 16h / 8h light / dark cycle. Supplement the treatment solution in each group daily to prevent the buds and leaves from drying out.

[0044] Four, research on CsAP2.7 gene antisense inhibition of the accumulation of theobromine and theacrine in tea

[0045] On the 5th day of treatment, the buds and leaves were frozen in liquid nitrogen and ground in a ball mill. RNA was extracted according to the method of Tiangeng Polysaccharide and Polyphenol RNA Kit, and cDNA was extracted by reverse transcription. The expression of CsAP2.7 gene in each group was determined by fluorescence quantification method. The results are shown in Figure 1According to the above Figure 1 It can be known that the antisense inhibition treatment reduces the expression of CsAP2.7 gene. Relative to the blank control group, the treatment of the negative control group has no significant effect on the expression of CsAP2.7 gene.

[0046] Theobromine and theacrine determination. 0.1 g of tea tree bud leaf ground powder was weighed into a 15 mL centrifuge tube. 10 mL of 70% methanol (chromatographic grade) was added and mixed well. Ultrasonic cleaning instrument was used at 80% power for 45 minutes, and shaken every 15 minutes. After ultrasonic treatment, it was placed at 4°C for 2 hours of precipitation. The supernatant was filtered through a 0.22 μm membrane into a 1.5 mL sample bottle. Waters ACQUITY H-Class ultra-high performance liquid chromatograph (equipped with 1290 Infinity II high-speed pump, diode array detector, evaporative light scattering detector, workstation, etc.) (Waters, USA) was used as the detection instrument, and ACQUITY UPLC HSS T3 C18 (1.8 μm, 2.1 mm x 100 mm, Waters) chromatographic column was used. The detection wavelength was 280 nm, the column temperature was 41°C, the mobile phase A was 0.1% formic acid aqueous solution, the mobile phase B was acetonitrile, and the flow rate was 0.4 mL·min -1 .

[0047] Mass spectrometry was performed on the separated substances, and theobromine was detected at about 3 minutes and theacrine was detected at about 8 minutes. The same extraction and detection process was performed using theobromine and theacrine standards, and the peak times of theobromine and theacrine standards were 3 minutes and 8 minutes, respectively, which was consistent with the mass spectrometry experiment. The contents of theobromine and theacrine in the tea tree bud leaf sample were calculated according to the peak areas at 3 minutes and 8 minutes in the experiment under the established liquid chromatography conditions and the gradient content regression curve of the peak area.

[0048] The results are shown in Table 1 Figure 2 According to the above Figure 2 It can be known that the antisense inhibition of CsAP2.7 gene expression increases theobromine content and reduces theacrine content, and there is no significant difference in alkaloid content between the negative control group (S) and the blank control group (Blank), indicating that CsAP2.7 gene inhibits the accumulation of theobromine in tea tree bud leaves and promotes the accumulation of theacrine in tea tree bud leaves.

[0049] Finally, it should be noted that the above only lists some specific embodiments of the present application. Obviously, the present application is not limited to the above embodiments, and many modifications can be made. All modifications that can be directly derived or inferred from the disclosure of the present application by those of ordinary skill in the art should be considered within the scope of the present application.

Claims

1. A method of modulating alkaloid accumulation in tea plants, characterised by: By inhibiting CsAP2.7 Gene expression increases the theobromine content and reduces the theophylline content of tea, said CsAP2.7 The nucleotide sequence of the gene is as described in SEQ ID NO:

1.

2. The method of claim 1, wherein the tea plant is Camellia sinensis var. sinensis. CsAP2.7 The antisense primers used for gene silencing were as follows: CsAP2.7 Antisense primer-1: 5' ACACTGCACAAATGCGGACG 3' CsAP2.7 Antisense primer-2: 5' GACAAGGCTGCAATAAAATG 3' CsAP2.7 Antisense primer-3: 5' ACTTTGAGGCAAGCACATAT 3' CsAP2.7 Antisense primer-4: 5' GAGGCAAGCACATATGAAGA 3' CsAP2.7 Antisense primer-5: 5' TTACAACCTAGCAACAAAGC 3'.

3. The method of claim 2, wherein the tea plant is Camellia sinensis var. sinensis. For CsAP2.7 The antisense inhibition treatment solution of the gene is prepared by mixing CsAP2.7 antisense primer-1, CsAP2.7 antisense primer-2, CsAP2.7 antisense primer-3, CsAP2.7 antisense primer-4, CsAP2.7 antisense primer-5 in equal amounts and then adding distilled water for dilution. The concentration of each primer in the antisense inhibition treatment solution is 20±2 μM.

Images