Application of ClVDAC1 gene in regulation and control of growth and development, fruit quality, seed quality, low-temperature resistance and wilt resistance of watermelons

Abstract

The invention relates to the technical field of plant genetic engineering. The invention provides application of the ClVDAC1 gene in regulation and control of growth and development, fruit quality, seed quality, low-temperature resistance and wilt resistance of watermelons. A watermelon ClVDAC1 gene overexpression and gene silencing material is constructed through a transgenosis means, and it is found that due to ClVDAC1 gene overexpression, the stem diameter, the vine length, the seed weight, the fruit weight, the fruit vitamin C content and the like of a watermelon plant are increased, the fruit organic acid content is reduced, and the sugar-acid ratio is also increased, that is, the ClVDAC1 gene overexpression can promote growth and development of watermelons, and the yield of the watermelons is increased. The yield of watermelons and the taste quality and nutritional quality of fruits are improved, the quality and storage and transportation resistance of watermelon seeds are also improved, and a foundation is laid for preparing a high-quality, high-yield and storage and transportation-resistant watermelon material; the resistance of watermelon plants to low temperature is improved through ClVDAC1 gene silencing.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to application of the ClVDAC1 gene in regulating watermelon growth and development, fruit quality, seed quality, low temperature resistance and wilt resistance. Background Art

[0002] Watermelon is an important horticultural crop in my country and even in the world. Due to its short production cycle, quick effect and stable benefits, it has developed rapidly in the planting industry and has become the leading industry in some regions. However, environmental stresses such as low temperature in winter and spring and wilt caused by continuous cropping affect the growth and development of watermelon plants, causing the plants to wilt or even die, which in turn affects the yield and quality of watermelon, seriously restricting the high-quality production and branding development of watermelon and the sustainable and healthy development of the watermelon industry. In addition, with the improvement of living standards, people have put forward higher requirements for the quality of watermelon fruits. The selection and application of high-quality multi-resistant watermelon new varieties is the fundamental guarantee for promoting the increase of melon farmers' income and the development of the watermelon industry. However, conventional hybrid breeding takes a long time, the phenotype is uncontrollable, and it is restricted by the breeding environment, which restricts the selection and breeding progress of high-quality multi-resistant watermelon varieties.

[0003] Molecular breeding technology is the core key technology for the transformation from "experience breeding" to directional and efficient "precision breeding". The mining of excellent genes is the premise of molecular breeding. Therefore, mining excellent genes is crucial for accelerating the breeding of new watermelon varieties using molecular technology.

[0004] Therefore, providing excellent genes for regulating watermelon resistance and fruit quality and their application in regulating plant resistance and fruit quality is an urgent problem to be solved by those skilled in the art.

[0005] VDAC (voltage-dependent anion-selective channel) is a highly abundant protein in the outer membrane of animal and plant mitochondria. It plays a key role in promoting the transport of ions and metabolites between mitochondria and cytoplasm and regulating energy conversion. There are many reports on the role of VDAC in animals, especially in the immune response to pathogens. The function of VDAC in regulating plant reproductive development and stress response has been reported. In Arabidopsis, AtVDAC3 negatively regulates the seed germination process under cold stress by interacting with HSP70-16 and kinase-like protein 1; AtVDAC1 also plays a negative regulatory role in plant cold response during seed germination and seedling development in Arabidopsis; overexpression of Pennisetum VDAC can enhance the salt tolerance of rice; overexpression of Arabidopsis VDAC2 leads to drought tolerance in plants in an ABA-dependent manner. However, the function of VDAC in regulating plant growth and fruit development has rarely been reported, and the sequences of VDACs in different plants are different, resulting in great differences in their functions. Summary of the invention

[0006] The object of the present invention is to provide an application of a ClVDAC1 gene in regulating watermelon growth and development, light energy utilization efficiency, watermelon yield, fruit taste quality and nutritional quality, fruit storage and transportation tolerance, seed quality, watermelon plant low temperature resistance and wilt disease resistance.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The invention provides application of ClVDAC1 gene in regulating the growth and development of watermelon, wherein the sequence of the ClVDAC1 gene is shown in SEQ ID NO.12; overexpression of the ClVDAC1 gene increases the stem thickness, vine length, leaf number and internode length of watermelon plants.

[0009] The present invention provides an application of the ClVDAC1 gene in regulating the yield and quality of watermelon fruits, and overexpressing the ClVDAC1 gene improves the yield, taste quality and nutritional quality of watermelon.

[0010] The invention provides application of the ClVDAC1 gene in regulating the storage and transportation resistance of watermelon, and overexpression of the ClVDAC1 gene increases the thickness of the watermelon peel.

[0011] The present invention provides application of the ClVDAC1 gene in regulating watermelon seed quality, and overexpression of the ClVDAC1 gene increases watermelon seed weight.

[0012] The invention provides a system for overexpressing a ClVDAC1 gene, comprising an overexpression vector pCambia1305.4-ClVDAC1.

[0013] Preferably, the structure of the pCambia1305.4 vector in the overexpression vector pCambia1305.4-ClVDAC1 is (CaMV 35S)-(MCS)-(NOS terminator)-(CaMV 35S)-(GFP).

[0014] The present invention provides a method for preparing a pCambia1305.4 vector, comprising the following steps:

[0015] (1) Using pCambia1305 as the original vector, the GUSPlus sequence was removed and the GFP sequence was connected to obtain the pCambia1305-GFP vector;

[0016] (2) The lac promoter sequence on the pCambia1305-GFP vector was removed and connected to the CaMV 35S promoter sequence to obtain the pCambia1305-35S-GFP vector;

[0017] (3) The NOS terminator sequence was connected to the pCambia1305-35S-GFP vector to obtain the pCambia1305.4 vector.

[0018] Preferably, the GFP sequence is shown as SEQ ID NO.3, the CaMV 35S promoter sequence is shown as SEQ ID NO.6, and the NOS terminator sequence is shown as SEQ ID NO.9.

[0019] The invention provides application of the ClVDAC1 gene in regulating the low temperature resistance of watermelon plants, and inhibits the expression of the ClVDAC1 gene to improve the low temperature resistance of the watermelon plants.

[0020] The invention provides application of the ClVDAC1 gene in regulating the wilt resistance of watermelon plants. Overexpression of the ClVDAC1 gene inhibits the wilt resistance of watermelon plants.

[0021] The present invention also provides a system for silencing the ClVDAC1 gene, comprising a pTRSV1 plasmid, a recombinant plasmid pTRSV2-ClVDAC1 and a p19 virus.

[0022] The present invention also provides an application of the system for silencing the ClVDAC1 gene, comprising the following steps:

[0023] (1) The pTRSV1 plasmid, the recombinant plasmid pTRSV2-ClVDAC1 and the p19 virus were transformed into Agrobacterium, and cultured to obtain Agrobacterium culture liquid 1, Agrobacterium culture liquid 2 and p19 virus Agrobacterium culture liquid;

[0024] (2) mixing Agrobacterium solution 1, Agrobacterium solution 2 and p19 virus Agrobacterium solution in a volume ratio of (0.8-1.2):1:(0.8-1.2) and injecting the mixture into tobacco leaves to obtain an infection solution;

[0025] (3) Using the infection solution of step (2) to treat crop plants, to obtain crop plants with silenced ClVDAC1 gene.

[0026] Preferably, the OD of the Agrobacterium culture 1 in step (1) is 600 The OD of the Agrobacterium bacterial solution 2 is 0.8-1.2. 600 The OD of the p19 virus Agrobacterium solution is 0.9-1.2. 600 It is 0.9-1.1.

[0027] By adopting the above technical solution, the present invention has the following beneficial effects:

[0028] The technical scheme of the present invention constructs watermelon ClVDAC1 overexpression and gene silencing materials by means of transgenic means, regulates the expression level of the ClVDAC1 gene to study its regulatory effect on watermelon plant growth, resistance, yield, fruit quality, fruit storage and transportation resistance and seed quality, and finds that ClVDAC1 overexpression increases the stem thickness, vine length, leaf number, internode length, seed weight, fruit weight, peel thickness and fruit vitamin C content of the watermelon plant, reduces the fruit organic acid content, increases the sugar-acid ratio and reduces the number of seeds per melon; ClVDAC1 gene silencing increases the resistance of watermelon plants to low temperature and physiological subspecies 1 of Fusarium wilt pathogen. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The overexpression vector pCambia1305.4-ClVDAC1 structure;

[0030] Figure 2 The expression of ClVDAC1 gene in overexpressing transgenic plants #1, #2, #4 and control group plants;

[0031] Figure 3 Results of stem diameter, vine length, leaf number and internode length of wild-type plants and overexpression transgenic plants #2 and #4 ( Figure 3 A represents stem thickness, B represents vine length, C represents leaf number, and D represents internode length);

[0032] Figure 4 The results of single fruit weight and fruit skin thickness of wild-type plants and overexpression transgenic plants #2 and #4 are shown in Figure 2. Figure 4 A represents the weight of a single melon, and B represents the thickness of the fruit skin);

[0033] Figure 5 Results of determination of vitamin C content, organic acid content, total soluble sugar content and sugar-acid ratio in fruits of wild-type plants and overexpression transgenic plants #2 and #4 ( Figure 5 A represents the vitamin C content, B represents the organic acid content, C represents the total soluble sugar content, and D represents the sugar-acid ratio);

[0034] Figure 6 The results of the determination of the number of seeds per fruit and the weight of seeds in the wild-type plants and the overexpressing transgenic plants #2 and #4 are shown in Figure 2. Figure 6 A represents the number of seeds in a single melon, and B represents the seed weight);

[0035] Figure 7 Results of low temperature resistance test of WT plants and plants overexpressing ClVDAC1 gene ( Figure 7 A represents the wilting conditions of different plants, B represents the Fv / Fm values ​​of different plants, and C represents the relative conductivity of different plants);

[0036] Figure 8 The resistance of WT plants and ClVDAC1 gene overexpressing plants to FON1 ( Figure 8 A represents the wilting condition of different plants, B represents the incidence rate of different plants, and C represents the disease index of different plants);

[0037] Fig. 9 The structure of ClVDAC1 gene silencing plasmid pTRSV2-ClVDAC1;

[0038] Fig.10 The expression of ClVDAC1 gene in ClVDAC1 gene silenced plants and control plants;

[0039] Fig.11 The resistance of ClVDAC1 gene silenced plants and control plants to low temperature ( Fig.11 A in the figure represents the wilting condition of different plants, B represents the Fv / Fm value of different plants, and C represents the relative conductivity of different plants). DETAILED DESCRIPTION

[0040] The invention provides application of the ClVDAC1 gene in regulating the growth and development of watermelon.

[0041] In the present invention, the sequence of the ClVDAC1 gene is shown in SEQ ID NO.12, and the specific sequence is

[0042] .

[0043] In the present invention, overexpression of the ClVDAC1 gene promotes the growth and development of watermelon, and increases the stem thickness, vine length, leaf number and internode length of the watermelon plant.

[0044] The present invention provides an application of the ClVDAC1 gene in regulating the yield and quality of watermelon fruits, and overexpressing the ClVDAC1 gene improves the yield, taste quality and nutritional quality of watermelon.

[0045] In the present invention, improving the taste quality of watermelon preferably includes reducing the organic acid content of watermelon fruit, increasing the sugar-acid ratio of watermelon fruit, and reducing the number of seeds and grains.

[0046] In the present invention, improving the nutritional quality of watermelon preferably includes increasing the vitamin C content of watermelon fruit.

[0047] The present invention also provides an application of the ClVDAC1 gene in regulating the storage and transportation resistance of watermelons, and overexpression of the ClVDAC1 gene increases the thickness of the watermelon peel.

[0048] The present invention also provides application of the ClVDAC1 gene in regulating watermelon seed quality, and overexpression of the ClVDAC1 gene increases watermelon seed weight.

[0049] The invention provides a system for overexpressing a ClVDAC1 gene, comprising an overexpression vector pCambia1305.4-ClVDAC1.

[0050] In the present invention, the structure of the pCambia1305.4 vector in the overexpression vector pCambia1305.4-ClVDAC1 is (CaMV 35S)-(MCS)-(NOS terminator)-(CaMV 35S)-(GFP).

[0051] The present invention also provides a method for preparing a pCambia1305.4 vector, comprising the following steps:

[0052] (1) Using pCambia1305 as the original vector, the GUSPlus sequence was removed and the GFP sequence was connected to obtain the pCambia1305-GFP vector;

[0053] (2) The lac promoter sequence on the pCambia1305-GFP vector was removed and connected to the CaMV35S promoter sequence to obtain the pCambia1305-35S-GFP vector;

[0054] (3) The NOS terminator sequence was connected to the pCambia1305-35S-GFP vector to obtain the pCambia1305.4 vector.

[0055] In the present invention, the GFP sequence is as shown in SEQ ID NO.3, and the specific sequence is atgggtaagggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaagcttcctgttccttggccaacacttgtcactactcttacttatggtgttcaatgcttttcaagatacccagatcatatgaagcggcacgacttcttcaagagcgccatgcctgagggatacgtgcaggaaaggaccatcttcttcaaggacgacgggaactacaagacacgtgctgaagtcaagtttgagggagacacccttgtcaacaggatcgagcttaagggaatcgatttcaaggaggacggaaacatcctcggccacaagttggaatacaactacaactcccacaacgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataa。

[0056] In the present invention, the CaMV 35S promoter sequence is as shown in SEQ ID NO.6, and the specific sequence is agattagccttttcaatttcagaaagaatgctaacccacagatggttagagaggcttacgcagcaggtctcatcaagacgatctacccgagcaataatctccaggaaatcaaataccttcccaagaaggttaaagatgcagtcaaaagattcaggactaactgcatcaagaacacagagaaagatatatttctcaagatcagaagtactattccagtatggacgattcaaggcttgcttcacaaaccaaggcaagtaatagagattggagtctctaaaaaggtagttcccactgaatcaaaggccatggagtcaaagattcaaatagaggacctaacagaactcgccgtaaagactggcgaacagttcatacagagtctcttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttcatttggagagaacacgggggactctagaggatcc。

[0057] In the present invention, the NOS terminator sequence is as shown in SEQ ID NO.9, and the specific sequence is

[0058] ccatcacgtgtgaattggtgaccagctcgaatttccccgatcgttcaaacatttggcaataaagtttcttaagattgaatc

[0059] ctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacg

[0060] ttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttatactagatc.

[0061] The present invention also provides an application of the ClVDAC1 gene in regulating the low temperature resistance of watermelon plants, and inhibits the expression of the ClVDAC1 gene to improve the low temperature resistance of the watermelon plants.

[0062] The present invention also provides application of the ClVDAC1 gene in regulating the resistance of watermelon plants to wilt disease. Overexpression of the ClVDAC1 gene inhibits the resistance of watermelon plants to wilt disease.

[0063] The present invention also provides a system for silencing the ClVDAC1 gene, comprising a pTRSV1 plasmid, a recombinant plasmid pTRSV2-ClVDAC1 and a p19 virus.

[0064] The present invention also provides an application of the system for silencing the ClVDAC1 gene, comprising the following steps:

[0065] (1) The pTRSV1 plasmid, the recombinant plasmid pTRSV2-ClVDAC1 and the p19 virus were transformed into Agrobacterium, and cultured to obtain Agrobacterium culture liquid 1, Agrobacterium culture liquid 2 and p19 virus Agrobacterium culture liquid;

[0066] (2) mixing Agrobacterium solution 1, Agrobacterium solution 2 and p19 virus Agrobacterium solution in a volume ratio of (0.8-1.2):1:(0.8-1.2) and injecting the mixture into tobacco leaves to obtain an infection solution;

[0067] (3) Using the infection solution of step (2) to treat crop plants, to obtain crop plants with silenced ClVDAC1 gene.

[0068] In the present invention, the OD of the Agrobacterium culture 1 in step (1) is 600Preferably, it is 0.8-1.2, more preferably 0.9-1.1, and even more preferably 1.0; the OD of the Agrobacterium bacterial solution 2 is 600 Preferably, it is 0.9-1.2, more preferably 0.92-1.1, and even more preferably 1.0; the OD of the p19 virus Agrobacterium bacterial solution is 600 It is preferably 0.9-1.1, more preferably 0.95-1.05, and further preferably 1.0.

[0069] In the present invention, the volume ratio of the Agrobacterium solution 1, Agrobacterium solution 2 and p19 virus Agrobacterium solution mixed in step (2) is preferably (0.8-1.2):1:(0.8-1.2), further preferably (0.9-1.1):1:(0.9-1.1), and further preferably 1:1:1.

[0070] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0071] Example 1 Construction of ClVDAC1 gene overexpression vector

[0072] (I) Preparation of pCambia1305.4 vector

[0073] The pCambia1305.4 vector is modified based on the pCambia1305 vector. The specific modification process is as follows:

[0074] 1. Obtain pCambia1305-GFP vector

[0075] The original GUSPlus tag was replaced with a GFP tag, where the GFP sequence came from the PBI221-GFP vector (provided by the Muskmelon Research Group of Northwest A&F University). Specific primers were designed, and the homology arm sequences of the pCambia1305 vector (provided by Professor Li Dawei of Northwest A&F University; Jingjing Chang, Yanliang Guo, Jingyi Yan, Zixing Zhang, Li Yuan, Chunhua Wei, Yong Zhang, Jianxiang Ma, Jianqiang Yang, Xian Zhang, and Hao Li. The role of watermelon caffeic acid O-methyltransferase (ClCOMT1) in melatonin biosynthesis and abiotic stress tolerance. Horticulture Research (2021) 8: 210) were added to the 5' end of the primers, named GFP-F and GFP-R. The sequence of the GFP-F is shown in SEQ ID NO.1, and the specific sequence is 5'-acgggggactcttgaccatggatgggtaagggagaagaacttt-3'; the sequence of the GFP-R is shown in SEQ ID NO.2, and the specific sequence is 5'-gagctggtcaccaattcacacttatttgtatagttcatccatgcc-3'.

[0076] Then, PCR amplification was performed using the PBI221-GFP vector as a template. The PCR reaction system was as follows: Primer START Max Premix (2x) 25 μL, PBI221-GFP 2 μL, GFP-F 1 μL, GFP-R 1 μL, ddH 2 O 21μL; PCR reaction program: 98℃10s, 55℃5s, 72℃10s, 30 cycles; 72℃5min.

[0077] After purification and recovery, a GFP fragment containing the homology arm of the pCambia1305 vector was obtained. The purified product was ligated with the pCambia1305 linearized vector (GUSPlus removed) digested with Nco I and Pml I restriction endonucleases to obtain the pCambia1305-GFP vector containing a GFP tag.

[0078] The nucleotide sequence of GFP is shown in SEQ ID NO.3, and the specific sequence is atgggtaagggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaagcttcctgttccttggccaacacttgtcactactcttacttatggtgttcaatgcttttcaagatacccagatcatatgaagcggcacgacttcttcaagagcgccatgcctgagggatacgtgcaggaaaggaccatcttcttcaaggacgacgggaactacaagacacgtgctgaagtcaagtttgagggagacacccttgtcaacaggatcgagcttaagggaatcgatttcaaggaggacggaaacatcctcggccacaagttggaatacaactacaactcccacaacgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataa。

[0079] 2. Obtain the pCambia1305-35S-GFP vector

[0080] On the basis of pCambia1305-GFP vector, the lac promoter was replaced by the CaMV 35S promoter, wherein the CaMV35S promoter sequence was from the PBI121 vector (provided by the Muskmelon Research Group of Northwest Agriculture and Forestry University), and specific primers were designed, and the homology arm sequences of pCambia1305 were added to the 5' ends of the primers, respectively, and named 35S-F and 35S-R. The sequence of the 35S-F is shown in SEQ ID NO.4, and the specific sequence is 5'-acgagagtgtcgtgctccaccatgagattagccttttcaatttcag-3'; the sequence of the 35S-R is shown in SEQ ID NO.5, and the specific sequence is 5'-cttgcatgcctgcaggtcgacggatcctctagagtcccccgtg-3'.

[0081] Then, PCR amplification was performed using the PBI121 vector as a template. The PCR reaction system was: Primer START Max Premix (2x) 25 μL, PBI121 2 μL, 35S-F 1 μL, 35S-R 1 μL, ddH 2 O21μL; PCR reaction program: 98℃10s, 55℃5s, 72℃10s, 30 cycles; 72℃5min.

[0082] After purification and recovery, the CaMV 35S fragment containing the homology arm of the pCambia1305 vector was obtained. The purified product was ligated with the pCambia1305-GFP linearized vector (lac promoter removed) digested with BstXI and Sal I restriction endonucleases to obtain the pCambia1305-35S-GFP vector containing the CaMV 35S promoter and GFP tag.

[0083] The nucleotide sequence of CaMV 35S is shown in SEQ ID NO.6, and the specific sequence is agattagccttttcaatttcagaaagaatgctaacccacagatggttagagaggcttacgcagcaggtctcatcaagacgatctacccgagcaataatctccaggaaatcaaataccttcccaagaaggttaaagatgcagtcaaaagattcaggactaactgcatcaagaacacagagaaagatatatttctcaagatcagaagtactattccagtatggacgattcaaggcttgcttcacaaaccaaggcaagtaatagagattggagtctctaaaaaggtagttcccactgaatcaaaggccatggagtcaaagattcaaatagaggacctaacagaactcgccgtaaagactggcgaacagttcatacagagtctcttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttcatttggagagaacacgggggactctagaggatcc。

[0084] 3. Obtain the pCambia1305.4 vector

[0085] On the basis of pCambia1305-35S-GFP vector, NOS terminator was added behind the CaMV 35S promoter, wherein the NOS terminator sequence came from the pCambia1305 vector, specific primers were designed, and the homology arm sequences of pCambia1305 were added to the 5' ends of the primers, respectively, and they were named NOS-F and NOS-R. The sequence of NOS-F is shown in SEQ ID NO.7, and the specific sequence is 5'-gactctagaggatccgtcgactcaccatcacgtgtgaattggt-3'; the sequence of NOS-F is shown in SEQ ID NO.8, and the specific sequence is 5'-aacgacggccagtgccaagctgatctagtaacatagatgacaccg-3'.

[0086] Then, PCR amplification was performed using the pCambia1305 vector as a template. The PCR reaction system was as follows: Primer START Max Premix (2x) 25 μL, pCambia1305 2 μL, NOS-F 1 μL, NOS-R 1 μL, ddH 2 O 21μL; PCR reaction program: 98℃10s, 55℃5s, 72℃10s, 30 cycles; 72℃5min.

[0087] After purification and recovery, the NOS terminator fragment containing the homology arms of the pCambia1305 vector was obtained, and the purified product was ligated with the pCambia1305-35S-GFP linearized vector digested with Sal I and Hind III restriction endonucleases to obtain the pCambia1305 vector containing the CaMV 35S promoter and GFP tag, named pCambia1305.4. The structure of pCambia1305.4 is: (CaMV 35S)-(MCS)-(NOS terminator)-(CaMV 35S)-(GFP).

[0088] The nucleotide sequence of NOS terminator is shown in SEQ ID NO.9, and the specific sequence is ccatcacgtgtgaattggtgaccagctcgaatttccccgatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcgcggtgtcatctatgttactagatc.

[0089] (II) Construction of ClVDAC1 gene overexpression vector

[0090] The ClVDAC1 gene was cloned from the cDNA of the watermelon wild-type material YL (Zhang Yueqiao, Ge Jie, Tian Shujuan, Yuan Li. 2020. Detection of target sites of the watermelon CRISPR / Cas9 system using the Agrobacterium rhizogenes system. Chinese Vegetables, 33(4): 7-11.).

[0091] According to the coding region sequence of the ClVDAC1 (Cla97C08G151760) reference sequence provided in the Cucurbit Genomics Database, specific primers were designed, and the homology arm sequences of the pCambia1305.4 vector were added to the 5' ends of the primers, respectively, and they were named ClVDAC1-F and ClVDAC1-R. The sequence of the ClVDAC1-F is shown in SEQ ID NO.10, and the specific sequence is 5'-acgggggactctagaggatccatggggaaaggtccaggtctc-3'; the sequence of the ClVDAC1-R is shown in SEQ ID NO.11, and the specific sequence is 5'-ctggtcaccaattcacacgtgttagtggtggtggtggtggtggtgaggcttgagagccaaggccag-3'.

[0092] Then, PCR amplification was performed using the cDNA of watermelon YL material as a template. The PCR reaction system was: Primer STARTMax Premix (2x) 25 μL, cDNA 2 μL, ClVDAC1-F 1 μL, ClVDAC1-R 1 μL, ddH 2O 21μL; PCR reaction program: 98℃10s, 55℃5s, 72℃10s, 30 cycles; 72℃5min.

[0093] After purification and recovery, the ClVDAC1 fragment containing the homology arms of the pCambia1305.4 vector was obtained, and the purified product was ligated with the pCambia1305.4 linearized vector digested with BamHI and Pml I restriction endonucleases to obtain the overexpression vector pCambia1305.4-ClVDAC1 (eg Figure 1The nucleotide sequence of ClVDAC1 gene is shown in SEQ ID NO.12, and the specific sequence is.

[0094] The results showed that the cloned ClVDAC1 cDNA sequence was consistent with the cDNA sequence (Cla97C08G151760) and amino acid sequence of 97103 whole genome sequencing materials published in the Cucurbit Genomics Database.

[0095] Example 2 Construction and detection of ClVDAC1 gene overexpression plants

[0096] The overexpression vector pCambia1305.4-ClVDAC1 prepared above was transformed into Agrobacterium tumefaciens EHA105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.), and explants prepared from YL watermelon cotyledons were infected to induce callus tissue in M519 solid medium containing 2,4-D. Explants transformed with the overexpression vector were screened with hygromycin, and explants transformed with the editing vector were screened with the herbicide BASTA, subcultured every two weeks, and positive transgenic tissues were detected at 6-8 weeks.

[0097] RT-qPCR was used to verify the transgenic plants overexpressing ClVDAC1 (ClVDAC1-OE). The 20 μL reaction system contained 10 μL SYBR Premix ExTaq, 0.8 μL Primer F + 0.8 μL Primer R (10 μM), 6 μL ddH 2 O, 0.4 μL ROXⅡ and 2 μL cDNA template (100 ng), the reaction was carried out in two steps, the conditions were: pre-denaturation at 95℃ for 30 s; denaturation at 95℃ for 5 s, annealing at 60℃ for 30 s, 40 cycles. Primer Premier 6.0 software was used to design specific primers for RT-PCR analysis, and β-actin was used as an internal reference.

[0098] The sequence of the ClVDAC1-qRTPCR-F is shown in SEQ ID NO.13, and the specific sequence is 5'-atgccctcactgcctcctacta-3'; the sequence of the ClVDAC1-qRTPCR-R is shown in SEQ ID NO.14, and the specific sequence is 5'-tcgtgctggattagaccgcttg-3'; the sequence of the β-actin-F is shown in SEQ ID NO.15, and the specific sequence is 5'-ccatgtatgttgccatccag-3'; the sequence of the β-actin-R is shown in SEQ ID NO.16, and the specific sequence is 5'-ggatagcatggggtagagca-3'.

[0099] RT-qPCR test results are as follows Figure 2 The results showed that the expression levels of ClVDAC1 gene in overexpressing transgenic plants #1, #2 and #4 were 18.26 times, 19.22 times and 24.99 times that of wild-type tissues, respectively.

[0100] Example 3 Detection of growth, fruit and seed characteristics of ClVDAC1 gene overexpressing plants

[0101] Wild-type YL (WT) and ClVDAC1 overexpressing plants were planted in the Rougu watermelon experimental base in Yangling, Shaanxi Province in early April. Four growth indices, namely stem diameter, vine length, leaf number and internode length, were tested during the vine extension period. Eight fruit characteristics, namely single melon weight, pericarp thickness, vitamin C content, total soluble sugar content, organic acid content, sugar-acid ratio, number of seeds per melon and seed weight, were tested after the fruit matured.

[0102] like Figure 3 It can be seen that the stem diameter, vine length, leaf number and internode length of the overexpressing transgenic plant #2 (ClVDAC1-OE#2) and the overexpressing transgenic plant #4 (ClVDAC1-OE#4) were higher than those of the wild type YL, indicating that overexpression of the ClVDAC1 gene promoted the growth and light energy utilization efficiency of YL watermelon plants.

[0103] like Figure 4 It can be seen that the single fruit weight and peel thickness of the overexpression transgenic plant #2 and the overexpression transgenic plant #4 are greater than those of the wild type YL, indicating that overexpression of the ClVDAC1 gene improves the yield and storage and transportation resistance of watermelon fruit.

[0104] like Figure 5 It can be seen that the vitamin C content and sugar-acid ratio of the fruits of the overexpression transgenic plant #2 and the overexpression transgenic plant #4 were higher than those of the wild-type YL, and the organic acid content was lower than that of the wild-type YL, indicating that overexpression of the ClVDAC1 gene improved the taste and nutritional quality of the fruit.

[0105] like Figure 6 It can be seen that the number of seeds per fruit of the overexpression transgenic plant #2 and the overexpression transgenic plant #4 is less than that of the wild type YL, indicating that the overexpression of the ClVDAC1 gene improves the taste quality of the fruit and can be used to create low-seed watermelon materials; the seed weight of the overexpression transgenic plant #2 and the overexpression transgenic plant #4 is higher than that of the wild type YL, indicating that the overexpression of the ClVDAC1 gene improves the seed quality.

[0106] Example 4 Evaluation of low temperature and wilt resistance of plants overexpressing the ClVDAC1 gene

[0107] (I) Evaluation of low temperature resistance of ClVDAC1 gene overexpressing plants

[0108] WT plants and ClVDAC1 gene overexpressing plants were sown in nutrient pots. When the plants grew to 4 leaves and 1 heart, they were treated with 4°C low temperature, with 25°C as the normal temperature control, for 48 hours.

[0109] The results are as follows Figure 7As shown in the figure, after low temperature stress, ClVDAC1 gene overexpression plants wilted more obviously than WT plants, and their Fv / Fm value was lower than that of WT plants, but their relative conductivity was higher than that of WT plants, indicating that ClVDAC1 gene overexpression reduced the low temperature resistance of watermelon plants. Based on the function of ClVDAC1 gene in negatively regulating the low temperature resistance of watermelon, gene editing technology can be used to create low temperature resistant watermelon materials.

[0110] (II) Evaluation of resistance to Fusarium wilt in plants overexpressing the ClVDAC1 gene

[0111] When the WT plants and the ClVDAC1 gene overexpression plants grew to 2 leaves and 1 heart, they were artificially inoculated with the physiological subspecies 1 of Fusarium wilt pathogen (FON1, isolated and preserved by the Muskmelon Research Group of the College of Horticulture, Northwest Agriculture and Forestry University, Xuan CQ, Feng MJ, Li X, Hou YJ, Wei CH, Zhang X. 2024. Genome-wide identification and expression analysis of chitinase genes in watermelon under abiotic stimuli and Fusarium oxysporum infection. Int J Mol Sci, 25: 638.). Artificial inoculation was performed by root immersion method. The seedlings were taken out of the nutrient pots, the roots were rinsed with water to minimize root damage and the water was absorbed, and the tip of the main root was cut off by scissors 1-2 cm, and the treated plants were immersed in the prepared spore suspension (10 6 / mL) for 15 min, and finally transplant the seedlings into sterilized soil (the soil was sieved). After the seedlings have recovered, the growth of the plants was observed, and the wilt incidence and disease index were calculated on the 7th day after inoculation.

[0112] The results are as follows Figure 8 As shown in the figure, after artificial inoculation with FON1, the ClVDAC1 gene overexpression plants wilted more obviously than WT plants, and their incidence and disease index were higher than those of WT plants, indicating that ClVDAC1 gene overexpression reduced the resistance of watermelon plants to FON1. Based on the function of ClVDAC1 gene in negatively regulating watermelon FON1 resistance, gene editing technology can be used to create watermelon materials resistant to Fusarium wilt.

[0113] Example 5 Construction and detection of ClVDAC1 gene silencing plants

[0114] Refer to Fang et al. (Fang L, Wei XY, Liu LZ, Zhou LX, Tian YP, Geng C, Li XD. 2021. Atobacco ringspot virus-based vector system for gene and microRNA function studies in cucurbits. Plant Physiology, 186: 853–864). Virus-induced gene silencing (VIGS) experiments were performed using Agrobacterium-mediated transformation. A 434 bp cDNA fragment of the target ClVDAC1 gene was amplified by PCR and inserted into the pTRSV2 (PT) vector containing the SnaB I restriction site to obtain the recombinant plasmid pTRSV2-ClVDAC1 (such as Fig. 9 ) and verified by sequencing. The recombinant plasmid pTRSV2-ClVDAC1, pTRSV1 plasmid, and p19 virus were transformed into Agrobacterium GV3101 strains, respectively, to obtain GV3101 carrying pTRSV1 gene, GV3101 carrying pTRSV2-ClVDAC1, and GV3101 carrying p19 virus, and cultured to obtain GV3101 Agrobacterium bacterial solution 1, GV3101 Agrobacterium bacterial solution 2, and p19 virus Agrobacterium bacterial solution.

[0115] GV3101 Agrobacterium tumefaciens 1, GV3101 Agrobacterium tumefaciens 2 and p19 virus Agrobacterium tumefaciens 1 were mixed in a 1:1:1 volume ratio (OD 600 =1.0) and injected into the lower epidermis of Nicotiana benthamiana leaves. After the virus phenotype was shown, the diseased Nicotiana benthamiana leaves were collected, ground into a homogenate, centrifuged to obtain the supernatant (i.e., the infection fluid), and gently injected into the cotyledons of YL watermelon (YL-pT-ClVDAC1). The empty pTRSV2 vector was used as a control (YL-pT). The relative expression of ClVDAC1 was analyzed by RT-qPCR, and the specific operating conditions were the same as those in Example 2.

[0116] The results are as follows Fig.10 As shown, compared with the control, the expression of ClVDAC1 gene in ClVDAC1 gene silenced plants decreased by 65.49%.

[0117] Example 6 Evaluation of low temperature resistance of ClVDAC1 gene silenced plants

[0118] When the control plants and ClVDAC1 gene silenced plants grew to 4 leaves and 1 heart, they were treated with 4°C low temperature, with 25°C as the control, for 48 hours.

[0119] like Fig.11As shown in the data, after low temperature stress, the wilting degree of ClVDAC1 gene-silenced plants was lighter than that of the control plants, and their Fv / Fm value was higher than that of the control plants, but their relative conductivity was lower than that of the control plants, indicating that ClVDAC1 gene silencing improved the low temperature resistance of watermelon plants, further providing theoretical support for the creation of low-temperature-tolerant watermelon materials by knocking out ClVDAC1 through gene editing.

[0120] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of ClVDAC1 gene in regulating the growth and development of watermelon, characterized in that: The sequence of the ClVDAC1 gene is shown in SEQ ID NO.12; Overexpression of the ClVDAC1 gene increased stem diameter, vine length, leaf number and internode length of watermelon plants.

2. Application of ClVDAC1 gene in regulating watermelon fruit yield and quality, characterized in that: Overexpression of the ClVDAC1 gene improves watermelon yield, taste and nutritional quality.

3. Application of ClVDAC1 gene in regulating storage and transportation tolerance of watermelon fruit, characterized in that: Overexpression of ClVDAC1 gene increases watermelon rind thickness.

4. Application of ClVDAC1 gene in regulating watermelon seed quality, characterized in that: Overexpression of ClVDAC1 gene increases watermelon seed weight.

5. A system for overexpressing the ClVDAC1 gene, characterized in that: The invention comprises an overexpression vector pCambia1305.4-ClVDAC1, wherein the structure of the pCambia1305.4 vector in the overexpression vector pCambia1305.4-ClVDAC1 is (CaMV35S)-(MCS)-(NOS terminator)-(CaMV 35S)-(GFP).

6. A method for preparing a pCambia1305.4 vector, characterized in that: The steps include: (1) Using pCambia1305 as the original vector, the GUSPlus sequence was removed and the GFP sequence was connected to obtain the pCambia1305-GFP vector; (2) The lac promoter sequence on the pCambia1305-GFP vector was removed and connected to the CaMV 35S promoter sequence to obtain the pCambia1305-35S-GFP vector; (3) The NOS terminator sequence was connected to the pCambia1305-35S-GFP vector to obtain the pCambia1305.4 vector; The GFP sequence is shown as SEQ ID NO.2, the CaMV 35S promoter sequence is shown as SEQ ID NO.3, and the NOS terminator sequence is shown as SEQ ID NO.

4.

7. Application of ClVDAC1 gene in regulating low temperature resistance of watermelon plants, characterized in that: Inhibiting ClVDAC1 gene expression improves low temperature resistance of watermelon plants.

8. Application of ClVDAC1 gene in regulating resistance to Fusarium wilt in watermelon plants, characterized in that: Overexpression of ClVDAC1 gene inhibits resistance to Fusarium wilt in watermelon plants.

9. A system for silencing the ClVDAC1 gene, characterized in that: Including pTRSV1 plasmid, recombinant plasmid pTRSV2-ClVDAC1 and p19 virus.

10. Use of the system for silencing the ClVDAC1 gene according to claim 9, characterized in that: The steps include: (1) The pTRSV1 plasmid, the recombinant plasmid pTRSV2-ClVDAC1 and the p19 virus were transformed into Agrobacterium, and cultured to obtain Agrobacterium culture liquid 1, Agrobacterium culture liquid 2 and p19 virus Agrobacterium culture liquid; (2) mixing Agrobacterium solution 1, Agrobacterium solution 2 and p19 virus Agrobacterium solution in a volume ratio of (0.8-1.2):1:(0.8-1.2) and injecting the mixture into tobacco leaves to obtain an infection solution; (3) treating crop plants with the infection solution of step (2) to obtain crop plants with a silenced ClVDAC1 gene; OD of the Agrobacterium culture 1 in step (1) 600 The OD of the Agrobacterium bacterial solution 2 is 0.8-1.

2. 600 The OD of the p19 virus Agrobacterium solution is 0.9-1.

2. 600 It is 0.9-1.1.

Images