Application of tomato SlAVT6B gene in regulating amino acid transport to affect tetranychus cinnabarinus resistance of tomato

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a tomato SlAVT6B gene in regulating and controlling amino acid transport to influence the tetranychus cinnabarinus resistance of tomatoes. The tomato SlAVT6B gene is localized to the tomato SlAVT6B gene through a forward genetics means and a whole genome association analysis (mGWAS) method, it is found that the tomato SlAVT6B gene is localized in vacuole, in-vitro verification shows that SlAVT6B has the function of transporting primary metabolite amino acid, overexpression and knockout are carried out in a tomato plant, and the tomato SlAVT6B gene is obtained. It is found that overexpression and knockout of the SlAVT6B gene can change the content of primary metabolite amino acid in tomatoes, then glandular hair development of tomatoes and resistance to tetranychus cinnabarinus are affected, and the biological function and application approach of the gene are fully verified.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to the application of tomato SlAVT6B gene in transporting primary metabolite amino acids, thereby affecting the development of tomato glandular hairs and insect resistance. Background Art

[0002] Tomato (Solanumlycopersicum L.) is an annual herbaceous plant of the Solanaceae family, native to South America. Tomato fruits are brightly colored, delicious and have high nutritional value. They can be eaten directly or processed into foods such as tomato sauce, and are deeply loved by people all over the world. However, in the actual production of tomatoes, due to pests, drought and cold damage, growth is often seriously affected. In the process of resisting adverse environments, tomato metabolites play an important role. Tomato metabolites are mainly divided into two categories: primary metabolites and secondary metabolites. They maintain the life activities and growth and development of tomatoes, and participate in the response of tomatoes to biotic and abiotic stresses, such as pests, drought, floods, salinity, ultraviolet stress, etc. Tomato primary metabolites are products obtained by participating in the primary metabolic process of synthesizing substances necessary for life activities in tomatoes, mainly including organic substances such as proteins, amino acids, fats, sugars and nucleic acids. Tomato secondary metabolites are substances generated by further reactions of primary metabolites, mainly produced by the interaction between plants and the environment, mainly including phenols, terpenes and alkaloid compounds. For tomatoes, secondary metabolites such as alkaloids, phenolic derivatives, and terpenes not only participate in the defense process, but also determine the quality and flavor of the fruit.

[0003] Amino acids are essential substances in plants and play an important role in the growth and development of plants. As an essential and important active molecule in plants, the changes of amino acids in plants not only involve many physiological regulation activities, but are also closely related to the growth, development and stress resistance of plants. In addition to providing a source of raw materials for protein synthesis, a large number of free amino acids in plants also participate in a variety of biological functions, such as regulating the osmotic pressure of the internal environment and maintaining acid-base balance. Amino acids account for a considerable proportion of the organic nitrogen composition in the soil, and plants can absorb and utilize amino acids as one of their nitrogen sources. In addition, amino acids have other necessary biological functions in plants. For example, amino acids can serve as precursors for the synthesis of plant hormones, transport nitrogen from source to sink, participate in resistance to external abiotic stress, regulate root morphology and pollen tube development, etc. During the growth and development of plants, they will inevitably be affected by various stress adversities in their living environment. Generally, the external stresses to which plants are subjected are divided into two categories: biotic stress and abiotic stress. Amino acids can improve the adaptability of plants to external abiotic stress. When plants encounter external stress conditions, amino acids mainly participate in changing certain physiological metabolisms in plants, or regulating related gene expression and key enzyme activities to enhance the adaptive response of plants to various adversities. Therefore, various studies on plant amino acids have become increasingly important, and in the research on plant amino acid synthesis and metabolism, the study of amino acid transporters is obviously an indispensable part.

[0004] Plants are frequently infected by various pathogens and pests in the natural environment. After infection, invaders obtain nutrients from the host. Amino acids serve as an important nitrogen source provided by the host plant. Modulating amino acid homeostasis by altering the expression of transporters may affect plant defense responses. It has been previously reported that AtLHT1 is involved in the uptake of amino acids into root and mesophyll cells, and AtLHT1 expression is induced by pathogen infection. Its knockout mutants have increased resistance to a broad spectrum of pathogens in an SA-dependent manner. In mutants defective in the SA pathway, the induction of resistance conferred by pathogen infection and AtLHT1 is reduced, demonstrating that the enhanced disease resistance may be caused by alterations in cellular redox homeostasis and a lack of intracellular glutamine. Alterations in the expression of amino acid transporters also affect plant resistance to parasitic pests, such as root-knot and cyst nematodes. Knockout of AtAAP3 and AtAAP6 significantly reduced the infection level of root-knot nematodes in Arabidopsis. Compared with wild-type plants, AtAAP3 and AtAAP6 mutants produced fewer female nematodes but more male nematodes. In addition, nematodes isolated from ATAAP3A and ATAAP6 mutants showed reduced egg hatching, infectivity, and lipid energy reserves. Similarly, loss of function of AtAAP1, AtAAP2, and AtAAP8 significantly reduced the number of female cyst nematodes that reproduced on these mutant plants. Therefore, amino acid homeostasis and levels in plants can, to some extent, affect plant resistance to pathogens and pests in nature. Summary of the invention

[0005] The purpose of the present invention is to isolate a tomato SlAVT6B gene, verify that SlAVT6B has a broad-spectrum amino acid transport function through in vitro yeast mutants, construct SlAVT6B transgenic materials, and find that knocking out or overexpressing the SlAVT6B gene changes the homeostasis of primary metabolite amino acids in the plant and thus affects the development and disease resistance of tomato glandular hairs, confirming the function and application of the gene.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] In the first aspect, the present invention locates the tomato SlAVT6B gene by forward genetics and adopts the method of genome-wide association analysis (mGWAS), and finds that the gene is located in the vacuole membrane, and is used in regulating the resistance of tomatoes to spider mites. The nucleotide sequence of the tomato SlAVT6B gene is shown in SEQ ID No. 1; the application approach is to increase the density of tomato type VI glandular trichomes by knocking out the SlAVT6B gene, thereby improving the resistance of tomatoes to spider mites.

[0008] Furthermore, the application approach is that the expression product of the SlWRKY57 gene combines with the promoter of the SlAVT6B gene to regulate the expression level of the SlAVT6B gene, thereby affecting the development of tomato glandular hairs to regulate tomato resistance to cinnabarinus spider mites; the nucleotide sequence of the SlWRKY57 gene is shown in SEQ ID No.2.

[0009] Furthermore, the knockout of the SlAVT6B gene increases the density of tomato type VI glandular trichomes and improves the resistance of tomatoes to spider mites, comprising the following steps:

[0010] (1) Designing the dual target sites sg1 and sg2 of the SlAVT6B gene and constructing a gene knockout vector, wherein the base sequence of sg1 is AATTTAGACTTTACCAGCTGCCG, and the base sequence of sg2 is

[0011] TGTAGTTAGCATTGTTGGAG;

[0012] (2) constructing an Agrobacterium genetic engineering bacterium containing the knockout vector described in step (1);

[0013] (3) Transforming tomato plants with the genetically engineered Agrobacterium described in step (2) to obtain a homozygous mutant strain that does not contain T-DNA and has stable inheritance.

[0014] Furthermore, in step (1), the gene knockout vector is constructed as follows:

[0015] a1 Design primers for the dual target sites sg1 and sg2 of the SlAVT6B gene, SlAVT6B-CF and SlAVT6B-CR, perform PCR amplification using primers SlAVT6B-F and SlAVT6B-R to prepare target dimers;

[0016] The base sequence of SlAVT6B-CF is GACCTTGGAATTCGTTTCAGCA; the base sequence of SlAVT6B-CR is AATTTAGACTTTACCAGCTGCCG;

[0017] a2 connects the target dimer obtained in a1 to the plasmid to obtain a recombinant vector for gene knockout;

[0018] a3. The recombinant vector obtained in step a2 is transferred into competent cells to obtain Escherichia coli containing the recombinant vector, i.e., the gene knockout vector.

[0019] In a second aspect, the present invention provides an application of a recombinant knockout vector in regulating resistance of tomatoes to spider mites, wherein the recombinant knockout vector contains the tomato SlAVT6B gene.

[0020] Furthermore, the application approach is to transfer the recombinant knockout vector into tomato plants to increase the density of tomato type VI glandular trichomes, thereby improving the resistance of tomatoes to Tetranychus cinnabarinus.

[0021] Compared with the prior art, the present invention has the following effects:

[0022] The role of SlAVT6B in coordinating amino acid homeostasis and regulating glandular hair development and disease resistance was further verified through transgenic material testing. This can provide an important reference for improving the disease resistance of tomatoes during tomato breeding, and will have important guiding significance for breeding high-quality and highly resistant new tomato varieties.

[0023] The present invention will be further described below in conjunction with the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 :The SlAVT6B gene was located through mGWAS screening. Figure 1 Figure A in the figure shows the results of genome-wide association analysis of phenylalanine content; Figure 1 Figures B and C in the figure are tissue expression analysis and phylogenetic analysis of the located genes.

[0025] Figure 2 : Functional validation of SlAVT6B as a vacuolar amino acid efflux protein, Figure 2 Figure A in the middle shows the subcellular localization of SlAVT6B; Figure 2 Figure B in the middle is the validation of the efflux function and efflux activity of SlAVT6B in the yeast mutant 22Δ10α. The results are based on three replicates, the error bars represent the standard deviation (SD), ** indicates a P value less than 0.01, *** indicates a P value less than 0.001, **** indicates a P value less than 0.0001, and all three indicate extremely significant differences.

[0026] Figure 3 :Construction and identification of SlAVT6B transgenic materials, Figure A is the expression level detection of SlAVT6VB overexpression plants and knockout plants; Figure B is the identification of SlAVT6B knockout materials; the results are based on three replicates, the error bars represent the standard deviation (SD), ** indicates P value less than 0.01, *** indicates P value less than 0.001, **** indicates P value less than 0.0001, all three indicate extremely significant differences.

[0027] Figure 4:Glandular hair development phenotype in SlAVT6B transgenic plants, Figure A is the observation of glandular hair phenotype in SlAVT6B transgenic plants; Figure B is the detection of glandular hair type and density in SlAVT6B transgenic plants. The results are based on three replicates, the error bars represent the standard deviation (SD), ** indicates a P value less than 0.01, *** indicates a P value less than 0.001, **** indicates a P value less than 0.0001, and all three indicate extremely significant differences.

[0028] Figure 5 :SlAVT6B affects the resistance of tomato plants to Tetranychus cinnabarinus. Figure A shows the phenotype of SlAVT6B transgenic plants after inoculation; Figure B shows the detection of lesion area of ​​SlAVT6B transgenic plants after inoculation. The results are based on three replicates, error bars represent standard deviation (SD), ** indicates P value less than 0.01, *** indicates P value less than 0.001, **** indicates P value less than 0.0001, and all three indicate extremely significant differences.

[0029] Figure 6 :SlAVT6B is regulated by SlWRKY57. Figure A shows the yeast one-hybrid results of SlAVT6B regulated by SlWRKY57; Figure B shows the EMSA results of SlAVT6B regulated by SlWRKY57; Figure C shows the LUC results of SlAVT6B regulated by SlWRKY57; the results are based on three replicates, the error bars represent the standard deviation (SD), ** indicates that the P value is less than 0.01, *** indicates that the P value is less than 0.001, **** indicates that the P value is less than 0.0001, and all three indicate that the difference is extremely significant.

[0030] Figure 7 : Nucleotide sequence of SlAVT6B.

[0031] Figure 8 : Plasmid map of entry vector pDonr207-SlAVT6B.

[0032] Fig. 9 : Overexpression editing vector PBI121-SlAVT6B. DETAILED DESCRIPTION

[0033] The following examples define the present invention and describe the methods of isolating and cloning DNA fragments containing the complete coding region of the SlAVT6B gene and verifying the function of the SlAVT6B gene. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0034] Preparation of reagents and culture medium used:

[0035] (1) Abbreviations of reagents and solutions: The amino acid solutions used in the present invention are all prepared in aqueous solution with a concentration of 100 μM; the abbreviations of plant hormones used in the culture medium are as follows: KN (Kanamycin); KT (Kinetin); IAA (Indole-3-acetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid); AS (Acetosringone); DMSO (Dimethyl Sulfoxide); Tim (Timentin); ZR (trans-Zeatin-riboside); IBA (3-Indolebutyric acid); KH2PO4 (potassium dihydrogen phosphate); MS (Murashige & Skoog); GA3 (gibberellins).

[0036] (2) Main solution formula:

[0037] 1) Yeast nitrogen-deficient medium

[0038] YNB (for mutant strains only) 6.7g

[0039] Glucose 20g

[0040] Dissolve at room temperature and make up to 1000 mL with distilled water.

[0041] 2) Preparation of MS liquid culture medium

[0042] MS Base salt 4.33 g;

[0043] MS Vitamin 0.1031g;

[0044] Sucrose 30g;

[0045] Dissolve at room temperature and make up to 1000 mL with distilled water.

[0046] 3) ZR stock solution, IBA stock solution is 2g / L; IAA stock solution, KH2PO4, 2,4-D stock solution, KT stock solution is 1g / L; Tim stock solution is 320g / L; KN stock solution is 50g / L; AS stock solution is 200mM / L. All need to be filtered and sterilized.

[0047] (3) Culture medium formulation for tomato genetic transformation

[0048] 1) Pre- / Co-culture medium

[0049]

[0050] Adjust the pH value to 5.8, make up to 1000 mL, seal and sterilize.

[0051] 2) Screening culture medium

[0052]

[0053] Adjust the pH value to 5.8, make up to 1000 mL, seal and sterilize.

[0054] 3) Rooting medium

[0055]

[0056]

[0057] Adjust the pH value to 5.8, make up to 1000 mL, seal and sterilize.

[0058] (4) YEB medium

[0059]

[0060] Adjust the pH value to 7.4, make up to 1000 mL, seal and sterilize.

[0061] (5) 1.5×CTAB extraction solution

[0062]

[0063] Add ddH2O to make up to 1000 mL.

[0064] Example 1: Discovery and localization of the SlAVT6B gene

[0065] The applicant measured metabolites of tomato materials from all over the world, performed statistical analysis on the measured data, and selected varieties with significant differences in amino acid synthesis for genome-wide association analysis. The results showed that there was a significant association between phenylalanine in the amino acid and a loci on chromosome 3. There was an amino acid transporter (Solyc03g117350) 205kb away from the major locus on chromosome 3, which had a strong correlation with the phenylalanine content (p=6.54E -08 ). Therefore, we named it SlAVT6B, and speculated that the SlAVT6B gene may affect the biosynthesis of amino acids.

[0066] Example 2: Isolation and cloning of the SlAVT6B gene and identification of its subcellular localization

[0067] In order to obtain the coding sequence of the SlAVT6B gene, the applicant planted the sequenced tomato variety MicroTom for one month, extracted the total RNA from the tomato leaves using TRIZOL reagent (Invitrogen) (the extraction method was in accordance with the instructions of the TRIZOL reagent), and reverse transcribed the RNA into cDNA using the Script All-in-one RT EasyMix for qPCR kit from Tolo. Using the cDNA as a template, PCR amplification was performed using primers SlAVT6B-F: 5'-aaaaagcaggcttaATGGATAGCAATTATTCGGCTG-3' and SlAVT6B-R: 5'-agaaagctgggtaTCAATCACTCTCAGTACTCATACT-3' to obtain the full length coding sequence (CDS sequence) of the SlAVT6B gene (1419 bp, as shown in SEQ ID No. 1). PCR reaction conditions: 94℃ pre-denaturation for 2min; 98℃ for 10sec, 58℃ for 30sec, 68℃ for 2min, 35 cycles; 68℃ extension for 5min. The amplified PCR product was connected to the pDonr207 entry vector through the BP reaction of GATEWAY cloning technology, and the positive clones were screened and sequenced to obtain the full-length cDNA of the SlAVT6B gene.

[0068] SlAVT6B was linked to the pH7WGF vector containing the GFP tag through the LR reaction of the GATEWAY cloning technology for transient injection into tobacco. The injected tobacco was first cultured in the dark for 24 hours, then cultured in the light for 24 hours, and then observed.

[0069] Observation: As shown in the figure, compared with the empty vector, SlAVT6B and Arabidopsis vacuolar water channel protein AtTIP3 showed specific fluorescence on the vacuole membrane, indicating that SlAVT6B is localized on the vacuole membrane.

[0070] Example 3: SlAVT6B is a vacuolar amino acid transporter

[0071] SlAVT6B was linked into the yeast expression vector ADH1 through the LR reaction of GATEWAY cloning technology, and the applicant named the clone with correct sequencing as ADH1-SlAVT6B. The mutant strain 22Δ10α cannot grow on a medium containing arginine and γ-aminobutyric acid as the only N source. In order to determine the amino acid transport activity of SlAVT6B, we heterologously expressed SlAVT6B in the yeast amino acid transporter mutant 22Δ10α, and cultured the transformed yeast on YNB solid medium containing (NH4)2SO4 and 2mM amino acid mixture as the only nitrogen source. The experimental results showed that the SlAVT6B-22Δ10α yeast transformant could grow normally on a medium containing (NH4)2SO4, while 2mM amino acids did not restore the growth of SlAVT6B-22Δ10α, indicating that SlAVT6B cannot transport amino acids into yeast cells.

[0072] Therefore, we used yeast mutants to conduct amino acid efflux experiments. The mutant yeast containing ADH1-AtAAP3 and ADH1-SlAVT6B was cultured in SD / -Ura liquid medium until OD600 was 1, and then the yeast samples were washed three times with sterile water. Then the yeast samples were transferred to a new medium with 3mM NH4 + The culture medium was used as the sole nitrogen source for 24 h, and then the bacterial solution was collected. The collected bacterial solution was centrifuged and divided into yeast sample and yeast culture medium sample. The amino acid content was determined respectively. The experimental results are shown in Figure 2 C. The experimental results show that after 3mM NH4 + After 12 h of liquid culture, the amino acid concentration in SlAVT6B-22Δ10α decreased by 35% compared with AtAAP3-22Δ10α, while the amino acid content in the yeast culture medium of SlAVT6B-22Δ10α increased by 2.6 times.

[0073] In addition, 3 mM NH4 + After 12 hours of cultivation in liquid medium with nitrogen as the only source, ADH1-SlAVT6B was washed three times with sterile water and then transferred to a medium without nitrogen source. 2 mL of bacterial liquid was collected at 0, 2, 4, 6 and 8 hours respectively. The collected bacterial liquid was centrifuged and divided into yeast samples and yeast medium samples, and the amino acid content was determined respectively. The amino acid efflux activity is the amino acid content in the yeast medium / (amino acid content of the yeast sample + amino acid content in the yeast medium). The experimental results showed that after 12 hours of cultivation in nitrogen-free medium, the efflux activity of SlAVT6B was higher than that of the control.

[0074] Example 4: Identification of S1AVT6B transgenic material

[0075] The overexpression vector was constructed as follows: the overexpression vector pBI121 was connected through the LR reaction of GATEWAY cloning technology, and the applicant named the clone with correct sequencing as PBI121-SlAVT6B.

[0076] The CRISPR vector construction method is as follows: the target sites sg1 (base sequence: AATTTAGACTTTACCAGCTGCCG) and sg2 (base sequence: TGTAGTTAGCATTGTTGGAG) were screened on the CRISPR-P 2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and primers SlAVT6B-CF (base sequence: GACCTTGGAATTCGTTTCAGCA) and SlAVT6B-CR (base sequence: AATTTAGACTTTACCAGCTGCCG) were designed for the two screened target sites (the forward primer is the first 19 bases of the target site, and the reverse primer is the reverse complement of the first 19 bases of the target site, and then the corresponding linkers are added before and after the two sequences). PCR amplification was performed using pTX41-CRISPR plasmid as a template, and then a band of 568 bp was recovered. The PCR reaction conditions were: 94°C pre-denaturation for 2 min; 98°C for 10 sec, 58°C for 30 sec, 68°C for 2 min, 30 cycles; 68°C extension for 5 min. The gel-recovered product was connected to pTX41 by Golden Gate. The reaction system was: 50-100 ng of the vector, 100-300 ng of the recovered product, 5 units (0.25 μL) of BsaⅠ-HFv2, 200 units (0.5 μL) of T4 Ligase, 1.5 μL of 10X Ligasebuffer, and ddH2O was added to 15 μL; the reaction procedure was: 37°C for 20 sec; 37°C for 3 min, 16°C for 4 min, 25 cycles; 50°C for 5 min, and 80°C for 5 min. The applicant named the clone with correct sequencing as CRISPR-SlAVT6B.

[0077] PBI-SlAVT6B and CRISPR-SlAVT6B were used for transformation, that is, they were introduced into the tomato variety MicroTom through the Agrobacterium-mediated tomato genetic transformation system, and transgenic plants were obtained after pre-cultivation, infection, co-cultivation, screening of calli with kanamycin resistance, differentiation, rooting, transplanting, and identification.

[0078] Specific steps: (1) Sowing: Soak several seeds of the tomato variety MicroTom in water for 3-4 hours in advance, then pour out the water and add 75% alcohol to disinfect for 45 seconds, rinse with sterile water five times, add 20% NaClO to disinfect for 18 minutes (protect from light), and wash the seeds five times with sterile water after disinfection. After soaking for about two minutes each time, pour out the sterile water, slightly dry the water and transfer to the germination medium 1 / 2MS for dark culture; (2) Cut seedlings for pre-culture: When the seeds germinate and grow to have two mature cotyledons, use scissors to cut off the leaf tips and leaf bases, and spread the cotyledons upside down on the pre-culture medium with the back of the leaves facing up, and pre-culture in the dark for about 1-2 days; (3) Agrobacterium transformation and culture: Add 20μl of the constructed PBI121-SlAVT6B and CRISPR-SlAVT6B vectors EHA105 competent cells (from Shanghai Weidi Biotechnology, commercial strain) were placed on ice for 5 minutes, transferred to liquid nitrogen for 5 minutes, then placed in a 37°C water bath for 5 minutes, and finally placed on ice for 5 minutes before adding 100 μl of YEB liquid culture medium (see below for ingredients), cultured at 28°C on a shaker for 1 hour, and the bacterial liquid was spread on a YEB solid plate with resistance and cultured at 28°C for 1 to 2 days. After a single colony appeared, the colony was transferred to YEB liquid culture medium and cultured at 28°C on a shaker for 12 hours; (4) Agrobacterium infection and co-cultivation: Use liquid MS culture medium to adjust the Agrobacterium suspension to an OD of 600 =0.2-0.3, gently shake the cotyledons in the Agrobacterium suspension for 12-15 minutes, then transfer to sterilized filter paper to absorb dryness, and place on the co-culture medium in the dark for 2 days; (5) Screening culture: transfer the cotyledons on the co-culture medium to the screening medium, and change the medium every two weeks until adventitious buds grow from the callus tissue; (6) Rooting: cut off the grown adventitious buds, remove all surrounding callus tissue, try to keep it intact, and transfer to the rooting medium (insert medium) for rooting culture; (7) Transplanting: Select healthy plants with roots and transplant them into nutrient soil. Avoid large-scale water loss for 5 days after transplanting, and identify the plants after they grow normally.

[0079] The specific identification steps are as follows: (1) Vector transfer identification: In order to verify whether the pBI121 overexpression vector has been transformed into the plant, PCR amplification identification was performed using vector-specific primers OJX487: 5'-CGCAAGACCCTTCCTCTATATAAG-3' and OJX488: 5'-TAAAACGACGGCCAGTGAATTCC C-3'. The PCR reaction conditions were: 94°C pre-denaturation for 5 min; 94°C for 30 sec, 60°C for 30 sec, 72°C for 1 min, 35 cycles; 72°C extension for 5 min. Then agarose gel electrophoresis was performed, and the presence of a 1317 bp band indicated that the vector had been transferred; (2) RNA extraction and reverse transcription: The RNA extraction and reverse transcription methods in Example 2 and real-time fluorescence quantitative detection of the relative expression of SlAVT6B in the transgenic plants were used.

[0080] DNA was extracted from the SlAVT6B knockout material according to the above steps, and the CRISPR-SlAVT6B vector insertion was identified. The vector-specific primers CAS9-F: TTGACAAGCTGTTCATCCAG and CAS9-R: CCTTCGTAATCTCGGTGTTC were used. The PCR reaction conditions were the same as above. The gel electrophoresis showed a 500bp band, which was the CRISPR-SlAVT6B vector insertion. Then the gene editing results were identified. Primers were designed 100bp upstream and downstream of the gene knockout target site: SlAVT6B-CF: GACCTTGGAATTCGTTTCAGCA and SlAVT6B-CR: AATTTAGACTTTACCAGCTGCCG. PCR amplification was performed using the DNA sample as a template, and the sequencing results of the PCR products were analyzed. The results are shown in Figure 3 As shown in A, SlAVT6B overexpression plants and knockout expression plants were successfully constructed.

[0081] Example 5: Changes in leaf epidermal hair morphology of SlAVT6B transgenic material

[0082] The observation experiment of tomato glandular trichomes was conducted using a stereo microscope (DFC550 LEICA). The density of glandular trichomes was observed in leaves (third leaf position), stems (third internode) and flowers (unopened buds) of 6-week-old tomato plants, with 10 replicates for each tissue. At the same time, the morphology of glandular trichomes in leaf tissue was observed, and the number of type II, V and VI glandular trichomes was counted.

[0083] Phenotypic analysis of SlAVT6B transgenic lines revealed that the density of glandular trichomes on leaves, stems and flowers of SlAVT6B-ko lines was significantly higher than that of wild type, while that of SlAVT6B-OE lines was lower than that of wild type. To further determine the role of SlAVT6B in the development of glandular trichomes, we observed the leaf surfaces of 6-week-old wild type and SlAVT6B transgenic lines under a microscope. The results showed that the number of type VI glandular trichomes on the leaf surfaces of SlAVT6B-ko lines was significantly higher than that of wild type. Further microscopic counting of type II, V and VI glandular trichomes on the leaf surfaces of all materials showed that the number of type II and V glandular trichomes in SlAVT6B-ko lines was similar to that of wild type, but the number of type VI glandular trichomes was 3-4 times that of WT. In addition, the number of type VI glandular trichomes in SlAVT6B-OE lines was less than that of wild type.

[0084] Example 6: SlAVT6B improves tomato resistance to Tetranychus cinnabarinus by affecting the development of glandular trichomes

[0085] Previous studies have found that the level of type VI glandular trichomes in tomatoes affects their resistance to Tetranychus cinnabarinus. Considering the changes in glandular trichome density in SlAVT6B transgenic materials, it is speculated that the insect resistance of SlAVT6B transgenic materials may change. To determine whether SlAVT6B affects the insect resistance of tomatoes, we first conducted a feeding preference experiment using Tetranychus cinnabarinus. After feeding Tetranychus cinnabarinus with a combination of wild-type and SlAVT6B transgenic materials for 2 hours, we found that the number of Tetranychus cinnabarinus moving to SlAVT6B-OE leaves was higher than that of wild-type, while the number of Tetranychus cinnabarinus moving to SlAVT6B-ko leaves was lower than that of wild-type. These results indicate that the feeding preference of Tetranychus cinnabarinus on tomato leaves is: SlAVT6B-OE>wild-type>SlAVT6B-ko. In addition, we also conducted a preference experiment of Tetranychus cinnabarinus, an egg-laying experiment of Tetranychus cinnabarinus, and an experiment on the whole plant infestation of Tetranychus cinnabarinus.

[0086] For the preference experiment of cinnabarinus spider mites, we placed the same leaf position leaves of the SlAVT6B transgenic material and the wild type that were grown normally for 6 weeks on both sides of the culture dish, and drew a line at the bottom of the middle of the culture dish as a mark, transferred 10 healthy cinnabarin spider mites to the marked line, covered the culture dish lid and placed it at room temperature for 1 hour, and then counted the number of cinnabarin spider mites transferred to the transgenic material and wild type leaves. The cinnabarin spider mites around the marked line were considered to have not made a choice and were also counted.

[0087] For the egg-laying experiment of spider mites, we placed the normally grown 6-week-old transgenic materials and wild-type leaves at the same leaf position on a culture dish with moistened filter paper, transferred 5 healthy female spider mites to the leaves, covered the culture dish lid for cultivation, and counted the number of eggs on the leaves every 24 hours.

[0088] For the whole plant infection experiment of T. cinnabarinus, we selected 6-week-old SlAVT6B transgenic materials and wild-type plants with normal growth and basically the same size and growth, transferred 15 healthy female T. cinnabarinus to the leaves at the third leaf position, and then placed the plants in the culture system for cultivation. The results showed that 45 days after inoculation, compared with the wild-type materials, the leaves of SlAVT6B-ko materials basically remained green, and only local collapse and chlorotic lesions appeared on the leaves. The chlorotic lesion area of ​​the leaves was calculated by scanning, and the quantitative results showed that the lesion area of ​​SlAVT6B-ko was 60% of that of the wild type. In contrast, the lesion size of the leaves of SlAVT6B-OE transgenic materials increased by 1.35 times compared with the wild type. In summary, SlAVT6B can enhance the resistance of tomatoes to T. cinnabarinus by regulating the development of type VI glandular trichomes.

[0089] Example 7: SlAVT6B is regulated by SlWRKY57

[0090] The binding of SlWRKY57 gene to SlAVT6B promoter was tested by yeast one-hybrid, LUC and EMSA.

[0091] Specific steps: Yeast single hybrid: Use the LR reaction of the Gateway system to transfer the SlWRKY57 gene from the pDONR207 vector to the yeast single hybrid vector pGADT7, and transfer the promoter sequence of SlAVT6B from the pDONR207 vector to the yeast single hybrid vector pHis2. Then co-transfer the correctly sequenced pGADT7-SlWRKY57 and pHis2-SlAVT6B into the yeast single hybrid competent Y187. After a single clone grows out, transfer it to SD / -Leu / -Trp / -His medium (containing 0-50mM 3AT) and observe its growth.

[0092] LUC: The SlWRKY57 gene (as shown in SEQ ID No. 2) was connected to the pEAQ tobacco expression vector through the LR reaction of the Gateway system, and the promoter sequence of SlAVT6B was connected to the modified pH2GW7 vector as a reporter, which contained the Firefly Luciferase gene and the Renilla luciferase gene, and the Ren gene was used as an internal reference. The constructed vector was transformed into tobacco transient transformants by Agrobacterium-mediated transformation in different combinations (negative control: pEAQ+LUC-SlAVT6B, experimental group: pEAQ-SlWRKY57+LUC-SlAVT6B) and co-transformed into N. benthamiana tobacco leaves. After culturing at 25°C in the greenhouse for 48 hours, samples were taken and extracted according to the instructions of the Dual-Luciferase Reporter Assay System kit (Promega). The results were determined in the Thermo ScientificTM VarioskanTM LUX multi-function microplate reader to detect LUC and REN luciferase activities; the relative expression level of the reporter gene was expressed as LUC / REN. This experiment was repeated three times, and 6 biological replicates were used on different leaves in each group each time.

[0093] EMSA: The coding sequence of SlWRKY57 gene was connected to pMAL-2X protein expression vector through Gateway system, transformed into BL21 (DE3) colon competent cells, and expressed at low temperature under 1M IPTG induction. The expressed protein was purified by MBP tag protein cross-linking purification resin. The binding motif of SlAVT6B promoter was predicted on the plant transcriptional regulation map website (http: / / plantregmap.gao-lab.org / index.php) and the fluorescent labeled probe was designed. The unlabeled probe was used as a competitive probe. The purified protein was incubated with different probes in dark conditions for 30 minutes, then electrophoresed at 90V for 50 minutes in 3% non-denaturing polyacrylamide gel, and finally developed and imaged in an infrared laser imaging system (ODYSSEY-FC, Gene Company Limited).

[0094] The experimental results showed that the combination of pGADT7-SlWRKY57 and pHIS2-SlAVT6B can grow in SD / -Leu / -Trp / -His (5mM 3AT) medium, that is, SlWRKY57 can bind to the promoter of SlAVT6B ( Figure 6 Middle A). LUC assay results showed that SlWRKY57 could activate the expression of SlAVT6B ( Figure 6Middle C). EMSA results showed that SlWRKY57 could bind to the promoter of SlAVT6B, and as the amount of SlWRKY57 increased, the migration band increased, and the band weakened after adding the competitive probe ( Figure 6 (B) The above experiments prove that SlWRKY57 regulates the expression of SlAVT6B gene by binding to its promoter, thereby affecting the development of glandular trichomes and insect resistance in tomatoes.

[0095] The present invention is described in detail above. Definitions of Terms Related to the Present Invention Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention belongs.

[0096] The term "protein" is used interchangeably herein to refer to a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0097] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0098] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0099] For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principle of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departing from the disclosed scope in the application, and the changes made with conventional techniques known in the art.

Claims

1. Application of tomato SlAVT6B gene in regulating tomato resistance to spider mites, characterized in that: The nucleotide sequence of the tomato SlAVT6B gene is shown in SEQ ID No. 1; the application approach is to increase the density of tomato type VI glandular trichomes by knocking out the SlAVT6B gene, thereby improving the resistance of tomatoes to spider mites.

2. The use according to claim 1, characterized in that: The application approach is that the expression product of the SlWRKY57 gene is combined with the promoter of the SlAVT6B gene to regulate the expression amount of the SlAVT6B gene, thereby affecting the development of tomato glandular hairs to regulate tomato resistance to cinnabar spider mites; the nucleotide sequence of the SlWRKY57 gene is shown in SEQ ID No.

2.

3. The use according to claim 1, characterized in that: The method of knocking out the SlAVT6B gene, increasing the density of type VI glandular trichomes in tomatoes, and improving the resistance of tomatoes to spider mites comprises the following steps: (1) Designing the dual target sites sg1 and sg2 of the SlAVT6B gene and constructing a gene knockout vector, wherein the base sequence of sg1 is AATTTAGACTTTACCAGCTGCCG, and the base sequence of sg2 is TGTAGTTAGCATTGTTGGAG; (2) constructing an Agrobacterium genetic engineering bacterium containing the knockout vector described in step (1); (3) Transforming tomato plants with the genetically engineered Agrobacterium described in step (2) to obtain a homozygous mutant strain that does not contain T-DNA and has stable inheritance.

4. The use according to claim 3, characterized in that: In step (1), the gene knockout vector is constructed as follows: a1 Design primers for the dual target sites sg1 and sg2 of the SlAVT6B gene, SlAVT6B-CF and SlAVT6B-CR, perform PCR amplification using primers SlAVT6B-F and SlAVT6B-R to prepare target dimers; The base sequence of SlAVT6B-CF is GACCTTGGAATTCGTTTCAGCA; the base sequence of SlAVT6B-CR is AATTTAGACTTTACCAGCTGCCG; a2 connects the target dimer obtained in a1 to the plasmid to obtain a recombinant vector for gene knockout; a3. The recombinant vector obtained in step a2 is transferred into competent cells to obtain Escherichia coli containing the recombinant vector, i.e., the gene knockout vector.

5. Application of a recombinant knockout vector in regulating resistance of tomato to Tetranychus cinnabarinus, characterized in that: The recombinant knockout vector contains the tomato SlAVT6B gene of claim 1.

6. The use according to claim 5, characterized in that: The application approach is to transfer the recombinant knockout vector into tomato plants, thereby increasing the density of tomato type VI glandular trichomes and improving the resistance of tomatoes to spider mites.

Images