Bnmyb4 gene for regulating sclerotinia sclerotiorum resistance of brassica napus and application thereof

Abstract

This invention belongs to the field of plant genetic engineering, specifically involving the application of the rapeseed BnMYB4 gene in the control of sclerotinia stem rot. A rapeseed BnMYB4 gene that enhances rapeseed resistance to sclerotinia stem rot was screened. Its nucleotide sequence is shown in SEQ ID NO:1; the protein sequence encoded by this gene is shown in SEQ ID NO:2. Using Agrobacterium-mediated transformation, pGWB418-BnMYB4 overexpression lines and CRISPR / Cas9-BnMYB4 gene knockout lines were obtained. Identification with Sclerotinia stem rot by inoculation of the transgenic materials revealed that the BnMYB4 overexpression lines showed enhanced resistance to sclerotinia stem rot, indicating that BnMYB4 is a positive regulator of rapeseed resistance to sclerotinia stem rot, playing a positive regulatory role in rapeseed resistance to sclerotinia stem rot, and that overexpression of this gene can significantly improve rapeseed resistance to sclerotinia stem rot.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically involving the BnMYB4 gene that regulates resistance to sclerotinia stem rot in Brassica napus and its applications. Background Technology

[0002] Rapeseed (Brassica napus L.) is the most widely planted oilseed crop in my country and holds a pivotal position in the domestic edible oil market. Sclerotinia stem rot is one of the most serious diseases affecting rapeseed production, with an incidence rate ranging from 10% to 80% in different regions, resulting in yield losses of 10% to 70%. Furthermore, sclerotinia stem rot also severely impacts the quality and oil content of rapeseed.

[0003] Currently, the control of Sclerotinia stem rot in rapeseed mainly relies on chemical pesticide spraying, rational crop rotation, and the breeding of Sclerotinia stem rot-resistant varieties. Chemical control is the most common method, typically using fungicides such as carbendazim, thiophanate-methyl, and imazalil. However, chemical pesticides suffer from environmental pollution and unsatisfactory control effects. The Sclerotinia stem rot pathogen is persistent, has numerous hosts, and spreads rapidly, making agricultural control alone insufficient to control the disease. Biological control is highly efficient, specific, and environmentally friendly; however, its application technology is not yet mature, and its commercialization is slow. Compared to chemical pesticides, its control costs are higher, and its suitable control period is relatively shorter, presenting certain technical limitations. Therefore, studying the mechanism of Sclerotinia stem rot resistance in rapeseed using molecular breeding techniques, screening for Sclerotinia stem rot-resistant genes, and thereby enhancing the rapeseed's resistance to Sclerotinia stem rot, is of great significance for providing genetic resources for the molecular identification of Sclerotinia stem rot and disease-resistant breeding.

[0004] MYB transcription factors (MYB TFs) typically contain a transcriptional activation region at their C-terminus and a conserved DNA-binding domain at their N-terminus. This domain usually consists of up to four imperfect amino acid repeats (R), each repeat forming three α-helices. The second and third helices of each repeat form a helix-turn-helix (HTH) structure with three regularly spaced tryptophan (or hydrophobic) residues forming a hydrophobic core in the 3D HTH structure. The third helix is ​​the recognition helix, responsible for recognizing the DNA binding site and binding to the major groove of the target DNA using this structure.

[0005] Currently reported MYB-type transcription factors mainly participate in plant immune responses through phenylalanine metabolism, the SA (salicylic acid) pathway, and the JA (jasmonic acid) pathway. Lignin is one of the end products related to the phenylalanine metabolism pathway. Rice OsMYB30, OsMYB55, and OsMYB110 specifically activate the expression of lignin biosynthesis-related genes (i.e., Os4CL3, Os4CL5, OsPAL6, and OsPAL8), thereby limiting the activity space of pathogens and preventing their spread through lignification. AtMYB96 enhances plant resistance to *Pseudomonas syringae* by regulating the SA resistance pathway. Rose RcMYB84 and RcMYB123 genes interact with the RcJAZ1 protein to participate in the regulation of the jasmonic acid signaling pathway.

[0006] Although there are studies on the role of the MYB gene family in regulating host resistance to bacteria and fungi, the research on the disease resistance function of BnMYB4 is not yet in-depth. There are no reports on whether BnMYB4 can enhance the resistance of rapeseed to sclerotinia stem rot, and its function needs further verification. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings and deficiencies of the existing technology and to provide the application of the BnMYB4 gene in the resistance of Brassica napus to Sclerotinia stem rot, thus providing a new genetic resource for breeding of rapeseed resistant to Sclerotinia stem rot.

[0008] The technical solution of the present invention is as follows:

[0009] The applicant cloned a transcription factor BnMYB4 gene that regulates resistance to sclerotinia stem rot in rapeseed. Its nucleotide sequence is shown in SEQ ID NO: 1, and its protein sequence is shown in SEQ ID NO: 2.

[0010] The present invention relates to the application of the BnMYB4 gene in regulating resistance to sclerotinia stem rot in rapeseed.

[0011] The more detailed technical solution is as follows:

[0012] 1. Cloning and vector construction of the BnMYB4 gene

[0013] Based on Arabidopsis thaliana homologous sequence alignment, the BnMYB4 sequence with the highest homology was selected, and the nucleotide sequence of the gene is shown in SEQ ID NO: 1. This invention uses the genomic DNA of the Brassica napus Westar variety as a template to clone the BnMYB4 gene. The BnMYB4 gene fragment is then ligated to the linearized overexpression vector pGWB418 using T4 DNA Ligase to obtain the overexpression vector pGWB418-BnMYB4.

[0014] pCBC-DT1DT2 (vector resistance is chloramphenicol) was used as the intermediate gene editing vector. Figure 2 Figure A in the diagram shows that pKSE401 (vector resistance is kanamycin) is the final gene editing vector. Figure 2 (Figure B in the diagram) to construct the CRISPR / Cas9-BnMYB4 gene editing vector for this gene.

[0015] 2. Creation of BnMYB4 genetically modified rapeseed

[0016] The vector was transformed into Brassica napus Westar using Agrobacterium-mediated transformation until regenerated differentiated seedlings were obtained. Genomic DNA was extracted from leaves of wild-type Brassica napus as a control and transgenic rapeseed lines using the CTAB method. Gene-edited lines were identified by PCR amplification using primers U626-IDF (5'TGTCCCAGGATTAGAATGATTAGGC 3') and U629-IDR (5'AGCCCTCTTCTTTCGATCCATCAAC3'), and CRISPR / Cas9 gene-editing positive lines were screened. The positive materials were then sequenced and analyzed. Expression lines were selected from positive seedlings obtained using 418seq-F1 (5'CTATCCTTCGCAAGACCC 3') and MYB4-R (5'GTTTGTACAGTTACGCGCCT3') as subsequent experimental materials.

[0017] 3. Identification of the resistance to sclerotinia stem rot in the BnMYB4 rapeseed line

[0018] By inoculating *Sclerotinia sclerotiorum*, the disease resistance of overexpressed and gene-edited lines was analyzed, the inhibitory effect of leaf extracts on *Sclerotinia sclerotiorum* growth was investigated, and the relationship between disease resistance and reactive oxygen species accumulation was inferred by DAB staining. The function of this gene in *Sclerotinia sclerotiorum* resistance in rapeseed was identified, providing new genetic resources for breeding rapeseed resistant to *Sclerotinia sclerotiorum*.

[0019] Advantages of this invention:

[0020] This invention, through the construction of BnMYB4 gene overexpression vectors and gene editing vectors, discovered that BnMYB4 can serve as a key gene for rapeseed resistance materials. Through genetic transformation, rapeseed varieties resistant to Sclerotinia stem rot with overexpression and gene editing of this gene were obtained, providing new materials for disease-resistant breeding of Brassica napus. Attached Figure Description

[0021] Figure 1Expression patterns of BnMYB family genes in wild-type Brassica napus (Westar) after inoculation with Sclerotinia sclerotiorum. Figure labels: Expression patterns of BnMYB4, BnMYB7, BnMYB32, BnMYB46, BnMYB44, BnMYB55, and BnMYB43 genes at 0h, 6h, 12h, 24h, 36h, 48h, 60h, and 72h after inoculation of detached leaves with Sclerotinia sclerotiorum in Westar. PDA culture blocks served as blank controls. The results indicate that BnMYB4 may be a key gene mediating resistance to Sclerotinia sclerotiorum in Brassica napus.

[0022] Figure 2 Map of vectors used to construct the BnMYB4 gene overexpression vector and gene editing vector. (Figure labels are explained below.) Figure 2 Figure A in the diagram is the pGWB418 vector map; Figure 2 Figure B in the image is the pCBC-DT1DT2 vector map; Figure 2 Figure C in the diagram is the pKSE401 vector map.

[0023] Figure 3 Results of BnMYB4 gene expression detection in transgenic rapeseed plants.

[0024] Figure 4 : Plaque formation on detached leaves of BnMYB4 overexpression lines and gene-edited lines after 48 hours of inoculation with Sclerotinia sclerotiorum.

[0025] Figure 5 : Plaque formation of BnMYB4 overexpression lines and gene-edited lines after 72 hours of inoculation with *Sclerotinia sclerotiorum* using leaf extracts from seedlings. Figure labels: Figure 5 Figure A shows the growth of bacterial plaques after leaf extract was added to PDA medium at a 1:1 ratio. Figure 5 Figure B shows the mycelial growth observed under a stereomicroscope 72 hours after inoculation. Compared to the culture medium without leaf extract, the growth of Sclerotinia sclerotiorum on the culture medium with leaf extract was inhibited. Furthermore, the growth of Sclerotinia sclerotiorum on the culture medium with leaf extract from BnMYB4-OE plants was significantly inhibited, and the mycelia were dense and neatly arranged.

[0026] Figure 6 DAB staining of detached leaves from BnMYB4 overexpression lines and gene-edited lines at the seedling stage for 36 hours after inoculation with Sclerotinia sclerotiorum. Leaves from the BnMYB4 overexpression lines showed a deeper brown color and a wider distribution compared to the wild type, indicating higher H2O2 accumulation. Leaves from the BnMYB4 gene-edited lines showed a lighter color compared to the wild type, with only some punctate brown spots, indicating lower H2O2 accumulation. Detailed Implementation

[0027] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are merely illustrative and not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the materials, reagents, instruments, etc., used are all commercially available.

[0028] This embodiment modifies the resistance of Brassica napus to Sclerotinia stem rot by adjusting the expression level of the BnMYB4 gene in Brassica napus. The DNA sequence of the BnMYB4 gene is SEQ ID NO: 1 in the sequence listing, and the amino acid sequence is SEQ ID NO: 2 in the sequence listing. The specific steps are as follows:

[0029] Example 1: Cloning and vector construction of the BnMYB4 gene

[0030] Based on homologous sequence alignment using the TAIR Arabidopsis database, the BnMYB4 sequence with the highest homology was selected. The nucleotide sequence of the gene is shown in SEQ ID NO: 1. This invention uses genomic DNA from the Brassica napus Westar variety as a template and clones the BnMYB4 gene using the forward primer myb-F (5'ATGGGAAGAGCACCATGT 3') and the reverse primer myb-R (5'TCAGAACTCGGGTATGTCC 3'). The BnMYB4 gene was grafted with adapters at both ends using the forward primer myb-FF (5'TATGGCGGCCCCTCGAGATGGGAAGAGCACCA3') and the reverse primer myb-RR (5'CGGGGAAATTCGAGCTCTCAGAACTCGGGTATGT3'). The linearized overexpression vector pGWB41 was obtained using SacⅠ and AFeⅠ. The BnMYB4 gene fragment was then ligated to the linearized overexpression vector pGWB418 using T4 DNA Ligase to obtain the overexpression vector pGWB418-BnMYB4.

[0031] Using the BnMYB4 gene sequence, two gRNAs with the highest scores and strongest specificity were screened using the online software CRISPR-GE (http: / / skl.scau.edu.cn / targetdesign / ). Based on the gRNA sequences, amplification primers with BsaI restriction sites were synthesized, where N was replaced with the designed gRNA, and the second gRNA was inverted for complementation. pCBC-DT1DT2 (with chloramphenicol resistance) was used as the intermediate gene editing vector. Figure 2(Figure A in the diagram) The target sequence containing the BsaI restriction site was amplified by mixing four primers: BsF:(5'ATATATGGTCTCGATTGNGTT3'), BsR:(5'ATTATTGGTCTCGAAACNCAA3'), F(5'TGNGTTTTAGAGCTAGAAATAGC3'), and R:(5'AACNCAATCTCTTAGTCGACTCTAC3'). This sequence was then used with the pKSE401 gene editing vector (with kanamycin resistance) to obtain the target sequence containing the BsaI restriction site. Figure 2 Connect the B diagram in the diagram to construct the CRISPR / Cas9-BnMYB4 gene editing vector for this gene.

[0032] Example 2: Genetic transformation of rapeseed

[0033] Overexpression and gene-edited seedlings were obtained through Agrobacterium-mediated hypocotyl infection. The specific steps are as follows:

[0034] 1. Seedling emergence: Select plump and active Westar seeds, put them into 2mL EP tubes, add mercuric chloride to sterilize in a clean bench for 4 minutes, pour out and recover the mercuric chloride, add 75% ethanol to sterilize for 2 minutes, pour out, rinse with sterile water for 2 minutes, repeat 3 times, use sterile tweezers to evenly place the treated seeds in M0 medium, and culture in the dark at 24℃ for 6 days.

[0035] 2. Activation of Agrobacterium: One day after inoculation, Agrobacterium was cultured on YEP medium supplemented with the appropriate antibiotic at 28°C for 48 hours. A single colony was picked and transferred to 5 ml of YEP medium, and cultured with shaking at 28°C for 36 hours. Then, 1 ml of the bacterial culture was transferred to 45 ml of YEP medium and cultured with shaking at 28°C for 12 hours. Afterward, the cells were collected by centrifugation at 4000 rpm at 4°C. The Agrobacterium was then resuspended in DM medium and diluted to an OD600 of approximately 0.8.

[0036] 3. Infection and Co-culture: In a clean bench, cut 8-10 mm segments of the cultured hypocotyl, keeping them moist by adding DM culture medium during the cutting process. Then, immerse the segments in the prepared Agrobacterium suspension for 30 minutes, gently stirring with sterile forceps to ensure thorough inoculation. Finally, aspirate the suspension, transfer the hypocotyl to filter paper to remove excess suspension, and place it on M1 medium. Incubate at 24°C in the dark for 2 days.

[0037] 4. Selection culture: Transfer the hypocotyls from M1 to M2 medium and culture at 24℃ for 16 hours under light for 8 hours in the dark for 12 days.

[0038] 5. Differentiation culture: Remove the brown hypocotyls from M2, transfer the healthy hypocotyls to M3 medium, and culture at 24℃ for 16 hours in light and 8 hours in darkness. Repeat this process every 15 days until germination.

[0039] 6. Rooting culture: After the buds appear, remove the callus tissue from the buds and insert them into M4 medium. Culture at 24℃ for 16 hours under light and 8 hours in the dark until roots are formed.

[0040] The embodiments of the present invention involve the following: a specialized culture medium, antibiotic and hormone formulations, and their preparation.

[0041] Culture medium formulation and preparation method:

[0042] 1. M0: Weigh 4.405g of MS powder, add 1L of deionized water to dissolve it completely, adjust the pH to 5.85, dispense it into seedling boxes, add 0.35g of agar powder, and sterilize in an autoclave at 121℃ for 20min.

[0043] 2.M1: Weigh 4.405g MS powder, 30g sucrose, 18g mannitol, 1000μl 2,4-D (1mg / ml), and 300μl KT (1mg / ml). Dissolve them thoroughly in 1L of deionized water, adjust the pH to 5.85, add 7g agar powder, and autoclave at 115℃ for 15min. After sterilization, add 1000μl AS (100mM / mL) in a clean bench and mix thoroughly. Dispense into petri dishes and store at 4℃.

[0044] 3. M2: The preparation method is the same as M1. After sterilizing in an autoclave at 115℃ for 15 minutes, add 1500μl of AgNO3, 1000μl of TMT (200mg / ml), and 500μl of Kan (50mg / ml) in a clean bench and mix thoroughly. Dispense into petri dishes and store at 4℃.

[0045] 4. M3: Weigh 4.405g MS powder, 10g glucose, 0.25g xylose, and 0.6g ethanesulfonic acid. Dissolve them thoroughly in 1L of deionized water. Adjust the pH to 5.85. Add 7g agar powder and autoclave at 115℃ for 15 minutes. After sterilization, add 2000μl ZT (0.5mg / mL), 100μl IAA (1mg / mL), and 1000μl TMT (200mg / mL) in a clean bench and mix thoroughly. Dispense into petri dishes and store at 4℃.

[0046] 5. M4: Weigh 2.202g of MS powder, add 1L of deionized water to dissolve it completely, adjust the pH to 5.85, add 0.35g of agar powder, heat to boiling, and then dispense 50mL into each conical flask. Sterilize in an autoclave at 121℃ for 20min.

[0047] 6. DM: Weigh 4.405g MS powder, 30g sucrose, 1000μl 2,4-D (1mg / ml), and 300μl KT (1mg / ml). Add 1L of deionized water and dissolve thoroughly. Adjust the pH to 5.85. Dispense into Erlenmeyer flasks and autoclave at 121℃ for 20min.

[0048] 7. YEP: Weigh 2g of peptone powder, 2g of yeast powder, 1g of NaCl, and 15g of agar. Sterilize in an autoclave at 121℃ for 20 minutes, then dispense into petri dishes and store at 4℃.

[0049] Antibiotic formulation:

[0050] 1. Kanamycin (Kan, 50mg / ml): Weigh 0.5g of kanamycin powder, add 10ml of deionized water to dissolve it completely, filter it, and dispense it into sterile EP tubes. Store at -20℃.

[0051] 2. Ampicillin (Amp, 50mg / ml): Weigh 0.5g of ampicillin powder, add 10ml of deionized water to dissolve it completely, filter to sterilize, dispense into individual containers, and store at -20℃.

[0052] 3. TMT (200mg / l): Under aseptic conditions, inject 4ml of sterile deionized water into 1.6g of unopened bottled TMT powder using a syringe. After mixing thoroughly, remove the powder, add another 4ml of sterile deionized water, mix thoroughly, dispense directly into sterile EP tubes, and finally store at -20℃.

[0053] 4. Rifampin (30mg / ml): Weigh 0.5g of rifampin powder, add 10ml of DMSO to dissolve it completely, filter to sterilize, and dispense into sterile EP tubes. Store at -20℃.

[0054] 5. Spectinomycin (spec, 50mg / ml): Weigh 0.5g of kanamycin powder, dissolve it thoroughly in 10ml of sterile deionized water, filter to sterilize, and dispense into sterile EP tubes. Store at -20℃.

[0055] Hormone formulation:

[0056] 1. Acetyleugenone (As, 100mM / mL): Weigh 0.196g of acetyleugenone powder, add 10mL of DMSO to dissolve it completely, filter to sterilize, dispense into sterile EP tubes, and finally store in a -20℃ refrigerator.

[0057] 2. Plant growth regulator (2,4-D, 1 mg / mL): Weigh 100 mg of 2,4-D, add 1 mL of 1N KOH and shake for 5 min. Then add 10 mL of sterile deionized water and shake until 2,4-D is fully dissolved. Finally, bring the volume to 100 mL with sterile deionized water and store at 4°C.

[0058] 3. Kinetin (KT, 1 mg / mL): Weigh 100 mg of KT dry powder, then add 1 mL of 1N KOH and shake until KT is completely dissolved. Then add ddH2O to make up to 100 mL and store at 4℃.

[0059] 4. Naphthaleneacetic acid (NAA, 1 mg / ml): Weigh 100 mg of NAA, add 1 mL of 1N KOH and shake until NAA is completely dissolved. Then add sterile deionized water to make up to 100 mL and store in a refrigerator at 4°C protected from light.

[0060] 5. Zeatin (ZT, 0.5 mg / mL): Under aseptic conditions, add 95% ethanol to each tube containing 5 mg of zeatin and dissolve completely. Then add sterile deionized water to bring the volume to 10 mL. Filter to remove bacteria and store at -20°C.

[0061] 5. Indoleacetic acid (IAA, 1 mg / mL): Weigh 100 mg of IAA dry powder and dissolve it in 5 ml of anhydrous ethanol. Add sterile deionized water to bring the volume to 100 mL, then filter to sterilize, and finally store in a -20°C refrigerator.

[0062] Example 3: Positive identification and expression level determination of transgenic materials

[0063] Genomic DNA was extracted from leaves of wild-type Brassica napus (control) and transgenic rapeseed lines using the CTAB method. Forward primer 418-F1 (5'CTATCCTTCGCAAGACCC3') was designed based on the pGWB418 vector sequence, and reverse primer MYB4-OE-R (5'GTTGGATCAATCCCTCGGTTT 3') was designed based on the BnMYB4 gene sequence for PCR amplification. Positive lines were screened. To determine whether BnMYB4 is overexpressed in rapeseed, real-time quantitative PCR (qPCR) was used to analyze the identified transgenic plants. qPCR used… The Green Realtime PCR Master Mix-Plus kit was used with a PCR program set to 95℃ pre-denaturation for 30 seconds, followed by 40 cycles (95℃ 10 seconds, 60℃ 10 seconds, 72℃ 26 seconds). The rapeseed housekeeping gene BnActin7 (Brassica napus actin-7) was used as an internal control. The qPCR primers for BnActin7 (Gene ID: 106418315) were:

[0064] BnActin7-F1: 5'-TCTTCCTCACGCTATCCTCCG-3' and

[0065] BnActin7-R1: 5'-AGCCGTTCCAGCTCTTGC-3'

[0066] The qPCR primers for the BnMYB4 gene are:

[0067] Q-MYB4-OE-F: 5'CTTCTTGGCAACAAATGGTCG 3' and

[0068] Q-MYB4-OE-R: 5'GTTGGATCAATCCCTCGGTTT 3' The transcriptional level of the BnMYB4 gene in the above positive seedlings was analyzed, and lines with high expression levels were screened for further experiments (see...). Figure 2 ).

[0069] Example 4: Identification of resistance to sclerotinia stem rot in the transgenic rapeseed line BnMYB4

[0070] 1. Inoculation of detached leaves with *Sclerotinia sclerotiorum*: Take a 6mm *Sclerotinia sclerotiorum* mycelial block and activate it in a PDA plate. When the mycelium is about to spread to the edge of the plate, take a 6mm newly formed mycelial block near the edge of the plate and place it in a new PDA plate for activation. Incubate in the dark at 22℃ for about 40 hours. Place three layers of absorbent paper at the bottom of a clean, non-toxic food storage container, and add an equal amount of sterile water to each container. Take a fully unfolded, second-to-last leaf of the same size, wrap the petiole with moistened absorbent cotton to retain moisture, and place it in the food storage container. Use a punch to take a 6mm diameter mycelial block and place it on the leaf, mycelium facing down, avoiding the main vein, and invert it in the same position on the leaf. Spray an equal amount of sterile water evenly to maintain moisture, and incubate in the dark in an artificial incubator at 22℃. Observe and record the *Sclerotinia sclerotiorum* infection status regularly. Set up three biological replicates for each strain.

[0071] The experiment found that 48 hours after inoculation, the lesion area of ​​the BnMYB4 gene-edited line was larger than that of the wild type, with the edited materials Bnmyb4-1 and Bnmyb4-9 increasing by 16.12% and 11.60%, respectively. The overexpression materials BnMYB4 and BnMYB4-22 showed smaller lesion areas compared to the wild type, decreasing by 18.84% and 33.42%, respectively.

[0072] 2. Inoculation of Leaf Extracts: Weigh 10.65g, 12.14g, 0.03g, and 1.74g of MES, Tris, EDTA, and NaCl, respectively, and add sterile deionized water to a final volume of 1L to prepare leaf extracts. Grind 2g of leaves of the same size and from the same part into powder, add 40mL of the extract and mix well. Centrifuge at 4500 rpm for half an hour at room temperature. Collect the supernatant and sterilize using a bacterial filter membrane. Add the supernatant to PDA medium at a 1:1 ratio for storage. Use a punch to create 6mm hyphal blocks along the edge of the hyphae, place them hyphae-side down in the center of the PDA medium, and use the area of ​​hyphal expansion as the basis for anti-Sclerotinia sclerotiorum.

[0073] The experiment found that 72 hours after inoculation with Sclerotinia sclerotiorum, the Sclerotinia sclerotiorum plaque area in the culture medium supplemented with leaf extract of the BnMYB4 overexpression strain was significantly smaller than that in the culture medium supplemented with leaf extract of the wild type; the Sclerotinia sclerotiorum plaque area in the culture medium supplemented with leaf extract of the BnMYB4 gene-edited strain was significantly larger than that in the culture medium supplemented with leaf extract of the wild type.

[0074] 3. DAB staining: Cut equal-sized leaves inoculated for 36 hours along the edge of hyphal expansion and place them in 50 mL of diaminobenzidine solution (1 mg / mL). After vacuuming for 20 minutes, incubate at 28°C for 8 hours. Decolorize with 95% alcohol for 10 hours, changing the 95% alcohol 1-2 times during this period. Finally, prepare slides and photograph them using a stereomicroscope. The accumulation of H2O2 in the leaves is determined by observing the depth of the brown polymer formed by the combination of DAB and H2O2.

[0075] The experiment revealed that DAB staining was performed on leaves 36 hours after inoculation. The results showed that the leaves of the BnMYB4 overexpression line were darker brown than those of the wild type, indicating a higher accumulation of H2O2; the leaves of the BnMYB4 gene-edited line were lighter in color than those of the wild type, indicating a lower accumulation of H2O2.

Claims

1. The application of overexpression of transcription factor BnMYB4 gene in improving resistance to sclerotinia stem rot in rapeseed, characterized by: The nucleotide sequence of the rapeseed BnMYB4 gene is shown in SEQ ID NO:1.

Images