Method for regulating soybean plant height and application thereof

Abstract

The invention relates to the technical field of biology, and particularly provides a method for regulating and controlling the plant height of soybeans and application of the method. The method comprises the following steps: overexpressing or knocking out any one or more of the following genes in soybeans: GmNRPE6a or GmNRPE6b; wherein the nucleotide sequence of the GmNRPE6a gene is as shown in SEQ ID NO: 1; the nucleotide sequence of the GmNRPE6b gene is as shown in SEQ ID NO: 2. Through knockout or overexpression of the gene, the plant height of the soybean can be regulated and controlled, the soybean plant can better adapt to the local growth environment, and the yield and quality of the soybean can be improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for regulating soybean plant height and application thereof. Background Art

[0002] Soybean is an important cash crop with economic value such as food, oil and feed. However, the current soybean production is far from meeting the market demand. Therefore, it is very necessary to use modern biological breeding technology to quickly increase soybean production.

[0003] Plant height is one of the important agronomic traits of crops and an important component of evaluating the ideal plant type of crops. Dwarf crops often have advantages such as resistance to lodging and tolerance to dense planting, which is of great significance in crop breeding to increase yield. How to reduce the height of soybean plants, cultivate the ideal plant type of soybean varieties, increase the planting density of soybeans, and thus increase the soybean yield per unit area, and increase the total domestic soybean production is a breeding and production technology problem that needs to be solved urgently.

[0004] GmNRPE6 protein is an analog of EAF6, a core subunit of the nucleosomal histone H4 acetyltransferase complex (NuA4). Many studies have shown that this gene is involved in the regulation of various life processes in organisms, including DNA damage repair and cell cycle regulation, and affects plant de-etiolation and plant fertility in plants. However, there are no reports on the application of the GmNRPE6 gene in soybean to regulate plant height. Summary of the invention

[0005] The main purpose of the present invention is to provide a method for regulating soybean plant height and application thereof, so as to solve the problem that there is a lack of a method for regulating soybean plant height in the prior art.

[0006] In order to achieve the above-mentioned object, according to the first aspect of the present invention, a method for regulating soybean plant height is provided, the method comprising: overexpressing or knocking out any one or more of the following genes in soybean: GmNRPE6a or GmNRPE6b; wherein the nucleotide sequence of the above-mentioned GmNRPE6a gene is SEQ ID NO: 1; the nucleotide sequence of the above-mentioned GmNRPE6b gene is SEQ ID NO: 2.

[0007] Furthermore, the CRISPR-Cas9 gene editing system was used to perform the above knockout.

[0008] Furthermore, the above-mentioned CRISPR-Cas9 gene editing system includes sgRNA; the above-mentioned sgRNA includes: sgRNA1 and sgRNA2 that simultaneously target the GmNRPE6a gene and the GmNRPE6b gene; wherein the nucleotide sequence of the above-mentioned sgRNA1 is SEQ ID NO: 9; and the nucleotide sequence of the above-mentioned sgRNA2 is SEQ ID NO: 10.

[0009] Furthermore, the GmNRPE6a gene is knocked out in the following manner: the C base at position 39 of the nucleotide sequence of the GmNRPE6a gene is deleted.

[0010] Furthermore, the GmNRPE6b gene is knocked out in the following manner: the C base at position 35 of the nucleotide sequence of the GmNRPE6b gene is deleted; or 5 bases from position 30 to 34 of the nucleotide sequence of the GmNRPE6b gene are deleted.

[0011] Furthermore, the above method includes: knocking out the following two genes in soybean: GmNRPE6a and GmNRPE6b.

[0012] Furthermore, the GmNRPE6a gene and the GmNRPE6b gene were knocked out in the following manner: the C base at position 39 of the nucleotide sequence of the GmNRPE6a gene was deleted and 5 bases from position 30 to 34 of the nucleotide sequence of the GmNRPE6b gene were deleted.

[0013] Furthermore, the overexpression method comprises: introducing an overexpression vector into the soybean; the overexpression vector contains the GmNRPE6a gene and / or the GmNRPE6b gene and a strong promoter.

[0014] Furthermore, the above-mentioned overexpression vector contains the above-mentioned GmNRPE6a gene or the above-mentioned GmNRPE6b gene and the above-mentioned strong promoter.

[0015] Furthermore, the strong promoter is selected from any one or more of the following: CaMV 35S promoter, UBQ10 promoter, Nos promoter, Actin2 promoter, RbcS promoter or 35S enhancer.

[0016] In order to achieve the above object, according to a second aspect of the present invention, there is provided an application of the above method in soybean planting.

[0017] By applying the technical solution of the present invention, any one or more of the following genes in soybean are overexpressed or knocked out: GmNRPE6a or GmNRPE6b; wherein the nucleotide sequence of the above GmNRPE6a is SEQ ID NO: 1; and the nucleotide sequence of the above GmNRPE6b is SEQ ID NO: 2.

[0018] Beneficial technical effects: When the above gene is overexpressed, the height of soybean plants becomes shorter. When the above gene is knocked out, the height of soybean plants increases. The increase or decrease in height of soybean plants may affect the growth and yield of soybean plants. By regulating the height of soybean plants, the plants can be better adapted to the local growth environment and the yield and quality of soybeans can be improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the accompanying drawings:

[0020] Figure 1 A map of the recombinant empty vector pXL106 according to an embodiment of the present invention is shown.

[0021] Figure 2 A map of the gene knockout empty vector pFYS007 according to an embodiment of the present invention is shown.

[0022] Figure 3 The protein expression detection of overexpressed GmNRPE6a and GmNRPE6b according to an embodiment of the present invention is shown.

[0023] Figure 4 The detection of RNA expression levels of overexpressed GmNRPE6a and GmNRPE6b according to an embodiment of the present invention is shown.

[0024] Figure 5 A plant height phenotype diagram of transgenic soybean materials overexpressing GmNRPE6a and GmNRPE6b according to an embodiment of the present invention is shown.

[0025] Figure 6 A statistical analysis chart of plant height of transgenic soybean materials overexpressing GmNRPE6a and GmNRPE6b according to an embodiment of the present invention is shown.

[0026] Figure 7 A diagram showing the sequencing results of GmNRPE6a and GmNRPE6b gene knockout soybean materials according to an embodiment of the present invention is shown.

[0027] Figure 8 The plant height phenotype diagram of the GmNRPE6a and GmNRPE6b gene knockout materials according to an embodiment of the present invention is shown.

[0028] Fig. 9 A statistical analysis chart of plant height of GmNRPE6a and GmNRPE6b gene knockout materials according to an embodiment of the present invention is shown. DETAILED DESCRIPTION

[0029] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0030] As mentioned in the background technology, soybean is an important economic crop, and the current soybean yield cannot meet the market demand. The height of soybean plants may affect the yield of soybeans. Therefore, the inventors of the present invention attempted to modify the soybean gene to make its plant height easily regulated, and thus proposed a series of protection schemes of the present invention.

[0031] In a first typical embodiment of the present invention, a method for regulating soybean plant height is provided, the method comprising: overexpressing or knocking out any one or more of the following genes in soybean: GmNRPE6a or GmNRPE6b; wherein the nucleotide sequence of the above GmNRPE6a gene is SEQ ID NO: 1; the nucleotide sequence of the above GmNRPE6b gene is SEQ ID NO: 2.

[0032] Overexpression of the above genes in soybeans shortens the height of soybean plants. Shortening soybean plant height helps reduce losses caused by lodging, promotes effective absorption of nutrients and water by soybeans in the soil layer, and increases effective planting area, thereby further increasing soybean yields. In addition, shortening soybean plant height can improve crop resistance, resource utilization efficiency, and economic benefits under certain conditions. Therefore, in breeding and cultivation, appropriately selecting short varieties can help achieve high and stable yields.

[0033] When the above gene is knocked out in soybeans, the soybean plants become taller. A taller plant height helps reduce the occurrence of pests and diseases because taller plants are farther from the ground, which is conducive to air circulation and reduces the spread of pests and diseases.

[0034] It should be noted that gene knockout refers to the deletion or inactivation of a specific gene from the genome of an organism through gene editing technology in order to study the effect of the gene on the organism. Methods for achieving gene knockout include but are not limited to: 1) using homologous recombination to replace the target gene with a non-functional or damaged version by introducing a modified DNA fragment. When the exogenous DNA undergoes homologous recombination with a gene with the same or similar sequence in the genome of the recipient cell, the target gene is replaced and inactivated; 2) using RNA interference to silence or degrade the mRNA of the target gene by using small RNA molecules to prevent it from being translated into protein, thereby achieving gene knockout; or 3) using the CRISPR-Cas9 system to introduce targeted DNA breaks at specific locations in the genome using sgRNA and Cas9 enzymes, resulting in gene disruption. CRISPR-Cas9 produces frameshift mutations or fragment deletions at the break site through a non-homologous end joining repair pathway, resulting in gene silencing and loss of function.

[0035] In a preferred embodiment of the present invention, the knockout is performed using the CRISPR-Cas9 gene editing system. The knockout of the gene using the above method has the beneficial effect of being easy to operate.

[0036] In a preferred embodiment of the present invention, the CRISPR-Cas9 gene editing system includes sgRNA; the sgRNA includes: sgRNA1 and sgRNA2 that simultaneously target the GmNRPE6a gene and the GmNRPE6b gene; wherein the nucleotide sequence of the sgRNA1 is SEQ ID NO: 9; and the nucleotide sequence of the sgRNA2 is SEQ ID NO: 10. Using the sgRNA for gene editing has the advantage of high editing efficiency.

[0037] It should be noted that the GmNRPE6a gene and the GmNRPE6b gene have a high homology (96.41%) and their nucleotide sequences are basically the same, so both sgRNA1 and sgRNA2 can target GmNRPE6a and GmNRPE6b at the same time.

[0038] In a preferred embodiment of the present invention, the GmNRPE6a gene is knocked out in the following manner: the C base at position 39 of the nucleotide sequence of the GmNRPE6a gene is deleted. In a preferred embodiment of the present invention, the GmNRPE6b gene is knocked out in the following manner: the C base at position 35 of the nucleotide sequence of the GmNRPE6b gene is deleted; or the 5 bases at positions 30 to 34 of the nucleotide sequence of the GmNRPE6b gene are deleted. When the GmNRPE6a gene and the GmNRPE6b gene undergo the above mutations, the function of the gene is inactivated and the plant height of the soybean increases.

[0039] In a preferred embodiment of the present invention, the above method includes: knocking out the following two genes in soybean: GmNRPE6a and GmNRPE6b. In a preferred embodiment of the present invention, the above GmNRPE6a gene and the above GmNRPE6b gene are knocked out in the following manner: the C base at the 39th position of the nucleotide sequence of the above GmNRPE6a gene is deleted and the 5 bases from the 30th to the 34th position of the nucleotide sequence of the above GmNRPE6b gene are deleted. By knocking out the GmNRPE6a and GmNRPE6b genes in soybean in the above manner, the height of soybean plants becomes taller.

[0040] In a preferred embodiment of the present invention, the overexpression method comprises: introducing an overexpression vector into the soybean; the overexpression vector contains the GmNRPE6a gene and / or the GmNRPE6b gene and a strong promoter. The overexpression method may help reduce the height of soybean plants, thereby helping to increase soybean yield.

[0041] In a more preferred embodiment of the present invention, the overexpression vector contains the GmNRPE6a gene or the GmNRPE6b gene and the strong promoter. The overexpression method may help reduce soybean plant height.

[0042] The function of the strong promoter is to enhance the expression of the target gene. In a preferred embodiment of the present invention, the strong promoter is selected from any one or more of the following: CaMV 35S promoter, UBQ10 promoter, Nos promoter, Actin2 promoter, RbcS promoter or 35S enhancer.

[0043] In a second typical embodiment of the present invention, an application of the above method in soybean planting is provided.

[0044] The present invention is further described in detail below in conjunction with specific embodiments. These embodiments should not be construed as limiting the scope of protection claimed by the present invention.

[0045] Example 1 Cloning of soybean GmNRPE6 gene

[0046] NuA4 (Nucleosome Acetyltransferase of H4) is an evolutionarily conserved histone acetyltransferase complex. It is a 13-subunit complex that can specifically acetylate histone H4 and H2A N-terminal tails. NuA4 histone acetyltransferase is involved in transcriptional regulation and cell cycle processes in eukaryotes.

[0047] Arabidopsis thaliana AtEAF6 (Arabidopsis thaliana Esa1-Associated Factor 6) is a core component of the histone acetyltransferase complex TIP60 / NuA4, which regulates chromatin structure and gene expression by mediating acetylation modification of histones H4 and H2A.

[0048] According to the protein sequence of Arabidopsis AtEAF6, the Soybase database was searched and it was found that there were two homologous genes of EAF6 in soybean, located on chromosome 10 and chromosome 13, respectively. They were named GmNRPE6a (Glyma.10G036900) and GmNRPE6b (Glyma.13G123300). The nucleotide sequences of GmNRPE6a and GmNRPE6b are SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0049] Primers for cloning GmNRPE6a and GmNRPE6b were designed based on their sequences, among which the nucleotide sequences of primers for PCR amplification of GmNRPE6 gene were as follows: upstream primer 1 of GmNRPE6a (SEQ ID NO: 3): ATGGAACCGGAAGGGCAAAAGGGTA; upstream primer 2 of GmNRPE6b (SEQ ID NO: 4): ATGGAATCGGAAGGGCAAAAGGGTA; downstream primer 1 of GmNRPE6a and GmNRPE6b (SEQ ID NO: 5): TCACAAGGTCAGGTCAGGATCATCT.

[0050] PCR amplification was performed using soybean leaf cDNA as a template. The amplification conditions were as follows: 98°C, pre-denaturation for 3 min; 98°C, denaturation for 30 s; 55°C, annealing for 30 s; 68°C, extension for 30 s; amplification cycle number 35; final extension at 68°C for 10 min; storage at 4°C. The PCR product was electrophoresed in a 1% agarose gel, and then a band of 474 bp was cut out in a UV gel exciter, and the target band was recovered using a Promega small agarose gel DNA recovery kit.

[0051] Take an appropriate amount of the recovered product, use the TA / Blunt-Zero Cloning Kit (model: C601-01, manufacturer: Novozyme) to connect the target band and the empty pCE2 vector and transform the competent E. coli DH5α. After colony PCR identification, extract the positive colony plasmids pCE2-GmNRPE6a and pCE2-GmNRPE6b and send them to the company for sequencing.

[0052] Example 2 Construction of soybean GmNRPE6 gene overexpression vector and knockout vector and Agrobacterium transformation

[0053] 1) Construction of soybean GmNRPE6a and GmNRPE6b overexpression vectors: GmNRPE6a and GmNRPE6b specific primers (SEQ ID NOs: 6-8) were used to amplify the target bands of GmNRPE6a and GmNRPE6b from plasmids pCE2-GmNRPE6a and pCE2-GmNRPE6b, respectively. Then, GmNRPE6a and GmNRPE6b were connected to the pXL106 vector stored in the laboratory (the structure of the empty vector is shown in Figure 1 , the nucleotide sequence of the empty vector is a sequence of SEQ ID NO: 22 and SEQ ID NO: 29 connected in sequence), to form overexpression vectors pXL106-GmNRPE6a and pXL106-GmNRPE6b. The nucleotide sequences of the primers for PCR amplification of the GmNRPE6 gene (including the GmNRPE6a gene and the GmNRPE6b gene) are as follows:

[0054] GmNRPE6a upstream primer (SEQ ID NO: 6): GGCGGAGTCGACTCCGGATCCATGGAATCGGAAGGGCAAAAGGGTAC.

[0055] GmNRPE6b upstream primer (SEQ ID NO: 7): GGCGGAGTCGACTCCGGATCCATGGAACCGGAAGGGCAAAAGGG.

[0056] Downstream primer of GmNRPE6a and GmNRPE6b (SEQ ID NO: 8): GTTTGAACGATCTTAGGGCCCCAAGGTCAGGTCAGGATCATCTTCA.

[0057] 2) Construction of soybean GmNRPE6a and GmNRPE6b gene knockout vector: The knockout expression vector was constructed using the reported CRISPR-Cas9 technology. The vector used was the pFYS007 empty vector, the structure of which is shown in Figure 2, whose nucleotide sequence is a sequence of SEQ ID NO: 23, SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 32 connected in sequence. The steps of knocking out the expression vector are as follows: First, the genomic exon region sequence of GmNRPE6a and GmNRPE6b was designed using the website http: / / crispor.tefor.net / . According to the score, sgRNA1 (nucleotide sequence is SEQ ID NO9: GCAATTCGTTCTCTCGAACATGG) and sgRNA2 (nucleotide sequence is SEQ ID NO 10: AAAGGGTACGGTGAACCCGTCGG) were selected, and then the primers required for the knockout vector were designed according to the sgRNA sequence. The nucleotide sequences of the primers are:

[0058] 007-EAF6-T1-F (SEQ ID NO: 11): TGGTCTCGTGCAGCAATTCGTTCTCTCGAACAGTTTTAGAGCTAGAAATAGC.

[0059] 007-EAF6-T1-R (SEQ ID NO: 12): TGGTCTCGACCGTACCCTTTTGCACCAGCCGGGAATCGAA.

[0060] 007-EAF6-T2-F (SEQ ID NO: 13): TGGTCTCCGGTGAACCCGTGTTTTAGAGCTAGAAATAGC.

[0061] 007-EAF6-T2-R (SEQ ID NO: 14): TGGTCTCGAAACGTCCGCGATGTTAGCGTCTCTGCACCAGCCGGGAATCGAA.

[0062] The vector construction process is as follows: using the pFYS007 empty vector as a template, PCR amplification with primers containing sgRNA to obtain the target fragment containing sgRNA, and then the target fragment is combined with the pFYS007 empty vector and the restriction endonuclease BsaI-HF @v2 (manufacturer: NEB, model: R3733L), T4 DNA ligase (manufacturer: NEB, model: M0202L) and their corresponding buffer were mixed, cut and ligated in a PCR instrument, and the final product was transformed into Escherichia coli DH5α. After successful sequencing, the vector construction was completed, and the GmNRPE6 gene knockout vector FYS007-GmNRPE6 was obtained. It should be noted that due to the randomness of gene knockout, the site of mutation in the gene knockout vector FYS007-GmNRPE6 obtained here may be the GmNRPE6a gene, the GmNRPE6b gene, or both the GmNRPE6a gene and the GmNRPE6b gene.

[0063] The amplification reaction system is shown in Table 1, and the amplification reaction procedure is shown in Table 2.

[0064] Table 1

[0065]

[0066] Table 2

[0067]

[0068] Transformation of Agrobacterium:

[0069] The constructed transgenic vectors (including overexpression vectors pXL106-GmNRPE6a, pXL106-GmNRPE6b and gene knockout vector FYS007-GmNRPE6) were transformed into EHA105 Agrobacterium competent cells prepared and preserved in the laboratory by heat stimulation. The specific process was as follows: 1 μL of the constructed transgenic vector was added to 100 μL of EHA105 competent cells, placed on ice for 30 min, then quick-frozen in liquid nitrogen for 5 min, incubated at 37°C for 5 min, 500 μL of liquid LB medium without antibiotics was added, and cultured on a shaker at 28°C for 2 h, and then the bacterial solution was spread on a solid plate containing the corresponding antibiotics to obtain EHA105 strains for genetic transformation (referring to Agrobacterium EHA105 strains containing overexpression vectors pXL106-GmNRPE6a, pXL106-GmNRPE6b and gene knockout vector FYS007-GmNRPE6, respectively).

[0070] It should be noted that the antibiotics used in pXL106-GmNRPE6a and pXL106-GmNRPE6b are rifampicin (Rif) and spectinomycin (Spec), and the antibiotics used in FYS007-GmNRPE6 are rifampicin (Rif) and kanamycin (Kan).

[0071] Example 3 Creation of soybean GmNRPE6 gene overexpression and knockout transgenic materials

[0072] Creation of transgenic soybean materials by soybean cotyledon node immersion method: Transgenic soybean materials were created using the soybean variety W82 (Williams 82) propagated and preserved in the laboratory as the recipient material.

[0073] After 5 days of aseptic germination of plump and spot-free W82 seeds, the cotyledonary nodes were carefully taken as explants with a scalpel and tweezers, placed in EHA105 bacterial suspension, and inoculated at room temperature for 30 minutes; the infected explants then underwent adventitious bud induction, bud elongation, rooting induction, tissue culture seedling growth acclimatization and transplanting to obtain T0 transgenic seedlings with GmNRPE6 gene knockout and overexpression. The T0 positive seedlings obtained by screening were preliminarily identified for transgenics using PAT / bar transgenic test paper (manufacturer: AgeneFast, model: AG-002-SLF) and seeds were harvested. Finally, 3 copies / types of transformation materials were obtained, namely: GmNRPE6 gene knockout material gmnrpe6, GmNRPE6 overexpression materials GmNRPE6aOE and GmNRPE6bOE. It should be noted that the above experiments were completed by the Modern Agricultural Transgenic Platform of Peking University, which is open to the public.

[0074] It should be noted that the transgenic material of the T0 generation may not be a stable inherited material, but may be a mosaic or a heterozygote. Therefore, it is necessary to identify the offspring of T0 to obtain stable and heritable transgenic materials. The mutation site of the GmNRPE6 gene knockout material gmnrpe6 here may be a single mutation of the GmNRPE6a gene or the GmNRPE6b gene, or a double mutation of the GmNRPE6a+GmNRPE6b gene.

[0075] Example 4 Identification of soybean GmNRPE6 gene overexpression and knockout transgenic materials

[0076] 1) CTAB method for extracting soybean genomic DNA: Use a leaf sampler to take a leaf tissue with a diameter of 6 mm, put it into a 2 mL EP tube, add a clean steel ball with a diameter of 2 mm, put it into liquid nitrogen for precooling, and then use a sampler to sample for 1 min at 50 Hz; add 300 μL of CTAB extraction buffer, shake it thoroughly, and incubate it at 65°C for 30 min; cool it to room temperature, add 300 μL of phenol: chloroform: isoamyl alcohol (25:24:1), and mix it; centrifuge it at 12000rpm for 10 min, aspirate the supernatant into a new 1.5 mL centrifuge tube, add 0.6 times the volume of isopropanol, gently invert and mix it, and let it stand at -20°C for 30 min; centrifuge it at room temperature at 12000rpm for 10 min, discard the supernatant, add 1 mL of 70% ethanol to rinse; centrifuge it at room temperature at 12000rpm for 5 min, blow it on a clean bench for 5-10 min; add 50 μL of ddH2O, dissolve it and store it at 4°C.

[0077] 2) T1 generation gene-edited soybean genome amplification and identification: The extracted T1 generation transgenic soybean genomic DNA was used as a template to perform PCR amplification on the GmNRPE6a and GmNRPE6b genes. The PCR products were then sequenced for the first generation to obtain the sequence information of the GmNRPE6a and GmNRPE6b genes in the transgenic material, and the gene editing event was determined by comparing the reference genome sequence of the wild-type W82. The amplification reaction system is shown in Table 3, and the amplification reaction procedure is shown in Table 4. Among them, the nucleotide sequence of the amplification primer is:

[0078] GmNRPE6a-CR-F (SEQ ID NO: 15): GGTTAATCCTCCGAGTTGCGAAG.

[0079] GmNRPE6b-CR-F (SEQ ID NO: 16): CCGCATTGTGAAGCAATTAGGG.

[0080] GmNRPE6-CR-R (SEQ ID NO: 17): CGGAATTGGTTCAACCAACCAAAC.

[0081] Table 3:

[0082]

[0083] Table 4:

[0084]

[0085] 2 μL of PCR product was tested by 1% agarose gel electrophoresis, and the remaining products were sequenced and compared. By sequencing and comparison, we obtained single mutants of gmnrpe6a-1 and gmnrpe6b-1 and double mutants of gmnrpe6a-1+gmnrpe6b-2. The results are shown in Figure 7 Among them, the mutation type of gmnrpe6a-1 is a deletion of one base at the 39th position of the nucleotide sequence of the GmNRPE6a gene; the mutation type of gmnrpe6b-1 is a deletion of one base at the 35th position of the nucleotide sequence of the GmNRPE6b gene; the mutation type of gmnrpe6b-2 is a deletion of five bases from the 30th to the 34th position of the nucleotide sequence of the GmNRPE6b gene.

[0086] 3) Extraction and Western blot detection of soybean leaf protein: Use a leaf sampler to take a circular leaf with a diameter of 6 mm, put it into a 2 mL EP tube, freeze it quickly in liquid nitrogen, and then use a tissue grinder to break the leaf. Add 40 μL SDS-PAGE protein loading buffer (2×) to the EP tube, vortex, incubate at 95°C for 5 minutes, then centrifuge at 12000g for 1 minute, and take 10 microliters of supernatant for protein electrophoresis detection. After electrophoresis, use Bio-Rad semi-dry transfer instrument to transfer the protein to PVDF membrane; PVDF membrane is first stained with Ponceau red dye to detect the transfer efficiency, then the dye is cleaned with PBS solution, and the PVDF membrane is blocked with 5% skim milk powder at room temperature for 1 hour. Replace fresh blocking solution, then add antibody to the blocking solution at 1:3,000, hybridize for 1 hour or incubate overnight at 4°C; wash the membrane in TBST 3 times, 5 minutes each time; perform chemical color development.

[0087] The experimental results are as follows Figure 3 As shown, two overexpression transgenic lines of GmNRPE6a and GmNRPE6b (GmNRPE6aOE-1, GmNRPE6aOE-2, GmNRPE6bOE-1, and GmNRPE6bOE-2) were obtained, with obvious signals.

[0088] 4) RNA extraction from soybean leaves and detection of GmNRPE6 gene expression: The tripterygium leaves of wild-type W82 and GmNRPE6 overexpression materials (GmNRPE6aOE-1, GmNRPE6aOE-2, GmNRPE6bOE-1 and GmNRPE6bOE-2) grown to the V2 stage were quickly frozen in liquid nitrogen and then ground in a mortar. Total RNA from the leaves was extracted using the Promega RNA extraction kit (LS1040), and then single-stranded cDNA was synthesized using the Novagen reverse transcription kit (R323-01) for fluorescence quantitative PCR detection of gene expression. After the synthesized cDNA was diluted 5 times, 2 μL was taken as a template, and the gene expression of GmNRPE6a and GmNRPE6b was detected using the Novagen fluorescence quantitative PCR Mix.

[0089] The nucleotide sequence of the overexpression detection primer used is:

[0090] GmNRPE6aOE-F (SEQ ID NO: 18): AACCCGTCCGCGATGTTAGCGT.

[0091] GmNRPE6aOE-R (SEQ ID NO: 19):CATTCCCACATTGTCCAGGATCT.

[0092] GmNRPE6bOE-F (SEQ ID NO: 20): AACCCGTCGGCAATGTTAGCTT.

[0093] GmNRPE6bOE-R (SEQ ID NO: 21): CATTACCACACTGTCCAGGATCC.

[0094] The results showed that the expression levels of GmNRPE6 gene in GmNRPE6a and GmNRPE6b overexpression strains (including GmNRPE6aOE-1, GmNRPE6aOE-2, GmNRPE6bOE-1 and GmNRPE6bOE-2) with protein expression were significantly increased compared with the wild-type W82 ( Figure 4 ).

[0095] Example 5 Plant height determination of soybean GmNRPE6 gene overexpression and knockout transgenic materials

[0096] Seeds of wild-type soybean material W82 and GmNRPE6 overexpression (GmNRPE6aOE-1, GmNRPE6aOE-2, GmNRPE6bOE-1 and GmNRPE6bOE-2) and gene knockout (gmnrpe6a-1, gmnrpe6b-1 and gmnrpe6a-1+gmnrpe6b-2) materials were planted in nutrient pots filled with substrate soil for germination and placed in a soybean growth room for growth. The light intensity in the soybean growth room was 300 μmol / m 2 / s, the light duration is 16 hours, the light is turned off for 8 hours, and the temperature is 25℃. When the transgenic soybean material shows a significant difference in plant height from the control material during the growth stage (30 days after planting), its plant height is measured and counted. The measurement standard is the length from the soybean unearthed position to the highest position of the soybean plant stem top.

[0097] By observing and measuring the plant height phenotype of GmNRPE6a and GmNRPE6b overexpression materials, it was found that compared with the wild-type control material W82, overexpression of GmNRPE6a or GmNRPE6b significantly reduced the plant height of soybean ( Figure 5 and Figure 6 In addition, by observing the plant height phenotype of GmNRPE6 mutant materials, including single mutants gmnrpe6a-1, gmnrpe6b-1 and double mutants gmnrpe6a-1+gmnrpe6b-2, it was found that the plant height of single mutants gmnrpe6a-1 and gmnrpe6b-1 was no different from that of W82, and only the double mutant gmnrpe6a-1+gmnrpe6b-2, in which both genes GmNRPE6a and GmNRPE6b were mutated, showed a phenotype of increased plant height compared with W82 ( Figure 8 and Fig. 9 ). It can be seen from the above results that the present invention can achieve the regulation of soybean plant height by overexpressing or knocking out the GmNRPE6 gene.

[0098] In various assays involved in this patent, each sample was assayed three times in parallel, and the results were expressed as mean ± standard deviation. The difference between each sample and the control was analyzed for significance (p value) by a two-tailed t-test.

[0099] From the above description, it can be seen that the above-mentioned embodiments of the present invention achieve the following technical effects: the present invention discovers for the first time that soybean GmNRPE6a and GmNRPE6b genes have the function of regulating plant height, and the present invention also proves through experiments that overexpression and knockout of GmNRPE6 genes (including GmNRPE6a genes and GmNRPE6b genes) can cause significant changes in plant height.

[0100] The present invention first created a double mutant of the gmnrpe6 gene editing and soybean materials overexpressing GmNRPE6a and GmNRPE6b, which provides necessary genetic materials for a deep understanding of the mechanism of soybean plant height regulation and provides good germplasm resources for the establishment and application of ideal soybean plant types.

[0101] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for regulating soybean plant height, characterized in that: The method comprises: overexpressing or knocking out any one or more of the following genes in soybean: GmNRPE6a or GmNRPE6b; Among them, the nucleotide sequence of the GmNRPE6a gene is SEQ ID NO: 1; the nucleotide sequence of the GmNRPE6b gene is SEQ ID NO:

2.

2. The method according to claim 1, characterized in that The knockout was performed using the CRISPR-Cas9 gene editing system.

3. The method according to claim 2, characterized in that The CRISPR-Cas9 gene editing system includes sgRNA; the sgRNA includes: sgRNA1 and sgRNA2 that simultaneously target the GmNRPE6a gene and the GmNRPE6b gene; Wherein, the nucleotide sequence of the sgRNA1 is SEQ ID NO: 9; the nucleotide sequence of the sgRNA2 is SEQ ID NO:

10.

4. The method according to claim 3, characterized in that The GmNRPE6a gene is knocked out in the following manner: the C base at position 39 in the nucleotide sequence of the GmNRPE6a gene is deleted.

5. The method according to claim 4, characterized in that The GmNRPE6b gene was knocked out in the following manner: The C base at position 35 of the nucleotide sequence of the GmNRPE6b gene is missing; Or, 5 bases from position 30 to 34 of the nucleotide sequence of the GmNRPE6b gene are deleted.

6. The method according to claim 5, characterized in that The method comprises: knocking out the following two genes in soybean: GmNRPE6a and GmNRPE6b.

7. The method according to claim 6, characterized in that The GmNRPE6a gene and the GmNRPE6b gene were knocked out in the following manner: The C base at position 39 of the nucleotide sequence of the GmNRPE6a gene is deleted, and 5 bases from position 30 to 34 of the nucleotide sequence of the GmNRPE6b gene are deleted.

8. The method according to claim 1, characterized in that The overexpression method comprises: introducing an overexpression vector into the soybean; the overexpression vector contains the GmNRPE6a gene and / or the GmNRPE6b gene and a strong promoter.

9. The method according to claim 8, characterized in that The overexpression vector contains the GmNRPE6a gene or the GmNRPE6b gene and the strong promoter.

10. The method according to claim 9, characterized in that The strong promoter is selected from any one or more of the following: CaMV 35S promoter, UBQ10 promoter, Nos promoter, Actin2 promoter, RbcS promoter or 35S enhancer.

11. Use of the method according to any one of claims 1 to 10 in soybean planting.

Images