Application of tomato antiviral related gene AGO2a in regulation and control of plant antivirus

Abstract

The invention discloses application of a tomato antiviral related gene AGO2a in virus resistance, and relates to the technical field of gene engineering. The nucleotide sequence of the AGO2a provided by the invention is shown as SEQ ID NO.3. The invention discloses that overexpression of the tomato AGO2a gene can effectively inhibit virus infection, can inhibit accumulation of virus DNA in a plant body, and improves the resistance of tomatoes to tomato yellow leaf curl virus for the first time. Meanwhile, the invention further provides a preparation method of the tomato transgenic line with tomato yellow leaf curl virus resistance. The prepared transgenic line has remarkable application value in the field of tomato planting.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to application of a tomato antiviral-related gene AGO2a in regulating plant antiviral resistance. Background Art

[0002] Tomato yellow leaf curl virus (TYLCV) is the third most harmful plant virus in the world. When TYLCV infects tomatoes, the edges of the leaves at the top of the plant will turn slightly yellow and curl, the leaves will become smaller and wrinkled, the plant will grow slowly, the internodes will shorten, the plant will be significantly dwarfed, the flower setting rate will decrease, the flowering period will be delayed, the fruit setting rate will decrease, the fruit will be small and stiff, and the color change will be severely uneven, ultimately leading to a sharp drop in yield and poor quality. The virus is mainly transmitted by whiteflies and has the widest host range among the viruses in this genus. It can infect 49 plant species in 16 families, including important economic crops such as vegetables, fruit trees and flowers.

[0003] In production, diseases caused by TYLCV are mainly controlled by breeding disease-resistant varieties, strengthening seedling testing, taking agricultural and chemical control measures, and transgenic breeding. Among them, breeding disease-resistant varieties has achieved significant control effects, but the TY disease-resistant genes found in wild tomatoes are limited. With the continuous emergence of new TYLCV isolates, compound infections are more frequent, and the disease resistance of many disease-resistant varieties has also been broken. In addition, TYLCV relies on whiteflies for transmission, so using pesticides to eliminate whiteflies is an effective measure to curb the outbreak of tomato leaf curl. However, the large-scale use of pesticides not only causes whiteflies to develop resistance, but also pollutes the environment and affects human health. So scientists began to look for safer and more effective control measures. Genetic engineering breeding is a combination of genetic engineering technology and conventional breeding technology. This technology can be used to transfer viral sequences, miRNAs, siRNAs, etc. into cultivated varieties, and inhibit viral replication and transcription through RNA interference (RNAi); it can also edit the viral genome and host genes involved in viral replication by transferring CRISPR-Cas 9 gene editing vectors. Genetic engineering breeding has a short cycle, is environmentally friendly, and has stable resistance, and has broad application prospects.

[0004] RNAi is a major virus defense mechanism in plants. AGOs protein is crucial in the RNAi antiviral immunity pathway and has antiviral function against a variety of viruses. Previous studies have found that the tomato AGO2a gene can significantly inhibit the accumulation of CMV RNA, thereby improving the plant's antiviral function. However, there have been no reports on the function of the tomato AGO2a gene against DNA viruses and the application of AGO2a in plants to the creation of TYLCV-resistant germplasm materials. Summary of the invention

[0005] The purpose of the present invention is to provide a new use of a tomato antiviral-related gene AGO2a in resistance to tomato yellow leaf curl virus, and to provide a method for improving tomato antiviral resistance, which is effective in improving the resistance of tomatoes to tomato yellow leaf curl virus TYLCV and has application value in the field of tomato cultivation.

[0006] In order to achieve the above object, the present invention provides a tomato antiviral related gene AGO2a, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0007] The tomato antiviral related gene AGO2a provided by the present invention can be used for regulating plant antiviral resistance.

[0008] Preferably, the plant is Micro-Tom tomato; and the virus resistance is resistance to Tomato Yellow Leaf Curl Virus.

[0009] The tomato antivirus-related gene AGO2a provided by the present invention can be used to prepare a transgenic tomato strain with resistance to tomato yellow leaf curl virus.

[0010] The present invention also provides a method for preparing a transgenic tomato strain having resistance to tomato yellow leaf curl virus, comprising the following steps:

[0011] (1) inserting the nucleotide sequence of the gene sequence shown in SEQ ID NO.3 into a vector to obtain an overexpression recombinant plasmid;

[0012] (2) transferring the obtained overexpression recombinant plasmid into Agrobacterium to obtain overexpression Agrobacterium carrying the recombinant plasmid;

[0013] (3) The overexpressing Agrobacterium is transfected into tomatoes to obtain a tomato strain with high expression of tomato antiviral related genes, and a tomato strain with stable high expression of tomato antiviral related genes is obtained by self-pollination, that is, a transgenic tomato strain with resistance to Tomato Yellow Leaf Curl Virus.

[0014] Preferably, the above-mentioned overexpression recombinant plasmid is selected from p1300 plasmid; and the overexpression Agrobacterium is selected from Agrobacterium GV3101.

[0015] The present invention has the following advantages:

[0016] The present invention discloses for the first time the use of tomato AGO2a gene in resistance to tomato yellow leaf curl virus TYLCV.

[0017] The present invention also provides a method for preparing transgenic tomatoes resistant to tomato yellow leaf curl virus TYLCV. An overexpression vector is constructed for a gene fragment with a nucleotide sequence as shown in SEQ ID NO.3, and the vector is transferred into tomatoes through Agrobacterium-mediated transformation. The obtained transgenic tomatoes have high resistance to tomato yellow leaf curl virus TYLCV and have application value in the screening of resistant tomato lines and tomato breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Figure 2 is the expression of AGO2a genomic gene in T1 plants of transgenic lines 1 and 2; A is the schematic diagram of Myc-AGO2a vector construction, Hyg (Hygromycin) is the hygromycin resistance gene, 35Sp is the cauliflower mosaic virus 35S promoter, and E9t is the E9 termination site; B is the electrophoresis result of PCR detection of p1300-Myc-AGO2a recombinant plasmid in transgenic lines 1 and 2; C is the expression of Myc-AGO2a fusion protein in transgenic lines 1 and 2 detected by Western-blot, the fusion protein is about 123kDa in size, and Ponceau is the Rubisco large subunit stained with Ponceau red as a loading control.

[0019] Figure 2 The effect of AGO2a overexpression on tomato growth and development; A shows the growth and development of tomato leaves, flowers, fruits and plants after AGO2a overexpression; B shows the expression of Myc-AGO2a fusion protein in T3 plants of transgenic line 1 and 2 detected by Western-blot, and Ponceau shows the large subunit of Rubisco stained with Ponceau red as a loading control; C shows the expression of AGO2a in transgenic line 1 and line 2 by qRT-PCR analysis, and the error bars represent the standard deviation of three biological replicates, and the asterisks indicate statistically significant differences (*p<0.05, **<0.01).

[0020] Figure 3 The accumulation of TYLCV in susceptible tomatoes after AGO2a was highly expressed; Figure 3A shows the symptoms of Micro-Tom tomatoes of different genotypes 21 days after TYLCV inoculation, where MOCK is the healthy control of Micro-Tom tomatoes treated with infiltration buffer; B shows the expression of Myc-AGO2a fusion protein in plants detected by Western-blot, and Southern-blot analysis of the accumulation of TYLCV in different genotypes of Micro-Tom 21 days after TYLCV inoculation, where Ponceau is the large subunit of Rubisco stained with Ponceau red as the loading control, Total DNA is the DNA loading control, SC is the supercoiled DNA configuration of TYLCV, SS is the single-stranded DNA configuration of TYLCV, loading is the loading control, and the viral DNA content value is the grayscale ratio of poneau and Total DNA respectively; C is the grayscale value analysis result of viral DNA accumulation in tomatoes, the error bars represent the standard deviation of three biological repeated experiments, and the asterisks indicate that the differences are statistically significant (**<0.01, ***<0.001). DETAILED DESCRIPTION

[0021] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] Note: The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0023] Example 1 A method for cultivating TYLCV-resistant AGO2a transgenic tomatoes

[0024] This embodiment provides a method for cultivating transgenic tomatoes resistant to TYLCV, which is as follows:

[0025] (1) Micro-Tom tomato (MT tomato) leaves were sampled and genomic DNA was extracted using the CTAB method;

[0026] (2) Primers AGO2a-F and AGO2a-R were used, and their nucleotide sequences were shown in SEQ ID NO. 1 and 2, respectively. The specific sequences are as follows. PCR amplification was performed using the extracted genomic DNA as a template, and the cloned product was sequenced to obtain a 6395 bp tomato AGO2a genomic gene, and its nucleotide sequence was shown in SEQ ID NO. 3;

[0027] AGO2a-F (SEQ ID NO.1):atggatcgtgggaactaccg;

[0028] AGO2a-R (SEQ ID NO.2):tcagacgaaaaacattacgt;

[0029] (3) The AGO2a genomic gene with a nucleotide sequence as shown in SEQ ID NO. 3 was constructed into a p1300 vector with a Myc tag by homologous recombination to obtain a p1300-Myc-AGO2a recombinant plasmid. The schematic diagram of the construction of the recombinant plasmid is shown in FIG. Figure 1 As shown in A;

[0030] (4) The obtained p1300-Myc-AGO2a recombinant plasmid was transformed into Agrobacterium GV3101 by heat shock method, and the bacterial solution was spread on the resistant medium. The primer pair Myc-colony-F and AGO2a-detect-R for detecting the Myc-AGO2a recombinant gene were designed. The nucleotide sequences of the primers are shown in SEQ ID NOs. 4 and 5, respectively, and were used to screen and obtain monoclonal Agrobacterium carrying the p1300-Myc-AGO2a recombinant plasmid.

[0031] Myc-colony-F(SEQ ID NO.4):gacccttcctctatataagg;

[0032] AGO2a-detect-R(SEQ ID NO.5):cgttgaaccggttggtttac;

[0033] (5) The correct monoclonal Agrobacterium obtained by screening was transferred into YEP liquid medium containing antibiotics and cultured overnight at 28°C and 220 rpm until OD 600 The bacterial solution was centrifuged and the OD was adjusted to 0.6-1.0 using a suspension buffer. 600 Adjusted to 0.6, injected into Nicotiana benthamiana leaves, and collected the injected leaves 36 hours later to extract total protein. The expression of Myc-AGO2a fusion protein was analyzed by Western blot, and the results showed that a specific band of about 123 kDa could be detected in the injected Nicotiana benthamiana, which was consistent with the size of Myc-AGO2a fusion protein, indicating that the p1300-Myc-AGO2a recombinant plasmid could be expressed correctly.

[0034] (6) After the monoclonal Agrobacterium carrying the Myc-AGO2a recombinant plasmid was expanded and the OD 600Adjust to 0.6, resuspend for 3 hours and then use it to infect the cotyledon leaves of the aseptically cultured MT tomato AGO2a gene knockout mutant ago2a-453 (denoted as MT-ago2a-354) (the knockout mutant ago2a-453 is a tomato AGO2a gene mutant constructed by CRISPR-Cas9, for details, refer to the article Zhao L, Chen Y, Xiao X, et al. AGO2a but not AGO2b mediates antiviral defense against infection of wild-type cucumber mosaic virus into mato. Hortic Res. 2023; 10(5): uhad043. Published 2023Mar 13.doi:10.1093 / hr / uhad043), callus tissue was obtained by co-cultivation, budding was induced by differentiation culture, and finally two lines (respectively named MT-ago2a-453-AGO2a-1 and MT-ago2a-453-AGO2a-2) of tissue culture seedlings were obtained by rooting culture and transferred to the greenhouse for further cultivation;

[0035] (7) After the tissue culture seedlings grew stably, the CTAB method was used to extract the DNA of the tissue culture seedlings of the two lines. The Myc-colony-F and AGO2a-detect-R primer pairs were used to perform PCR amplification on the extracted DNA. As a result, bands of about 550 bp were amplified from the tissue culture seedlings of the two lines. The amplified products were sequenced to confirm that the obtained products were the sequences of the Myc-AGO2a recombinant gene. The electrophoresis results are shown in Figure 1 As shown in B, the three lanes represent the amplified products of the templates used. Therefore, it was determined that the p1300-Myc-AGO2a recombinant plasmid was transferred into the tissue culture seedlings of the two lines;

[0036] (8) The total protein of the tissue culture seedlings of the above two lines was extracted and subjected to SDS-PAGE gel electrophoresis. Western-blot detection was performed using Myc antibody to confirm the expression of Myc-AGO2a fusion protein in the tissue culture seedlings. The results of SDS gel electrophoresis were as follows: Figure 1 As shown in C, specific bands of about 123 kDa were detected in the tissue culture seedlings of the two lines, which was consistent with the size of the Myc-AGO2a fusion protein, indicating that the Myc-AGO2a fusion protein was normally expressed in ago2a-453 mutant tomatoes;

[0037] (9) The tissue culture seedlings of the above two lines were further cultured and harvested individually. The segregation ratio of the T2 generation was statistically analyzed, and it was found that both MT-ago2a-453-AGO2a-1 and MT-ago2a-453-AGO2a-2 met the 1:3 segregation ratio. The two lines were kept as seeds, and their growth and development phenotypes of leaves, flowers, and fruits were observed. It was found that the growth and development phenotypes of the T3 generation of MT-ago2a-453-AGO2a-1 and MT-ago2a-453-AGO2a-2 were consistent with the wild type. The results are shown in Figure 2 As shown in A. Four plants were randomly selected from the T3 generation of MT-ago2a-453-AGO2a-1 and MT-ago2a-453-AGO2a-2 (respectively marked as ago2a-453-AGO2a-1-1, 2, 3, 4; ago2a-453-AGO2a-2-1, 2, 3, 4, see Figure 2 Western-blot detection was performed on the samples (shown in B), and a specific band of about 123 kDa was detected. The detection results are shown in Figure 2 As shown in B, @Myc indicates that the Myc-AGO2a fusion protein was obtained by hybridization with the fusion tag protein Myc, which is used to prove that the transferred AGO2a is normally expressed in the transgenic plants. The size of the specific band is consistent with the size of the Myc-AGO2a fusion protein, indicating that the Myc-AGO2a fusion protein is normally expressed in the ago2a-453 mutant tomato; the mRNA expression of AGO2a in the T3 generation plants of these two lines was detected by qRT-PCR, and it was found that the mRNA expression of AGO2a in the two lines increased significantly and was stably expressed. The quantitative results are shown in Figure 2 As shown in C.

[0038] (10) The T3 generation of MT-ago2a-453-AGO2a-2 was inoculated with the virus TYLCV, and its symptoms were observed and the amount of virus accumulation was analyzed by Southern-blot. The results of symptom observation showed that TYLCV caused tomato leaf shrinkage, curling, and severe dwarfing of the plants after infecting the three different genotypes of tomatoes. However, the shrinkage, curling, and dwarfing symptoms of ago2a-453 were more obvious than those of WT and ago2a-453-AGO2a-2 plants, while there was no significant difference in symptoms between WT and ago2a-453-AGO2a-2 plants. The tomato phenotypes were as follows: Figure 3 As shown in A, MOCK is the healthy control of MT tomato treated with buffer. Further analysis of the differences in TYLCV virus accumulation in virus-infected plants was performed. Figure 3As shown in B and C, Repeat 1, 2, and 3 are technical repeats of three tests. It can be seen that the accumulation of viral DNA in ago2a-453 infected with TYLCV is significantly higher than that in WT and ago2a-453-AGO2a-2 plants, while the accumulation in ago2a-453-AGO2a-2 plants is significantly lower than that in WT. The above results show that AGO2a overexpression transgenic plants can significantly inhibit the accumulation of TYLCV virus in plants.

[0039] In summary, the present invention discloses a new use of the tomato AGO2a gene, specifically, the overexpression of the gene can inhibit the accumulation of viral DNA in the plant body and improve the resistance of tomatoes to tomato yellow leaf curl virus. At the same time, the present invention also provides a method for preparing a tomato transgenic strain with resistance to tomato yellow leaf curl virus. The prepared transgenic strain has significant application value in the field of tomato cultivation.

[0040] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

[0041]

[0042]

[0043]

[0044]

Claims

1. Application of tomato antiviral related gene AGO2a in regulating plant antiviral resistance, characterized in that: The nucleotide sequence of AGO2a is shown in SEQ ID NO.

3.

2. The use according to claim 1, characterized in that: The plant is Micro-Tom tomato.

3. The use according to claim 1, characterized in that: The antiviral agent is anti-tomato yellow leaf curl virus.

4. Use of the tomato antiviral related gene AGO2a in preparing a transgenic tomato line with resistance to tomato yellow leaf curl virus, characterized in that: The nucleotide sequence of AGO2a is shown in SEQ ID NO.

3.

5. A method for preparing a transgenic tomato line resistant to Tomato Yellow Leaf Curl Virus, characterized in that: The following steps are included: (1) inserting the nucleotide sequence as shown in SEQ ID NO.3 into a vector to obtain an overexpression recombinant plasmid; (2) transferring the overexpression recombinant plasmid into Agrobacterium to obtain overexpression Agrobacterium carrying the recombinant plasmid; (3) The overexpression Agrobacterium is transfected into tomatoes to obtain a tomato strain with high expression of the tomato antiviral related gene, and the tomato antiviral related gene stably highly expressed strain is obtained by self-pollination, which is the transgenic tomato strain.

6. The preparation method according to claim 5, characterized in that: The overexpression recombinant plasmid is selected from p1300 plasmid.

7. The preparation method according to claim 5, characterized in that: The overexpression Agrobacterium is selected from GV3101.

Images