Application of rice oszos1-18 gene in regulating salt tolerance
By knocking out or overexpressing the rice ZOS1-18 gene using CRISPR-Cas9 technology, the problem of rice's poor salt tolerance in high-salt environments was solved, and the salt tolerance of rice was significantly improved.
Patent Information
- Application Number
- CN202510231435.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-28
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2045-02-28
AI Technical Summary
Rice has poor salt tolerance in high-salt environments, and traditional breeding methods are difficult to effectively improve it. Existing salt-tolerant genes have limited application, and new genetic engineering methods are needed to improve the salt tolerance of rice.
The rice ZOS1-18 gene was knocked out or overexpressed using CRISPR-Cas9 technology, the salt tolerance of rice was increased or decreased using recombinant expression vectors and recombinant bacteria, and gene editing was performed using plant expression vectors and biological methods.
Knocking out the ZOS1-18 gene reduces the salt tolerance of rice, while overexpressing the ZOS1-18 gene increases the salt tolerance of rice, significantly improving the growth performance of rice in high-salt environments.
Smart Images

Figure CN119876264B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of genetic engineering, and particularly relates to a salt-tolerant related gene ZOS1-18 of rice, and a coding protein and application thereof. BACKGROUND
[0002] Soil salinization is one of the important factors restricting the development of world agricultural production, and about 1 billion hectares of land worldwide are affected by salt. Soil salinization not only makes it difficult for crop roots to absorb water, reduces the absorption efficiency of crops to nutrients, but also causes poor soil tillage, reduces beneficial microorganisms in the soil, and seriously affects the growth and development of crops and yield. Generally speaking, when the salt content of soil exceeds 0.1%, the growth of ordinary crop varieties begins to be affected; when the salt content of soil exceeds 0.3%, the yield of most crop varieties decreases significantly. China has more than 500 million mu of various available saline-alkali land resources, ranking third in the world in terms of saline-alkali land distribution. Saline-alkali land is an extremely important reserve arable land resource and "potential granary" in China, and saline-alkali land improvement is of great significance to increase the amount of arable land and improve the quality of arable land. Rice is one of the most important food crops in the world, and provides staple food for nearly half of the population. The water environment during the growth of rice can leach the soluble salt and alkali in the soil, and is the preferred food crop for the development of coastal beaches, but rice has poor salt tolerance, and breeding salt-tolerant rice varieties is an effective way to further increase the planting area and yield of the crop in saline-alkali areas.
[0003] High-salt environment mainly produces two stresses on rice, namely, osmotic stress and ion stress. Osmotic stress makes it difficult for rice roots to absorb water from the outside; and ion stress causes a large amount of Na + accumulation in root cells, which destroys the absorption of K + , Ca 2+ and other ions by the roots, and affects the ion homeostasis in cells. In order to survive under high-salt conditions, rice gradually responds to physiological regulation mechanisms of osmotic stress and ion stress in the long-term evolution process, including osmotic regulation, ion balance regulation, etc. Osmotic regulation capacity is one of the most basic characteristics of rice salt tolerance, and the strength of rice salt tolerance depends largely on the strength of the osmotic regulation capacity of rice cells themselves. Under high-salt stress, rice plants can accumulate a large amount of osmotic regulation substances, including organic osmotic regulation substances such as proline, soluble sugar, fructose, sucrose, polyamine, and inorganic osmotic regulation substances such as Na + , K + , Ca 2+ and Cl -inorganic ions. The accumulation of these hydrophilic osmotic adjustment substances helps to increase the concentration of rice cell sap, reduce the osmotic potential, and improve the cell's water retention or water absorption capacity, so that the cell can perform normal physiological functions, adapt to the high-salt environment outside, and thus improve the salt tolerance of rice. Ion balance regulation is to regulate the relative concentration of inorganic ions inside and outside the cell to regulate the turgor pressure, pH value, and ion content in the cell, so as to maintain the stability of the microenvironment in the cell. Among them, the most important inorganic ions for ion balance regulation are Na + and K + . Rice mainly controls the concentration of Na + and K + by regulating their absorption, transport, efflux, etc. in the plant body. These processes are mainly involved in proteins of multiple families such as high-affinity K + transporters (HKT), non-selective cation channels (NSCCs), Na + / K + antiporters (NHX), high-affinity K + transporters (HAK), etc.
[0004] Rice salt tolerance is a quantitative trait controlled by multiple genes, and more than 100 rice salt tolerance related genes have been cloned so far. The more important salt tolerance genes include SKC1, qSE3, DST, STH1, RST1, etc. SKC1 encodes a HKT family sodium ion transporter HKT 1;5 , which is responsible for the regulation of Na + content in the aboveground part, and can transport excess Na + in the aboveground part to the roots under salt stress, thereby reducing Na + toxicity and improving rice salt tolerance. qSE3 encodes a K + transporter OsHAK21, which promotes K + and Na + uptake during rice seed germination under salt stress.absorption, activating the ABA signaling pathway, thereby improving the salt tolerance of rice seeds during germination. The DST gene encodes a novel transcription factor containing a C2H2-type zinc finger domain, which directly binds to the DBS element in the promoter of reactive oxygen species-related genes, regulates the expression of these genes, affects the accumulation of reactive oxygen species, and thus regulates the opening of the stomata, ultimately affecting the drought and salt tolerance of rice. STH1 encodes an α / β folded domain hydrolase, which is derived from the variant form of African rice. Due to a SNP mutation, its translation is terminated prematurely and the enzyme activity is lost; the introduction of the African rice allele form of the STH1 gene locus not only delays the heading time of rice, but also significantly increases the yield of rice under normal field conditions and salt stress conditions. RST1 encodes the auxin response factor OsARF18, which has transcriptional repression activity and can directly bind to the promoter of the asparagine synthase gene OsAS1 and inhibit its expression; the loss of RST1 function leads to the upregulation of OsAS1 expression, which improves nitrogen utilization efficiency by promoting the synthesis of asparagine and reduces Na + / K + Ratio, reduce NH4 + Excessive accumulation can improve the salt tolerance and yield of plants.
[0005] Due to the complex genetic basis of salt tolerance in rice, improving salt tolerance using traditional breeding methods is challenging. Molecular design breeding techniques can accelerate the development of new salt-tolerant rice varieties. This relies on the identification and functional analysis of key salt-tolerant genes. Although several salt-tolerant genes have been reported, few have been successfully applied in breeding practices. Therefore, further research is needed to identify new salt-tolerant genes in rice to lay the theoretical and material foundation for the development of new salt-tolerant varieties. Summary of the Invention
[0006] In order to overcome the above technical problems existing in the prior art, the present invention provides the genetic engineering application of rice ZOS1-18 in regulating rice salt tolerance.
[0007] Genetic engineering application of rice gene ZOS1-18, or protein encoded by gene ZOS1-18, or recombinant expression vector or expression cassette containing gene ZOS1-18, or recombinant bacteria containing gene ZOS1-18, or knockout vector of gene ZOS1-18, or primers for amplifying gene ZOS1-18 in regulating rice salt tolerance,
[0008] The gene ZOS1-18 is the DNA molecule described in 1) or 2) or 3) below:
[0009] 1) A DNA molecule having a genomic sequence as shown in SEQ ID NO. 1;
[0010] 2) a DNA molecule having a CDS sequence as shown in SEQ ID NO. 2;
[0011] 3) DNA molecules hybridizing with the DNA sequences defined in 1) or 2) under stringent conditions and encoding the proteins.
[0012] Further, knocking out the aforementioned gene ZOS1-18, or reducing the expression amount of the protein encoded by the gene ZOS1-18 in rice, or introducing a knockout vector of the gene ZOS1-18 into rice can improve the salt sensitivity of rice.
[0013] Specifically, the knockout vector of the gene ZOS1-18 is to edit the gene in rice by using CRISPR-Cas9 technology, knock out the aforementioned gene ZOS1-18 in rice plants, and make the gene lose function.
[0014] Further, overexpressing the aforementioned gene ZOS1-18, or introducing a recombinant expression vector, expression cassette containing the gene ZOS1-18 into rice, or introducing a recombinant bacteria containing the gene ZOS1-18 into rice can improve the salt tolerance of rice.
[0015] Overexpressing the aforementioned gene ZOS1-18 is to transform plant cells or tissues by using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated transformation, etc. Conventional biological methods using expression vectors carrying the gene ZOS1-18, and cultivating the transformed plant tissues into plants. Using any one of the vectors that can edit genes in plants, the gene encoding the protein is knocked out, and transgenic cell lines and transgenic plants are obtained.
[0016] Further, the amino acid sequence of the protein encoded by the gene ZOS1-18 is shown in SEQ ID NO. 3.
[0017] Further, the recombinant expression vector, expression cassette containing the gene ZOS1-18 is obtained by inserting the gene ZOS1-18 into a plant expression vector.
[0018] The plant expression vector includes binary Agrobacterium vector and vector that can be used for plant microprojectile bombardment, etc. The plant expression vector can also contain the 3' untranslated region of the exogenous gene, that is, it contains a polyadenylation signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylation signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor, such as the 3' untranslated region of the Agrobacterium crown gall-induced (Ti) plasmid gene (such as the Nos gene of the nopaline synthase), the 3' untranslated region of the plant gene (such as the soybean storage protein gene) has similar functions.
[0019] When the gene construct is used to construct a recombinant plant expression vector, any one of the enhanced promoters or constitutive promoters, such as the Cauliflower Mosaic Virus (CAMV) 35S promoter, the Ubiquitin promoter of maize, can be added before the transcription initiation nucleotide, which can be used alone or in combination with other plant promoters; in addition, when the gene construct of the present application is used to construct a plant expression vector, enhancers, including translation enhancers or transcription enhancers, can also be used, and these enhancer regions can be ATG start codon or adjacent regions start codon, but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The source of the translation control signal and the start codon is wide, which can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene.
[0020] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can express enzymes or luminescent compounds that can produce color changes in plants (GUS genes, luciferase genes, etc.), antibiotic markers with resistance (gentamicin markers, kanamycin markers, etc.) or anti-chemical reagent marker genes (such as herbicide-resistant genes) and the like. For the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened under stress.
[0021] Further, the recombinant expression vector or expression cassette containing the gene ZOS1-18 is obtained by inserting the gene ZOS1-18 into the recombination site of the vector pCAMBIA1301 digested by restriction enzymes Hind III and BstE II.
[0022] Further, the recombinant bacteria containing the gene ZOS1-18 are obtained by transforming the recombinant expression vector or expression cassette into the engineering bacteria.
[0023] Further, the primers for amplifying the gene ZOS1-18 are selected from primer 1 shown in SEQ ID NO. 4, primer 2 shown in SEQ ID NO. 5, or primer 5 shown in SEQ ID NO. 11, primer 6 shown in SEQ ID NO. 12.
[0024] primer 1: 5'-ATGGACAGTGGCTTGGGAA-3' (SEQ ID NO. 4);
[0025] primer 2: 5'-TCAGCTGTCTCCGTTCTG-3' (SEQ ID NO. 5).
[0026] Primer 5: 5'-GCAGTGGCTTCTTTCCAAC-3' (SEQ ID NO. 11);
[0027] Primer 6: 5'-GCCCCTCATGTGCATCCTAA-3' (SEQ ID NO. 12).
[0028] Further, the knockout vector of the gene ZOS1-18 is a CRISPR / Cas9 vector capable of knocking out one or more of the target sequences such as target 1, target 2 and target 3 shown in SEQ ID NO. 6, SEQ ID NO. 7 and SEQ ID NO. 8.
[0029] Beneficial effects:
[0030] The present application first discovers a new plant salt tolerance related protein gene ZOS1-18. The plant salt tolerance related protein of the present application affects the salt tolerance of plants. Introducing the coding gene of the protein into plants can improve the salt tolerance of plants, so that salt-tolerant transgenic plants can be cultivated. Inhibiting the expression of the protein coding gene can lead to a decrease in the salt tolerance of plants, so that salt-sensitive transgenic plants can be cultivated. The protein and its coding gene can be applied to plant genetic improvement. BRIEF DESCRIPTION OF DRAWINGS
[0031] Figure 1 The mutation site of the ZOS1-18 gene and the sequence on both sides thereof in the ZOS1-18 gene mutant (zos1-18-1 and zos1-18-2).
[0032] Figure 2 The expression amount of the ZOS1-18 gene in wild type Nipponbare and ZOS1-18 overexpression lines (ZOS1-18-OE1 and ZOS1-18-OE2).
[0033] Figure 3 The phenotype of wild type Nipponbare and ZOS1-18 gene mutant (zos1-18-1 and zos1-18-2) under salt stress.
[0034] Figure 4 The seedling survival rate of wild type Nipponbare and ZOS1-18 gene mutant (zos1-18-1 and zos1-18-2) under salt stress.
[0035] Figure 5 The phenotype of wild type Nipponbare and ZOS1-18 overexpression lines (ZOS1-18-OE1 and ZOS1-18-OE2) under salt stress.
[0036] Figure 6Survival rate of seedling under salt stress of wild type Nipponbare and ZOS1-18 overexpression lines (ZOS1-18-OE1 and ZOS1-18-OE2). DETAILED DESCRIPTION
[0037] The present application is further explained with the following examples, but the examples do not limit the present application in any form.
[0038] The following examples facilitate better understanding of the present application, but do not limit the present application. In the following examples, the experimental methods are conventional methods, unless otherwise specified. In the following examples, the reagents and kits used are purchased from conventional biological reagent companies, unless otherwise specified.
[0039] Example 1, cloning of coding region sequence (CDS) of rice ZOS1-18 gene
[0040] The following primers are designed:
[0041] primer1: 5'-ATGGACAGTGGCTTGGGAA-3' (SEQ ID NO. 4);
[0042] primer2: 5'-TCAGCTGTCTCCGTTCTG-3' (SEQ ID NO. 5).
[0043] The cDNA of rice variety Nipponbare leaf is used as a template, and the primer pair composed of primer1 and primer2 is used for PCR amplification to obtain the CDS fragment of the target gene ZOS1-18. The PCR reaction system (50 μl) is as follows: template cDNA (50 ng / μl) 2 μl, primer1 (10 uM) 1.5 μl, primer2 (10 uM) 1.5 μl, dNTP Mix (10 mM) 1 μl, 2×Phanta Max Buffer 25 μl, Phanta Max Super-Fidelity DNA Polymerase 1 μl, ddH2O 18 μl. The PCR amplification reaction is performed in a Bio-rad T100 PCR instrument, and the program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 5 min; 4℃ storage.
[0044] The PCR product is recovered and purified by using a DNA purification kit (Nanjing Nova Biological Technology Co., Ltd.), connected to the expression vector pEASY-Blunt (Beijing Quanshi Gold Biotechnology Co., Ltd.), transformed into E. coli DH5α competent cells (Beijing Tiangen Company), and positive clones are selected and sent to Kingsway Biotech Co., Ltd. for sequencing.
[0045] The sequencing results show that the ZOS1-18 gene CDS fragment obtained by PCR amplification has the nucleotide sequence shown in SEQ ID NO. 2, and encodes a protein composed of 522 amino acid residues (SEQ ID NO. 3).
[0046] Example 2, construction and identification of rice ZOS1-18 gene mutant transgenic plants
[0047] I. Construction of ZOS1-18 gene mutant transgenic plants
[0048] The genomic sequence (SEQ ID NO. 1) and CDS sequence (SEQ ID NO. 2) of ZOS1-18 were provided to Wuhan Buryuan Biotechnology Co., Ltd., which designed the target. The specific method is as follows: the genomic sequence (SEQ ID NO. 1) of ZOS1-18 is input into the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the CRISPR-Cas9 sgRNA target is designed by the website, and one or more of the target 1, target 2 and target 3 are selected for gene editing vector construction.
[0049] The sequence of target 1 is: GAAGACTGAACCCCAAAGAGTGG (SEQ ID NO. 6),
[0050] The sequence of target 2 is: TGAGGGTCCCAATCCATTGTAGG (SEQ ID NO. 7),
[0051] The sequence of target 3 is: CTGCTTTGCTTGTGCCTCGCTGG (SEQ ID NO. 8)
[0052] The above three sgRNA units are synthesized into an intermediate vector PUC57 by full gene synthesis. Then, Primer 3 and Primer 4 primers are synthesized, and the PUC57 plasmid with three sgRNAs is used as a template for PCR amplification to obtain double-stranded DNA molecules with sticky ends.
[0053] Primer 3: 5'-CAGTGGTCTCATGCAACCACAACCATCCATAGAGCGTTTTAGAG-3' (SEQ ID NO. 9);
[0054] Primer 4: 5'-CAGTGGTCTCAAAACCCTTGCAAACAAACTGCCGGTGC-3' (SEQ ID NO. 10)
[0055] The double-stranded DNA molecule was connected to the Bsa I cut pHK1-Cas9-U3 linearized vector (which contains in the product "monocotyledon gene editing vector kit (Hyg)" of Wuhan Boyuan Biotechnology Co., Ltd.) by using T4 DNA ligase, and the ligation product was transformed into E. coli DH5a, positive clones were identified by colony PCR, and plasmid was extracted for sequencing. The sequencing results showed that a recombinant vector containing the sequences shown in SEQ ID NO. 6, SEQ ID NO. 7 and SEQ ID NO. 8 was obtained. Then, the Nipponbare callus was transformed by the Agrobacterium-mediated genetic transformation method, thereby obtaining T0 generation transgenic plants.
[0056] II. Molecular identification of ZOS1-18 gene mutant plant
[0057] The leaves of the ZOS1-18 gene mutant T0 generation plants obtained in step one were taken, and the genomic DNA was extracted. The DNA fragments of the editing target point and its two flanking regions shown in SEQ ID NO. 6, SEQ ID NO. 7 and SEQ ID NO. 8 were amplified by PCR using a primer pair composed of Primer 5 and Primer 6 as the template.
[0058] Primer 5: 5'-GCAGTGGCTTCTTTCCAAC-3' (SEQ ID NO. 11);
[0059] Primer 6: 5'-GCCCCTCATGTGCATCCTAA-3' (SEQ ID NO. 12).
[0060] The PCR products were detected by 1% agarose gel electrophoresis and sent to Jin Sui Biological Technology Co., Ltd. for sequencing. According to the sequencing results, two single plants in which the ZOS1-18 gene was mutated were screened and identified, and were named zos1-18-1 and zos1-18-2, respectively. The DNA sequences of the editing target point and its two flanking regions in the two single plants are shown in SEQ ID NO. 13 and SEQ ID NO. 14, respectively. Figure 1
[0061] In the zos1-18-1 single plant, there was one nucleotide insertion and two nucleotide deletions in the exon of the ZOS1-18 gene;
[0062] In the zos1-18-2 single plant, there were two nucleotide deletions and one nucleotide insertion in the exon of the ZOS1-18 gene;
[0063] In the two single plants, the mutations of the ZOS1-18 gene both resulted in frame shift of the protein translation and premature termination.
[0064] Example 3, Construction and identification of transgenic rice plants overexpressing the ZOS1-18 gene
[0065] I. Construction of ZOS1-18 gene overexpression vector
[0066] The cDNA from the leaves of Nipponbare seedlings was used as a template for PCR amplification using a primer pair consisting of primer 7 and primer 8, which included linkers, to obtain the full-length CDS fragment of the ZOS1-18 gene (SEQ ID NO. 2).
[0067] primer 7: 5'-ACCTGCAGGCATGCAAGCTTATGGACAGTGGCTTGGGAA-3' (SEQ ID NO. 13);
[0068] primer 8: 5'-GGAAATTCGAGCTGGTCACCTCAGCTGTCTCCGTTCTG-3' (SEQ ID NO. 14).
[0069] The PCR product was ligated to the expression vector pCAMBIA1301 through Hind III and BstE II double enzyme digestion sites, and transformed into E. coli DH5a competent cells (Beijing Tiangen Company). Positive clones were selected and sent to Kingsway Biotech Co., Ltd. for sequencing.
[0070] The sequencing results showed that the recombinant expression vector containing the sequence shown in SEQ ID NO. 2 was successfully constructed and named pCAMBIA1301-ZOS1-18.
[0071] II. Obtaining of recombinant Agrobacterium
[0072] The pCAMBIA1301-ZOS1-18 was transformed into Agrobacterium tumefaciens EHA105 strain by electroporation to obtain recombinant Agrobacterium. The plasmid was extracted, PCR amplified and enzyme digested, and the recombinant Agrobacterium that passed the identification was named EH-pCAMBIA1301-ZOS1-18.
[0073] III. Obtaining of transgenic rice plants
[0074] The EH-pCAMBIA1301-ZOS1-18 strain was transformed into Nipponbare callus, and the specific method was as follows:
[0075] (1) Induction of rice callus: Take mature seeds of Nipponbare, peel the seed coat, sterilize in 75% ethanol for 2.5 min, then sterilize in 40 mL 2% sodium hypochlorite solution (containing a small amount of Tween 20) for 20 min, and wash with sterile water for more than 3 times, then transfer to sterile filter paper to absorb residual water; evenly spread the sterilized seeds on N6D solid medium, and culture in a 28°C light incubator for 28 d, and replace the medium once in the middle.
[0076] (2) Inoculate the EH-pCAMBIA1301-ZOS1-18 strain into 5 mL YEP liquid medium, and culture overnight at 28°C, 200 rpm; transfer to new 50 mL YEP liquid medium at a ratio of 1:50, and culture at 28°C, 200 rpm until OD 600 = 0.6-0.8; centrifuge at 4°C, 3000g for 10 min to collect the bacteria; resuspend the bacteria in AAM liquid medium (containing 10 mg / L AS) to make OD 600 = 0.05-0.1.
[0077] (3) Mix the callus in step (1) with the bacterial solution in step (2), and infect for 90 s, constantly overturning and mixing; discard the bacterial solution, transfer the callus to sterile filter paper to drain, and then transfer to 2N6-AS solid medium, and culture at 28°C in the dark for 48-60 h.
[0078] (4) Put the callus in step (3) into a 50 ml centrifuge tube, wash with sterile water for more than 6 times, and then soak in sterile water containing 500 mg / L Car for 15 min; discard the sterile water, transfer the callus to sterile filter paper to drain for 1-2 h.
[0079] (5) Transfer the callus in step (4) to N6D-S solid medium containing 50 mg / L hygromycin for screening, and culture in a 28°C light incubator for 28 d, replacing the medium once in the middle.
[0080] (6) Transfer the resistant callus obtained by screening in step (5) to MS-NK solid medium, and culture in a 28°C light incubator for 3-4 weeks; when the adventitious buds grow to 3-4 cm, transfer the callus to MS-HF rooting medium, and culture for 1 week.
[0081] (7) After the seedlings differentiated in step (6) are hardened, they are transferred to the field to grow, and T0 generation of transgenic rice plants is obtained.
[0082] IV. Identification of transgenic rice plants
[0083] 1. PCR molecular identification
[0084] Genomic DNA of the T0 generation of rice transgenic plants obtained in step three was extracted as a template, and a primer pair consisting of primer 9 and primer 10 was used for PCR amplification. The primer sequences are as follows:
[0085] primer 9: 5'-CTTCGTCAACATGGTGGAGCAC-3' (SEQ ID NO. 15);
[0086] primer 10: 5'-GATCATAGGAGCACAAAGTG-3' (SEQ ID NO. 16).
[0087] Among them, primer 9 is located in the pCAMBIA1301 vector sequence, and primer 10 is located in the CDS sequence of the ZOS1-18 gene shown in SEQ ID NO. 2.
[0088] The PCR product was detected by 1% agarose gel electrophoresis, and the positive plants were detected by the target band.
[0089] 2. Detection of ZOS1-18 gene expression
[0090] The positive transgenic T0 generation plants screened by PCR molecular identification in step 1 were self-crossed for two generations to obtain homozygous lines, and the ZOS1-18 gene expression was detected. The roots of three-leaf seedlings were taken, and total RNA was extracted from the tissues by Trizol method, and total RNA was reverse transcribed into cDNA by reverse transcription kit. Rice OsUBQ5 was used as an internal reference gene, and the transcription level of ZOS1-18 gene was detected by Takara TB Premix Ex Taq TM II(Tli RNaseH Plus) kit. The sequences of the ZOS1-18 gene quantitative detection primers (primer 11 and primer 12) and the OsUBQ5 gene quantitative detection primers (primer 13 and primer 14) used are as follows:
[0091] primer 11: 5'-TCAACAGCTGGTTCCTTGCT-3' (SEQ ID NO. 17);
[0092] primer 12: 5'-AGGAATTGTGGCTTCGTCGT-3' (SEQ ID NO. 18).
[0093] primer 13: 5'-ACCACTTCGACCGCCACTACT-3' (SEQ ID NO. 19);
[0094] primer 14: 5'-ACGCCTAAGCCTGCTGGTT-3' (SEQ ID NO. 20).
[0095] The relative expression of ZOS1-18 gene was calculated by the method of 2 -△△CT Figure 2 The results are shown in Table 1, wherein the relative expression of ZOS1-18 gene in the two overexpression lines (ZOS1-18-OE1, ZOS1-18-OE2) is increased by about 40 times.
[0096] Example 4, salt tolerance identification of ZOS1-18 gene mutant and overexpression lines
[0097] The two ZOS1-18 gene TO generation transgenic mutant plants constructed in Example 2 were selfed for two generations to obtain homozygous mutant lines (zos1-18-1 and zos1-18-2). The two homozygous mutant lines and the two homozygous ZOS1-18 gene overexpression lines (ZOS1-18-OE1 and ZOS1-18-OE2) constructed in Example 3 were respectively cultured with Nipponbare wild type seedlings and subjected to salt tolerance identification.
[0098] The specific method for rice seedling culture and salt tolerance identification is as follows:
[0099] 1. The seeds of the broken dormancy rice were soaked at 30°C for 48h, and germinated at 33°C for about 24h until the seeds germinated.
[0100] 2. The germinated seeds were selected and sowed on 96-well PCR plates with the bottom cut off, and placed in a black organic glass culture box for culture in an artificial climate chamber. After 1 week of pure water culture, the seedlings were cultured with Kimura B nutrient solution, and the nutrient solution was replaced every 3 days. The seedling culture conditions were: 14h light (28°C) / 10h darkness (24°C), light intensity 1000 μmol·m -2 ·s -1 -1, relative humidity 70%.
[0101] 3. When the seedlings grew to the two-leaf-one-heart stage, salt stress treatment was performed, and the nutrient solution was replaced with Kimura B nutrient solution containing 120mM NaCl, and the nutrient solution was replaced every 3 days.
[0102] 4. After 5-7 days of NaCl treatment, the seedlings were subjected to rehydration treatment, and the Kimura B nutrient solution without NaCl was used for culture, and the survival rate of the seedlings was counted after 5 days. Survival rate = number of surviving seedlings / total number of treated seedlings x 100%.
[0103] The results of salt tolerance identification of ZOS1-18 gene mutant lines are shown in Table 2.Figure 3 and Figure 4 The results show that, compared with the wild type (WT) of Nipponbare, the two ZOS1-18 gene mutant lines exhibit more serious leaf wilting, death and other salt damage symptoms under salt stress Figure 3 , and the survival rate of seedlings after rehydration is significantly lower than that of the wild type Figure 4 .
[0104] The salt tolerance identification results of the ZOS1-18 gene overexpression lines are shown in Figure 5 and Figure 6 The results show that, compared with the wild type (WT) of Nipponbare, the two ZOS1-18 gene overexpression lines exhibit lighter leaf wilting, death and other salt damage symptoms under salt stress Figure 5 , and the survival rate of seedlings after rehydration is significantly higher than that of the wild type Figure 6 .
[0105] The above experimental results show that the ZOS1-18 gene has a function of positively regulating the salt tolerance of rice seedlings, and knocking out the gene can lead to a decrease in the salt tolerance of rice, and overexpression of the gene can increase the salt tolerance of rice.
[0106] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. Use of rice gene ZOS1-18 or a protein encoded by gene ZOS1-18 in regulating salt tolerance of rice, characterized in that: The amino acid sequence of the protein encoded by the gene ZOS1-18 is shown in SEQ ID NO.
3.
2. The use according to claim 1, characterized in that Knockout of the gene ZOS1-18 described in claim 1, or reducing the expression of the protein encoded by the gene ZOS1-18 in rice, or introducing a knockout vector of the gene ZOS1-18 into rice to improve the salt sensitivity of rice.
3. The use according to claim 1, characterized in that Overexpression of the gene ZOS1-18 described in claim 1, or transfer of a recombinant expression vector or expression cassette containing the gene ZOS1-18 into rice, or transfer of a recombinant bacterium containing the gene ZOS1-18 into rice improves the salt tolerance of rice.
4. The use according to claim 1, characterized in that The gene ZOS1-18 is a DNA molecule shown in 1) or 2) below: 1) A DNA molecule having a genomic sequence as shown in SEQ ID NO. 1; 2) A DNA molecule whose CDS sequence is shown in SEQ ID NO.
2.
5. The use according to claim 3, characterized in that The recombinant expression vector and expression cassette containing the gene ZOS1-18 are obtained by inserting the gene ZOS1-18 into a plant expression vector.
6. The use according to claim 5, characterized in that The recombinant expression vector and expression cassette containing the gene ZOS1-18 are obtained by inserting the gene ZOS1-18 into the recombination site of the vector pCAMBIA1301 through double digestion with restriction endonucleases HindIII and BstEII.
7. The use according to claim 3, characterized in that The recombinant bacteria containing gene ZOS1-18 are obtained by transferring the recombinant expression vector or expression cassette into engineering bacteria.
8. The use according to claim 1, characterized in that The amplification primers for the gene ZOS1-18 are selected from primer 1 shown in SEQ ID NO. 4, primer 2 shown in SEQ ID NO. 5, or primer 5 shown in SEQ ID NO. 11, primer 6 shown in SEQ ID NO.
12.
9. The use according to claim 2, characterized in that The knockout vector of the gene ZOS1-18 is a CRISPR / Cas9 vector that knocks out one or more of target 1, target 2, and target 3 as shown in SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8.
Citation Information
Patent Citations
Paddy rice zinc finger protein gene and stress tolerance genetic engineering applications thereof
CN101182520A
Application of rice ZOS2-02 gene in regulation and control of salt tolerance
CN119410660A