Application of reducing SlASR3 gene expression in tomato character optimization

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to application of reduction of SlASR3 gene expression in tomato character optimization. The technical problem to be solved by the invention is to provide more technical means for improving and promoting the characters of tomatoes. According to the technical scheme, the invention relates to application of a substance for reducing SlASR3 gene expression in increasing plant epidermal hair, avoiding of plants to tetranychus urticae mites or improving cold injury stress resistance of plant fruits. The tomato SlASR3 knockout gene editing strain is obtained through a gene editing technology, the number of VI-type epidermal hairs of leaves of the tomato SlASR3 knockout gene editing strain is greatly increased, and the resistance of tomato plants to tetranychus urticae is enhanced; meanwhile, the tolerance of tomato fruits to cold damage is also greatly improved.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular biology, and particularly relates to the application of reducing S1ASR3 gene expression in optimizing tomato traits. Background Art

[0002] Tomato (Solanum lycopersicum L.) is an annual herbaceous plant of the genus Solanum (Solanum L.), one of the most important fruits and vegetables in the world, and is cultivated in both northern and southern China. Tomato is a nutritious economic crop, rich in carotene, vitamin C and B vitamins, with high nutritional value. It can be used as both a vegetable and a fruit, and can be eaten raw or cooked; tomatoes can be used to make tomato sauce, tomato juice and diced tomatoes; tomatoes are rich in lycopene, have strong antioxidant capacity, can lower blood pressure, clear away heat and detoxify, and can also be extracted as a health product.

[0003] Low temperature is one of the important abiotic stresses faced by plants, which has a negative impact on plant growth, development, yield and quality, and also limits the geographical distribution of many wild plants. Under low temperature stress conditions, plants will gradually change from the molecular level to the cell, tissue, and overall phenotype. Since tomatoes are cold-sensitive crops, during low-temperature transportation and storage after harvest, they often suffer from problems such as flavor loss, texture deterioration, and decreased nutritional content due to cold stress, which seriously affects the commercial value and edible quality of tomato fruits. Therefore, how to improve the resistance of tomato fruits to cold damage and extend their shelf life has become a hot issue in agricultural and food science research.

[0004] In order to extend the shelf life of tomato fruits and maintain their quality, low-temperature transportation and storage methods are usually adopted. However, tomato fruits are extremely sensitive to low temperatures and are easily subject to chilling damage. This late physiological disorder can cause a variety of negative effects, such as fruit depression, maturity disorders, ion leakage, and an increase in rot. At present, it is difficult for existing technologies to balance the effects of post-harvest low-temperature storage of tomato fruits and low-temperature chilling damage during storage on the physiological quality of the fruit. Therefore, in-depth research on the response mechanism of tomato fruits to chilling damage, the creation of high-quality germplasm resources through modern gene editing technology, and the cultivation of cold-resistant varieties combined with traditional breeding methods will help optimize the post-harvest low-temperature storage strategy for tomato fruits.

[0005] The two-spotted spider mite (Tetranychus urticae Koch), also known as the two-spotted spider mite, leaf rust mite, cotton red spider or common spider mite, is a pest that seriously harms crops. This pest is common in East China, Southwest China and other regions, and causes damage to a variety of crops, including but not limited to strawberries, eggplants, cucumbers, tomatoes, peppers, cowpeas, kidney beans, watermelons, cucumbers, peaches, geraniums, poinsettias and more than 800 plant species from more than 50 families. Due to its large-scale reproduction and feeding damage, the two-spotted spider mite will cause crop yield reduction, quality decline, and even cause the death of some crops, causing serious economic losses to farmers.

[0006] At present, the control methods for plant mites mainly include chemical control, biological control and physical control. Chemical miticides are one of the most widely used methods, but the large-scale use of chemical pesticides will not only pollute the environment and destroy the ecological balance in the field, but also affect the safety of agricultural products. Therefore, more and more people are beginning to favor biological control. Through modern gene editing technology, high-quality germplasm resources are created, and new mite-resistant varieties are cultivated in combination with traditional breeding methods to achieve the control of plant mites. In the biological control strategy, the use of some natural enemies such as ladybugs and predatory mites has been proven to have a certain control effect on two-spotted spider mites, but there are some limitations, such as insufficient number of natural enemies and great environmental influences. Summary of the invention

[0007] The technical problem to be solved by the present invention is to provide more technical means for improving and enhancing the traits of tomatoes, a plant of the genus Solanum.

[0008] The technical solution of the present invention to solve the above technical problem is to provide the use of a substance that reduces the expression of the SlASR3 gene in optimizing tomato traits.

[0009] Specifically, the optimized tomato traits are at least one of increasing the number of tomato epidermal hairs, enhancing the tomato's avoidance of two-spotted spider mites, or improving the tomato's resistance to chilling stress.

[0010] Specifically, the substance that reduces the expression of the S1ASR3 gene is sgRNA, gRNA, siRNA or miRNA designed for the S1ASR3 gene.

[0011] Furthermore, the nucleotide sequence of the gRNA is shown in SEQ ID No.1 and / or SEQ ID No.2.

[0012] Particularly, the epidermal hairs are epidermal hairs of tomato leaves.

[0013] Wherein, the application in improving the resistance of tomatoes to chilling stress is the application in improving the resistance of tomato fruits to chilling stress.

[0014] The present invention also provides an expression framework, vector or host cell for expressing sgRNA, gRNA, siRNA or miRNA designed for the S1ASR3 gene.

[0015] Furthermore, the nucleotide sequence of the gRNA is shown in SEQ ID No.1 and / or SEQ ID No.2.

[0016] The present invention also provides a method for increasing tomato epidermal hairs, which is achieved by reducing the expression of S1ASR3 gene in tomatoes.

[0017] Specifically, the method of reducing the expression of the S1ASR3 gene in tomatoes is to knock out the S1ASR3 gene or interfere with the expression of the S1ASR3 gene.

[0018] Particularly, knocking out the SlASR3 gene is at least one of genome editing, homologous recombination or random insertion mutagenesis.

[0019] Furthermore, the genome editing method includes at least one of a meganuclease method, a ZFN method, a TALEN method or a CRISPR-Cas method.

[0020] Wherein, the CRISPR-Cas method comprises the following steps:

[0021] a. Design sgRNA or gRNA targeting SlASR3 gene;

[0022] b. Construct a Cas editing expression vector expressing sgRNA or gRNA;

[0023] c. Transform tomatoes with the Cas editing expression vector.

[0024] Furthermore, the CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b.

[0025] Wherein, the nucleotide sequence of the gRNA described in step a is shown as SEQ ID No.1 and / or SEQ ID No.2.

[0026] Wherein, the expression vector described in step b is BG-Plant-Fastcas9.

[0027] Specifically, in step c, the transformation is carried out using an Agrobacterium-mediated transformation method.

[0028] Particularly, the epidermal hairs are epidermal hairs of tomato leaves.

[0029] The present invention also provides a method for improving the ability of tomatoes to avoid two-spotted spider mites, which is achieved by reducing the expression of the SlASR3 gene in tomatoes.

[0030] Specifically, the method of reducing the expression of the S1ASR3 gene in tomatoes is to knock out the S1ASR3 gene or interfere with the expression of the S1ASR3 gene.

[0031] Particularly, knocking out the SlASR3 gene is at least one of genome editing, homologous recombination or random insertion mutagenesis.

[0032] Furthermore, the genome editing method includes at least one of a meganuclease method, a ZFN method, a TALEN method or a CRISPR-Cas method.

[0033] Wherein, the CRISPR-Cas method comprises the following steps:

[0034] a. Design sgRNA or gRNA targeting SlASR3 gene;

[0035] b. Construct a Cas editing expression vector expressing sgRNA or gRNA;

[0036] c. Transform tomatoes with the Cas editing expression vector.

[0037] Furthermore, the CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b.

[0038] Wherein, the nucleotide sequence of the gRNA described in step a is shown as SEQ ID No.1 and / or SEQ ID No.2.

[0039] Wherein, the expression vector described in step b is BG-Plant-Fastcas9.

[0040] Specifically, in step c, the transformation is carried out using an Agrobacterium-mediated transformation method.

[0041] The present invention also provides a method for improving the tolerance of tomatoes to cold damage stress, which is achieved by reducing the expression of S1ASR3 gene in tomatoes.

[0042] Specifically, the method of reducing the expression of the S1ASR3 gene in tomatoes is to knock out the S1ASR3 gene or interfere with the expression of the S1ASR3 gene.

[0043] Particularly, knocking out the SlASR3 gene is at least one of genome editing, homologous recombination or random insertion mutagenesis.

[0044] Furthermore, the genome editing method includes at least one of a meganuclease method, a ZFN method, a TALEN method or a CRISPR-Cas method.

[0045] Wherein, the CRISPR-Cas method comprises the following steps:

[0046] a. Design sgRNA or gRNA targeting SlASR3 gene;

[0047] b. Construct a Cas editing expression vector expressing sgRNA or gRNA;

[0048] c. Transform tomatoes with the Cas editing expression vector.

[0049] Furthermore, the CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b.

[0050] Wherein, the nucleotide sequence of the gRNA described in step a is shown as SEQ ID No.1 and / or SEQ ID No.2.

[0051] Wherein, the expression vector described in step b is BG-Plant-Fastcas9.

[0052] Specifically, in step c, the transformation is carried out using an Agrobacterium-mediated transformation method.

[0053] Beneficial effects of the present invention:

[0054] The present invention provides a new and effective means for improving and enhancing the traits of tomatoes, a plant of the Solanum genus. Reducing the expression of the SlASR3 gene can improve various traits of tomatoes. In the example cited in the present invention, a gene-edited strain of tomato SlASR3 knocked out was obtained by gene editing technology, and the number of type VI epidermal hairs on its leaves was greatly increased. Further studies have found that tomato type VI epidermal hairs can secrete terpenoids with insect-resistant effects, which enhance the resistance of tomato plants to two-spotted spider mites from a physical and chemical level; it can reduce the use of chemical pesticides, has fewer environmental limitations, reduces agriculture's dependence on fossil energy, and promotes the sustainable development of agriculture. In addition, the gene-edited tomato strain with SlASR3 knocked out has enhanced cold resistance in its fruits, and its physiological quality changes little during low-temperature storage, which greatly reduces the damage caused to tomato fruits by low-temperature storage. It can be seen that the tomato SlASR3 gene plays a critical role in the process of plant resistance to biological and abiotic stresses. The application method of the present invention in optimizing tomato traits can improve the resistance of plants to two-spotted spider mites and can also improve the cold resistance of plant fruits. SlASR3 gene-edited plants are obtained through modern gene editing technology, which lays the foundation for further breeding of germplasm resources with insect resistance and cold damage resistance, and has important production significance for insect-resistant breeding of tomatoes and cold-resistant breeding of tomato fruits. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 , the editing method of SlASR3 gene editing strain.

[0056] Figure 2 Scanning electron microscopy images of leaf epidermal hairs of wild type and SlASR3 gene-edited strains, as well as statistics on the number of epidermal hairs.

[0057] Figure 3 , wild type and SlASR3 gene-edited strains of two-spotted spider mites selection experiments and egg-laying experiments.

[0058] Figure 4 Chilling injury symptoms of tomato fruits after cold treatment in wild type, SlASR3 overexpressing and gene-edited plants.

[0059] Figure 5 Carotenoid content, MDA content, and SOD, POD, and CAT enzyme activities in tomato fruits of wild-type, SlASR3 overexpressing, and gene-edited plants after cold treatment. DETAILED DESCRIPTION

[0060] The present invention screened out SlASR3 from RNA-seq data, which has a plant-specific MYB / SANT-like DNA binding domain and a three-helix bundle, and is inferred to belong to the MYB-like transcription factor family. MYB transcription factors are one of the largest transcription factor families in plants, and their core structure is the MYB domain, which consists of 1 to 3 tandemly repeated DNA binding domains (R domains), each of which contains about 52 amino acids.

[0061] In order to study the function of the gene, the present invention constructed a knockout vector and an overexpression vector of the SlASR3 gene, and transformed tomatoes to obtain knockout plants and overexpression plants, respectively. The knockout plants and overexpression plants were further tested for various indicators, such as the number of epidermis. The knockout strain had a lot more epidermal hairs on its leaves. Considering that the tomato type VI epidermal hairs can secrete some terpenoid substances with insect-resistant effects, the insect-resistant ability of the plants was tested, and the results showed that the gene knockout plants showed better avoidance to two-spotted spider mites.

[0062] Furthermore, the inventors studied the role of this gene in other resistance aspects. The experiment showed that after knocking out the SlASR3 gene, the tolerance of the plant to cold damage was improved, especially the tomato fruit showed better cold resistance.

[0063] It can be seen that the present invention has obtained an excellent tomato variety that is resistant to insects and cold damage through gene editing.

[0064] The present invention found that knocking out the tomato SlASR3 gene not only improves the plant's resistance to two-spotted spider mites, but also improves the cold resistance of tomato fruits. Therefore, the tomato SlASR3 gene plays a critical role in the resistance of tomato plants to biotic and abiotic stresses. Obtaining SlASR3 gene-edited plants through modern gene editing technology has important production significance for insect-resistant breeding of tomato plants and cold-resistant breeding of tomato fruits. The tomatoes (Solanum lycopersicum) and two-spotted spider mites (Tetranychus cinnabarinus) used in the following examples are from the School of Life Sciences of Chongqing University.

[0065] Example 1 Vector construction and transformation

[0066] 1. Construction of SlASR3 gene-edited plant vector and detection of editing methods

[0067] The CRISPR-P online tool (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) was used to screen two gene editing targets of SlASR3 (https: / / solgenomics.net / search / locus, Solyc02g069390), and two gRNAs were designed according to the targets (see Figure 1 , SEQ ID No.1 and SEQ ID No.2). The corresponding double-stranded DNA of the two gRNAs was synthesized by PCR, and cloned into the BG-Plant-Fastcas9 (constructed by Chongqing Baoguang Company) binary vector by Golden Gate Assembly, and the sequence is shown in SEQ ID No.3. The vector was transformed into the Agrobacterium tumefaciens strain GV3101, and the Micro Tom tomato was transformed by Agrobacterium-mediated transformation. Tomato transgenic seedlings were obtained, the genome of the T0 generation tissue culture seedlings was extracted, and primers containing both ends of the knockout target were designed for PCR amplification. After sequencing, the amplified products were compared with the wild-type tomato genome to determine the gene editing method, and then the homozygous non-transgenic knockout strains were further screened in the T1 and T2 generations. Finally, the strains Slasr3#2, Slasr3#5, Slasr3#6, Slasr3#7, and Slasr3#8 were screened.

[0068] gRNA1 (SEQ ID No. 1): GAGTAGTAGTAACATGTTTA;

[0069] gRNA2 (SEQ ID No. 2): AACAGAGTTAAGATGGAAAT.

[0070] SEQ ID No.3 Sequence fragment containing sgRNA targeting two targets and its backbone sequence

[0071] 。

[0072] 2. Construction and transformation of overexpression vector

[0073] First, an overexpression vector was constructed, and the coding sequence of SlASR3 was connected to the binary vector pLP100 containing the cauliflower mosaic virus (CaMV) 35S promoter to construct an overexpression vector. Then, tomato explants were infected by Agrobacterium-mediated genetic transformation, and transgenic strains were obtained by plant tissue culture technology. Finally, the SlASR3 gene expression was analyzed by RT-qPCR to obtain overexpression transgenic strains SlASR3-OE#3, SlASR3-OE#5, and SlASR3-OE#8.

[0074] 3. Construction and transformation of RNAi vector

[0075] The RNAi vector was constructed, and the RNAi interference fragment sequence of SlASR3 was connected to the pJE042 vector to construct the RNAi vector. Then, the tomato explants were infected by Agrobacterium-mediated genetic transformation, and the transgenic lines were obtained by plant tissue culture technology. Finally, the SlASR3 gene expression was analyzed by RT-qPCR to obtain the RNAi transgenic lines SlASR3-RNAi#1 and SlASR3-RNAi#2.

[0076] Example 2 Observation and Quantity Statistics of Epidermal Hairs in S1ASR3 Gene Edited Plants

[0077] Cut 2cm each 2 The leaves of the wild type and two SlASR3 gene-edited lines were observed and counted using a scanning electron microscope. Figure 2 As shown in Figure 3, the number of epidermal hairs in tomato leaves increased significantly after SlASR3 gene knockout.

[0078] Example 3: Selectivity and oviposition experiment of S1ASR3 gene-edited plants against two-spotted spider mites

[0079] Prepare two clean plastic petri dishes (90 mm in diameter) and a 10 cm long plastic straw. Make a small hole with a diameter of 1 to 2 mm in the middle of the straw and connect the straw to the two petri dishes. Put a piece of cotton pad and two filter papers in each petri dish in turn, and lightly spray a small amount of water. Put two healthy tomato leaves and two leaves of gene-edited plants in the two petri dishes respectively. Then, put 20 two-spotted spider mites into the middle hole connected to the straw. Wait for 10 minutes and count the number of two-spotted spider mites in each petri dish.

[0080] Select healthy, pest-free tomato leaves and leaves of gene-edited plants and place them on filter paper in a petri dish. Place 10 adult female two-spotted spider mites on each leaf. Cover tightly and seal with sealing film, then place in a plant incubator for 3 days. After the incubation, use a microscope to observe and count the number of eggs laid by two-spotted spider mites on the tomato leaves in each petri dish.

[0081] The results show that Figure 3 ) The gene-edited strain of tomato SlASR3 has a significant repellent effect on the two-spotted spider mite, affecting its host selection and inhibiting its egg laying.

[0082] Example 4 Experiment on low temperature storage of fruits of S1ASR3 gene-edited plants at the color-breaking stage

[0083] The fruits of the wild type, SlASR3 overexpressing transgenic line and gene-edited line at the color-breaking stage were treated at room temperature (25°C) for 28 days or cold treated (4°C) for 14 days and then treated at room temperature for 14 days to observe the fruit phenotype.

[0084] Experimental results ( Figure 4 ) showed that the gene-edited strain of tomato SlASR3 had the smallest change in physiological phenotype after cold treatment and had the strongest tolerance to cold damage.

[0085] Example 5 Determination of carotenoid content, MDA content, and SOD, POD, and CAT enzyme activities in fruits of S1ASR3 gene-edited plants after cold treatment

[0086] The fruits of wild-type, SlASR3 overexpression plants and gene-edited plants were subjected to low temperature treatment as follows: the fruits at the color-breaking stage were treated at room temperature (25°C) for 28 days and cold treatment (4°C) for 14 days, and then treated at room temperature for 14 days, and then the physiological indicators of chilling injury were measured; including carotenoid content, MDA content, SOD enzyme, POD enzyme, and CAT enzyme activity. Malondialdehyde (MDA) content kit (Cat. No.: G0109W microplate method 96 samples), catalase (CAT) kit (Cat. No.: G0105W microplate method 96 samples), peroxidase (POD) kit (Cat. No.: G0107W microplate method 96 samples) and superoxide dismutase (SOD)-WST-8 activity assay kit (Cat. No.: G0101W microplate method 96 samples) were purchased from Suzhou Grace Biotechnology Co., Ltd.

[0087] The carotenoids determination method is as follows:

[0088] (1) Take out the sample (select appropriate sample) stored in the -80°C freezer and put it into liquid nitrogen. Precool the mortar with liquid nitrogen, grind the fruit into powder, put the centrifuge tube on the scale to remove the skin, cut the Pasteur tube, and put 50 mg (0.05 g) of the fruit powder into a 2 mL centrifuge tube after passing through liquid nitrogen.

[0089] (2) Add 1.5 mL of the extract to the centrifuge tube (you can even add it on a scale to see if the final amount is 1.26 g), gently invert it upside down to mix, place it on ice, and repeat 4 times;

[0090] (3) Wrap the sample and the centrifuge tube rack with sealing film. During the extraction, shake the centrifuge tube frequently to ensure full contact between the extract and the fruit powder. Extract in a refrigerator at 4°C for 36 h.

[0091] (4) Extract for 36 hours until the solution turns yellow and the fruit sample turns white. During the extraction process, a low temperature and dark environment must be maintained to avoid degradation of carotenoids;

[0092] (5) Centrifuge at 3,000 rpm for 1 min at 4°C to obtain the supernatant;

[0093] (6) Keep the sample away from light and on ice. Preheat the spectrophotometer in advance. Pipette the supernatant from the centrifuge tube into a glass cuvette. Use an extract containing anhydrous ethanol and acetone in a volume ratio of 1:1 as a control. Then measure the absorbance of the fruit sample at wavelengths of OD 663nm, OD 645nm, and OD 470nm (measure 3 OD values ​​for each sample).

[0094] Experimental results ( Figure 5 ) showed that the SlASR3 gene-edited strain of tomato produced the lowest content of malondialdehyde (MDA), a chilling product, after cold treatment; the enzyme activities of SOD, POD, and CAT were significantly increased to cope with the reactive oxygen damage caused by chilling. Therefore, compared with the wild-type and SlASR3 overexpressing plants, the fruit of the SlASR3 gene-edited plants has the strongest tolerance to chilling damage, because the reactive oxygen damage caused by chilling damage has the least effect on the fruit of the SlASR3 gene-edited plants.

Claims

1. Application of substances that reduce SlASR3 gene expression in optimizing tomato traits.

2. The application according to claim 1, characterized in that: The optimized tomato traits are at least one of increasing the number of tomato epidermal hairs, enhancing the tomato's avoidance of two-spotted spider mites, or improving the tomato's resistance to cold damage stress.

3. The application according to claim 1, characterized in that: The substance that reduces the expression of the SlASR3 gene is a sgRNA, gRNA, siRNA or miRNA designed for the SlASR3 gene; Preferably, the nucleotide sequence of the gRNA is shown as SEQ ID No.1 and / or SEQ ID No.

2.

4. The application according to claim 1, characterized in that: The epidermal hairs are the number of epidermal hairs on tomato leaves.

5. The application according to claim 1, characterized in that: The application in improving the resistance of tomatoes to chilling stress is the application in improving the resistance of tomato fruits to chilling stress.

6. A method for optimizing the application of tomato traits, characterized in that: This was achieved by reducing the expression of the SlASR3 gene in tomatoes; Preferably, the optimized tomato traits are at least one of increasing tomato epidermal hairs, enhancing the ability of tomatoes to avoid two-spotted spider mites, or improving the tolerance of tomatoes to chilling stress.

7. The method according to claim 6, characterized in that: The way to reduce the expression of SlASR3 gene in tomatoes is to knock out the SlASR3 gene or interfere with the expression of SlASR3 gene.

8. The method according to claim 7, characterized in that: Knocking out the SlASR3 gene is at least one of genome editing, homologous recombination, or random insertion mutagenesis; Preferably, the genome editing method comprises at least one of a meganuclease method, a ZFN method, a TALEN method or a CRISPR-Cas method.

9. The method according to claim 8, characterized in that: The CRISPR-Cas method comprises the following steps: a. Design sgRNA or gRNA targeting SlASR3 gene; b. Construct a Cas editing expression vector expressing sgRNA or gRNA; c. Transform tomatoes with the Cas editing expression vector.

10. The method according to claim 11, characterized in that: The CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b; Preferably, the nucleotide sequence of the gRNA in step a is shown as SEQ ID No.1 or / and SEQ ID No.2; Preferably, the expression vector in step b is BG-Plant-Fastcas9; Preferably, in step c, the transformation is carried out using an Agrobacterium-mediated transformation method.

Images