Use of reduced expression of slasr3 gene in optimizing tomato traits

Abstract

The application belongs to the technical field of molecular biology, and particularly relates to application of reducing SlASR3 gene expression in optimization of tomato traits. The technical problem to be solved by the application is to provide more technical means for improvement and promotion of tomato traits. The technical scheme of the application is application of a substance for reducing SlASR3 gene expression in increasing plant cuticular hair, plant avoidance to Tetranychus urticae Koch or improvement of plant fruit resistance to cold damage stress. The application obtains a gene editing strain of knocking out tomato SlASR3 through gene editing technology, the number of VI type cuticular hair of the leaf of the strain is greatly increased, and the resistance of the tomato plant to Tetranychus urticae Koch is enhanced; meanwhile, the tolerance of the tomato fruit to cold damage is greatly improved.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology technology, specifically involving the application of reducing SlASR3 gene expression in optimizing tomato traits. Background Technology

[0002] Tomato (Solanum lycopersicum L.) is an annual herbaceous plant belonging to the genus Solanum L. It is one of the world's most important fruits and vegetables, cultivated throughout both northern and southern China. Tomatoes are a nutritious economic crop, rich in carotene, vitamin C, and B vitamins. They are highly nutritious and can be eaten as both a vegetable and a fruit, raw or cooked. Tomatoes can be processed into tomato sauce, tomato juice, and diced tomatoes. Rich in lycopene, tomatoes have strong antioxidant capabilities, can lower blood pressure, and have detoxifying effects; they can also be extracted for use in health supplements.

[0003] Low temperature is one of the most significant abiotic stresses facing plants, negatively impacting their growth, development, yield, and quality, while also limiting the geographical distribution of many wild plants. Under low temperature stress, plants undergo gradual changes from the molecular level down to the cellular and tissue levels, and finally to their overall phenotype. Because tomatoes are a cold-sensitive crop, post-harvest low-temperature transportation and storage often result in chilling injury, leading to flavor loss, deterioration in texture, and a decline in nutritional content, severely affecting the commercial value and edible quality of tomato fruit. Therefore, improving the chilling injury resistance of tomato fruit and extending its shelf life has become a hot topic in agricultural and food science research.

[0004] To extend the shelf life and maintain the quality of tomato fruits, low-temperature transportation and storage are commonly employed. However, tomato fruits are extremely sensitive to low temperatures and are susceptible to chilling injury. This late-stage physiological disorder can trigger various negative effects, such as fruit depression, impaired ripening, ion leakage, and increased rot. Currently, existing technologies struggle to balance the impact of post-harvest low-temperature storage and chilling injury during storage on the physiological quality of tomato fruits. Therefore, in-depth research into the response mechanisms of tomato fruits to chilling injury, the creation of high-quality germplasm resources through modern gene editing technology, and the cultivation of chill-resistant varieties using traditional breeding methods will contribute to optimizing post-harvest low-temperature storage strategies for tomato fruits.

[0005] The two-spotted spider mite (Tetranychus urticae Koch), also known as the two-spotted spider mite, leaf rust mite, cotton red spider mite, or common spider mite, is a serious pest that damages crops. It is widespread in East and Southwest China, harming a variety of crops, including but not limited to strawberries, eggplants, cucumbers, tomatoes, peppers, cowpeas, kidney beans, watermelons, peaches, geraniums, poinsettias, and over 800 species of plants from more than 50 families. Due to its large-scale reproduction and feeding, the two-spotted spider mite can lead to reduced crop yields, decreased quality, and even the death of some crops, causing significant economic losses to farmers.

[0006] Currently, the main methods for controlling plant mites include chemical control, biological control, and physical control. Chemical acaricides are one of the most widely used methods, but the large-scale use of chemical pesticides not only pollutes the environment and disrupts the ecological balance in fields, but also affects the safety of agricultural products. Therefore, more and more people are beginning to favor biological control. This involves creating high-quality germplasm resources through modern gene editing technology and combining them with traditional breeding methods to cultivate new mite-resistant varieties to control plant mites. In biological control strategies, the use of natural enemies such as ladybugs and predatory mites has been proven to have a certain control effect on two-spotted spider mites, but it has some limitations, such as insufficient numbers of natural enemies and significant susceptibility to environmental influences. Summary of the Invention

[0007] The technical problem to be solved by this invention is to provide more technical means for the improvement and enhancement of the traits of tomato, a plant in the Solanaceae family.

[0008] The technical solution of this invention to solve the above-mentioned technical problems is to provide the application of a substance that reduces the expression of the SlASR3 gene in optimizing tomato traits.

[0009] Specifically, the optimized tomato traits include at least one of increasing the number of hairs on the tomato skin, enhancing the tomato's repellency to two-spotted spider mites, or improving the tomato's resistance to cold stress.

[0010] Specifically, substances that reduce SlASR3 gene expression are sgRNA, gRNA, siRNA, or miRNA designed specifically for the SlASR3 gene.

[0011] Furthermore, the nucleotide sequence of the gRNA is shown in SEQ ID No. 1 and / or SEQ ID No. 2.

[0012] Specifically, the epidermal hairs are those of tomato leaves.

[0013] The application mentioned here refers to the application of improving the resistance of tomatoes to cold stress.

[0014] This invention also provides expression frameworks, vectors, or host cells for expressing sgRNA, gRNA, siRNA, or miRNA designed to target the SlASR3 gene.

[0015] Furthermore, the nucleotide sequence of the gRNA is shown in SEQ ID No. 1 and / or SEQ ID No. 2.

[0016] This invention also provides a method for increasing the hairs on the tomato skin, achieved by reducing the expression of the SlASR3 gene in tomatoes.

[0017] Specifically, the method for reducing SlASR3 gene expression in tomatoes is to knock out the SlASR3 gene or interfere with SlASR3 gene expression.

[0018] Specifically, knocking out the SlASR3 gene involves at least one of the following methods: genome editing, homologous recombination, or random insertion mutation.

[0019] Furthermore, the genome editing method includes at least one of the following: giant nuclease method, ZFN method, TALEN method, or CRISPR-Cas method.

[0020] The CRISPR-Cas method includes the following steps:

[0021] a. Design sgRNA or gRNA targeting the SlASR3 gene;

[0022] b. Construct Cas editing expression vectors that express sgRNA or gRNA;

[0023] c. Convert the Cas editing expression vector into a tomato.

[0024] Furthermore, the CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a, or CRISPR-Cas12b.

[0025] The nucleotide sequence of the gRNA described in step a is shown in SEQ ID No. 1 and / or SEQ ID No. 2.

[0026] The expression vector mentioned in step b is BG-Plant-Fastcas9.

[0027] Specifically, in step c, the transformation is performed using the Agrobacterium-mediated transformation method.

[0028] Specifically, the epidermal hairs are those of tomato leaves.

[0029] This invention also provides a method to improve the repellency of tomatoes against two-spotted spider mites, achieved by reducing the expression of the SlASR3 gene in tomatoes.

[0030] Specifically, the method for reducing SlASR3 gene expression in tomatoes is to knock out the SlASR3 gene or interfere with SlASR3 gene expression.

[0031] Specifically, knocking out the SlASR3 gene involves at least one of the following methods: genome editing, homologous recombination, or random insertion mutation.

[0032] Furthermore, the genome editing method includes at least one of the following: giant nuclease method, ZFN method, TALEN method, or CRISPR-Cas method.

[0033] The CRISPR-Cas method includes the following steps:

[0034] a. Design sgRNA or gRNA targeting the SlASR3 gene;

[0035] b. Construct Cas editing expression vectors that express sgRNA or gRNA;

[0036] c. Convert the Cas editing expression vector into a tomato.

[0037] Furthermore, the CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a, or CRISPR-Cas12b.

[0038] The nucleotide sequence of the gRNA described in step a is shown in SEQ ID No. 1 and / or SEQ ID No. 2.

[0039] The expression vector mentioned in step b is BG-Plant-Fastcas9.

[0040] Specifically, in step c, the transformation is performed using the Agrobacterium-mediated transformation method.

[0041] This invention also provides a method for improving the tolerance of tomatoes to cold stress by reducing the expression of the SlASR3 gene in tomatoes.

[0042] Specifically, the method for reducing SlASR3 gene expression in tomatoes is to knock out the SlASR3 gene or interfere with SlASR3 gene expression.

[0043] Specifically, knocking out the SlASR3 gene involves at least one of the following methods: genome editing, homologous recombination, or random insertion mutation.

[0044] Furthermore, the genome editing method includes at least one of the following: giant nuclease method, ZFN method, TALEN method, or CRISPR-Cas method.

[0045] The CRISPR-Cas method includes the following steps:

[0046] a. Design sgRNA or gRNA targeting the SlASR3 gene;

[0047] b. Construct Cas editing expression vectors that express sgRNA or gRNA;

[0048] c. Convert the Cas editing expression vector into a tomato.

[0049] Furthermore, the CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a, or CRISPR-Cas12b.

[0050] The nucleotide sequence of the gRNA described in step a is shown in SEQ ID No. 1 and / or SEQ ID No. 2.

[0051] The expression vector mentioned in step b is BG-Plant-Fastcas9.

[0052] Specifically, in step c, the transformation is performed using the Agrobacterium-mediated transformation method.

[0053] The beneficial effects of this invention are:

[0054] This invention provides a new and effective means for improving and enhancing the traits of tomato, a plant in the Solanaceae family. Reducing the expression of the SlASR3 gene can improve various traits of tomatoes. In the examples exemplified in this invention, gene-edited lines with SlASR3 knockout in tomatoes were obtained through gene editing technology, resulting in a significant increase in the number of type VI epidermal trichomes on their leaves. Further research revealed that tomato type VI epidermal trichomes can secrete terpenoids with insect-resistant effects, enhancing the resistance of tomato plants to the two-spotted spider mite from both physical and chemical perspectives. This reduces the use of chemical pesticides, has fewer environmental limitations, reduces agricultural dependence on fossil fuels, and promotes sustainable agricultural development. In addition, the SlASR3 knockout tomato gene-edited lines exhibit enhanced fruit cold resistance and minimal changes in physiological quality during low-temperature storage, greatly mitigating the damage caused by low-temperature storage to tomato fruits. It is evident that the tomato SlASR3 gene plays a crucial role in plant resistance to both biotic and abiotic stresses. The application method of this invention in optimizing tomato traits can improve the plant's resistance to two-spotted spider mites and also enhance the cold resistance of the fruit. By obtaining SlASR3 gene-edited plants through modern gene editing technology, this lays the foundation for further breeding of germplasm resources with insect resistance and cold damage resistance, and has significant production value for insect-resistant tomato breeding and cold-resistant tomato fruit breeding. Attached Figure Description

[0055] Figure 1 The editing method of the SlASR3 gene editing line.

[0056] Figure 2 Scanning electron microscope images of leaf epidermal hairs and statistics on the number of epidermal hairs in wild-type and SlASR3 gene-edited lines.

[0057] Figure 3 Selectivity and oviposition experiments of wild-type and SlASR3 gene-edited Tetranychus spp.

[0058] Figure 4 Symptoms of chilling injury in tomato fruits of wild-type, SlASR3 overexpression, and gene-edited plants after cold treatment.

[0059] Figure 5 The carotenoid content, MDA content, and SOD, POD, and CAT enzyme activities of cold-treated tomato fruits from wild-type, SlASR3 overexpression, and gene-edited plants were measured. Detailed Implementation

[0060] This invention screened SlASR3 from RNA-seq data. SlASR3 possesses a plant-specific MYB / SANT-like DNA-binding domain and a three-helix bundle structure, leading to its classification as a MYB-like transcription factor family. MYB transcription factors are one of the largest transcription factor families in plants. Their core structure is the MYB domain, composed of 1 to 3 tandemly repeated DNA-binding domains (R domains), each containing approximately 52 amino acids.

[0061] To investigate the function of this gene, this invention constructed a SlASR3 gene knockout vector and an overexpression vector, which were transformed into tomatoes to obtain knockout plants and overexpression plants, respectively. Further analysis of various indicators in the knockout and overexpression plants, such as the number of epidermal hairs, was conducted. The knockout line showed a significant increase in leaf epidermal hairs. Considering that tomato type VI epidermal hairs can secrete terpenoids with insect-resistant effects, the insect resistance of the plants was further examined. The results showed that the gene knockout plants exhibited better repellency against the two-spotted spider mite.

[0062] Furthermore, the inventors investigated the role of this gene in other resistance aspects. Experiments showed that knocking out the SlASR3 gene improved the plant's tolerance to cold damage, especially in the tomato fruit, which exhibited better cold resistance.

[0063] It is evident that this invention, through gene editing, has yielded superior tomato varieties that are resistant to insects and cold damage.

[0064] This invention discovers that knocking out the SlASR3 gene in tomatoes not only improves the plant's resistance to the two-spotted spider mite but also enhances the cold resistance of tomato fruits. Therefore, the SlASR3 gene plays a crucial role in the resistance of tomato plants to both biotic and abiotic stresses. Obtaining SlASR3 gene-edited plants through modern gene editing technology has significant production implications for insect-resistant breeding of tomato plants and cold-resistant breeding of tomato fruits. The tomato (Solanum lycopersicum) and two-spotted spider mite (Tetranychus cinnabarinus) used in the following examples were obtained from the College of Life Sciences, Chongqing University.

[0065] Example 1: Vector Construction and Transformation

[0066] 1. Construction of SlASR3 gene-edited plant vector and detection of editing method

[0067] Two gene editing targets for SlASR3 (https: / / solgenomics.net / search / locus, Solyc02g069390) were identified using the CRISPR-P online tool (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), and two gRNAs were designed based on these targets (see [link to gRNA program]). Figure 1 (SEQ ID No. 1 and SEQ ID No. 2). The corresponding double-stranded DNA of the two gRNAs were synthesized by PCR and cloned into the BG-Plant-Fastcas9 binary vector (constructed by Chongqing Baoguang Company) using Golden Gate Assembly. The sequence is shown in SEQ ID No. 3. The vector was transformed into Agrobacterium tumefaciens strain GV3101, and Micro Tom tomatoes were transformed via Agrobacterium-mediated transformation. Transgenic tomato seedlings were obtained, and the genome of the T0 generation tissue culture seedlings was extracted. Primers containing knockout target sites were designed for PCR amplification. After sequencing, the genome was compared with the amplified product of wild-type tomato genome to determine the gene editing method. Homozygous non-transgenic knockout lines were then screened in the T1 and T2 generations. Finally, the following lines were selected: Slasr3#2, Slasr3#5, Slasr3#6, Slasr3#7, and Slasr3#8.

[0068] gRNA1 (SEQ ID No. 1): GAGTAGTAGTAACATGTTTA;

[0069] gRNA2 (SEQ ID No. 2): AACAGAGTTAAGATGGAAAT.

[0070] SEQ ID No. 3 contains a sequence fragment of sgRNA targeting two sites and its backbone sequence.

[0071] 。

[0072] 2. Construction and transformation of overexpression vectors

[0073] First, an overexpression vector was constructed by ligating the coding sequence of SlASR3 into the binary vector pLP100 containing the cauliflower mosaic virus (CaMV) 35S promoter. Next, tomato explants were infected using Agrobacterium-mediated transformation, and transgenic lines were obtained through plant tissue culture. Finally, SlASR3 gene expression was analyzed by RT-qPCR, yielding overexpression transgenic lines SlASR3-OE#3, SlASR3-OE#5, and SlASR3-OE#8.

[0074] 3. Construction and transformation of RNAi vectors

[0075] An RNAi vector was constructed by ligating the RNAi interference fragment sequence of SlASR3 into the pJE042 vector. Tomato explants were then infected using Agrobacterium-mediated transformation, and transgenic lines were obtained through plant tissue culture. Finally, SlASR3 gene expression was analyzed by RT-qPCR to obtain the RNAi transgenic lines SlASR3-RNAi#1 and SlASR3-RNAi#2.

[0076] Example 2: Observation and Count of Epidermal Hairs in SlASR3 Gene-Edited Plants

[0077] Cut 2cm pieces respectively 2 The number of epidermal hairs on leaves of wild-type and two SlASR3 gene-edited lines was observed and counted using scanning electron microscopy. Results are as follows: Figure 2 As shown, knocking out the SlASR3 gene significantly increased the number of epidermal hairs on tomato leaves.

[0078] Example 3: Selection and oviposition experiment of SlASR3 gene-edited plants against two-spotted spider mites.

[0079] Prepare two clean plastic petri dishes (90mm in diameter) and a 10cm long plastic pipette. Make a small hole (1-2mm in diameter) in the center of the pipette and connect it to the two petri dishes. Place a cotton pad and two sheets of filter paper in each petri dish, and lightly spray with a small amount of water. Place two healthy tomato leaves and one leaf from the gene-edited plant in each petri dish. Then, place 20 two-spotted spider mites into the hole connected to the pipette. Wait 10 minutes and count the number of two-spotted spider mites in each petri dish.

[0080] Healthy, pest-free tomato leaves and leaves from gene-edited plants were placed on filter paper in petri dishes. Ten adult female two-spotted spider mites were placed on each leaf. The dishes were then sealed tightly with sealing film and placed in a plant incubator for 3 days. After incubation, the number of two-spotted spider mite eggs laid on the tomato leaves in each petri dish was observed and counted under a microscope.

[0081] The results show ( Figure 3 Gene-edited lines of tomato SlASR3 exhibit a significant repulsive effect on two-spotted spider mites, influencing their host selection and inhibiting their oviposition.

[0082] Example 4: Low-temperature storage experiment of fruits from SlASR3 gene-edited plants during the color-breaking stage.

[0083] Fruits from wild-type, SlASR3 overexpression transgenic lines, and gene-edited lines at the color-breaking stage were treated at room temperature (25℃) for 28 days or cold-treated (4℃) for 14 days followed by room temperature treatment for 14 days, and the fruit phenotype was observed.

[0084] Experimental results ( Figure 4 The results showed that the gene-edited tomato SlASR3 line exhibited the least physiological phenotypic changes and the strongest tolerance to chilling injury after cold treatment.

[0085] Example 5: Determination of carotenoid content, MDA content, and SOD, POD, and CAT enzyme activities in fruits of SlASR3 gene-edited plants after cold treatment.

[0086] Low-temperature treatment was applied to fruits from wild-type, SlASR3 overexpressing, and gene-edited plants, as follows: fruits at the color-breaking stage were treated at room temperature (25℃) for 28 days, then cold-treated (4℃) for 14 days, followed by room temperature treatment for another 14 days. Physiological indicators of chilling injury were then measured, including carotenoid content, MDA content, SOD enzyme activity, POD enzyme activity, and CAT enzyme activity. Malondialdehyde (MDA) content assay kit (catalog number: G0109W, microplate method, 96 samples), catalase (CAT) assay kit (catalog number: G0105W, microplate method, 96 samples), peroxidase (POD) assay kit (catalog number: G0107W, microplate method, 96 samples), and superoxide dismutase (SOD) – WST-8 activity assay kit (catalog number: G0101W, microplate method, 96 samples) were purchased from Suzhou Greens Biotechnology Co., Ltd.

[0087] The method for determining carotenoids is as follows:

[0088] (1) Take out the stored sample (select a suitable sample) from the -80℃ freezer and put it into liquid nitrogen. Pre-cool the mortar with liquid nitrogen and grind the fruit into powder. Place the centrifuge tube on the scale to remove the skin, cut the Pasteur tube, and put 50mg (0.05g) of fruit powder into a 2mL centrifuge tube through liquid nitrogen.

[0089] (2) Add 1.5 mL of the extraction solution to the centrifuge tube (you can even weigh it to see if the final amount is 1.26 g), gently invert to mix well, place on ice, and repeat 4 times.

[0090] (3) Wrap the sample and centrifuge tube rack with sealing film. During extraction, shake the centrifuge tube frequently to ensure that the extract and fruit powder are in full contact. Extract at 4°C for 36 hours.

[0091] (4) Extract for 36 hours until the solution turns yellow and the fruit sample turns white. A low temperature and dark environment must be maintained during the extraction process to prevent carotenoid degradation;

[0092] (5) Centrifuge at 3,000 rpm for 1 minute at 4℃ to obtain the supernatant;

[0093] (6) Protect from light and place on ice. Preheat the spectrophotometer in advance. Transfer the supernatant from the centrifuge tube to a glass cuvette. Use an extract with anhydrous ethanol and acetone in a volume ratio of 1:1 as a control. Then measure the absorbance of the fruit samples at wavelengths of OD 663nm, OD 645nm, and OD 470nm (3 OD values ​​for each sample).

[0094] Experimental results ( Figure 5 The results showed that the SlASR3 gene-edited tomato lines produced the lowest levels of malondialdehyde (MDA), a chilling injury product, after cold treatment; the activities of SOD, POD, and CAT enzymes were significantly increased to cope with reactive oxygen species damage caused by chilling injury. Therefore, compared with wild-type and SlASR3 overexpression plants, the fruits of SlASR3 gene-edited plants showed the strongest tolerance to chilling injury, as the reactive oxygen species damage caused by chilling injury had the least impact on the fruits of SlASR3 gene-edited plants.

Claims

1. Reduce tomatoes SlASR3 Application of gene-expressed substances in improving the resistance of tomato fruits to cold stress; the reduction SlASR3 The substance that reduces gene expression SlASR3 The reduction of gRNA in gene expression SlASR3 The nucleotide sequence of the gRNA expressing the gene is shown in SEQ ID No. 1 and / or SEQ ID No.

2. SlASR3 The gene is Solyc02g069390.

2. A method for improving the tolerance of tomato fruits to cold stress, characterized in that: By reducing the amount in tomatoes SlASR3 Gene expression is achieved; reducing the concentration of tomato SlASR3 Gene expression is achieved through knockout. SlASR3 Gene; the knockout SlASR3 The gene editing method used was CRISPR-Cas genome editing. SlASR3 The gene is Solyc02g069390.

3. The method according to claim 2, characterized in that: The CRISPR-Cas method includes the following steps: a. Design targeting SlASR3 The sgRNA or gRNA of a gene; b. Construct Cas editing expression vectors that express sgRNA or gRNA; c. Convert the Cas editing expression vector into a tomato.

4. The method according to claim 3, characterized in that: The CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a, or CRISPR-Cas12b.

5. The method according to claim 4, characterized in that: The nucleotide sequence of the gRNA described in step a is shown in SEQ ID No. 1 and / or SEQ ID No.

2.

6. The method according to claim 4, characterized in that: The expression vector mentioned in step b is BG-Plant-Fastcas9.

7. The method according to claim 4, characterized in that: In step c, the transformation is performed using the Agrobacterium-mediated transformation method.

Images