Lipid nanoparticles and their application

Abstract

The present invention provides lipid nanoparticles and their applications. This application explores the ratio of lipid material formulations, the optimal cell culture and editing system, the Cas9 mRNA:sgRNA ratio in the editing system, and the optimization of Cas9 mRNA design, resulting in a system suitable for transfection and editing of human hematopoietic stem cells. While saving costs, this application can completely replace the inability of existing commercial transfection reagents to effectively transfect primary cells, significantly improving editing efficiency within primary cells and achieving excellent therapeutic effects in vivo.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to lipid nanoparticles and applications thereof. Background Art

[0002] As is well known, mRNA delivery into cells faces two major technical obstacles: (1) membrane barriers caused by electrostatic repulsion; (2) enzymatic degradation during delivery. Therefore, special modification or packaging delivery systems are required to achieve intracellular expression of mRNA, change the intracellular biodistribution, cell targeting and uptake mechanism of mRNA, promote mRNA delivery, and exert the post-translational effects of mRNA. To make up for the shortcomings of viral vectors, non-viral delivery systems have attracted increasing attention due to their low toxicity, potential for targeted delivery, long-term stability, high DNA / mRNA loading capacity, controllable chemical structure, low immunogenicity, and ease of large-scale preparation. LNP (Lipid Nanoparticle) is considered to be the most promising non-viral vector for exogenous mRNA delivery.

[0003] Hematopoietic stem cells have specific receptors and markers on their surfaces. To achieve efficient transfection, LNPs need to be able to specifically recognize and bind to these receptors or markers. However, due to the low expression levels and complex and diverse expression of receptors and markers on the surface of hematopoietic stem cells, LNP targeting has become a challenge. Therefore, how to effectively transfect human hematopoietic stem cells and significantly improve the efficiency of editing in primary cells is an urgent problem in this field. Summary of the Invention

[0004] To overcome the deficiencies of the prior art, the present invention provides a lipid nanoparticle and its application.

[0005] To achieve the above purpose, the present invention adopts the following technical solutions

[0006] The first aspect of the present invention provides an LNP-mRNA delivery system, which includes an LNP carrier loaded with one or more mRNAs, and the ratio of the LNP to the mRNA is (4-10):1.

[0007] Furthermore, the ratio of LNP to mRNA is (8-10):1.

[0008] Furthermore, the ratio of LNP to mRNA is 8:1.

[0009] Furthermore, the concentration of the oil phase in the LNP is 4-12 mM.

[0010] Furthermore, the concentration of the oil phase in the LNP is 6 mM.

[0011] Furthermore, the mRNA is Cas9 mRNA.

[0012] Furthermore, the LNP-mRNA delivery system also includes sgRNA.

[0013] Furthermore, the ratio of mRNA to sgRNA was (1-4):(1-3).

[0014] Furthermore, the ratio of mRNA to sgRNA was 1:2.

[0015] Furthermore, the LNP comprises ionizable amino lipids, PEG lipids, phospholipids, and cholesterol.

[0016] Furthermore, the ionizable amino lipid is selected from ALC0315.

[0017] Furthermore, the PEG lipid is selected from ALC0159 (DMG-PEG2000).

[0018] Furthermore, the phospholipid is selected from DSPC.

[0019] A second aspect of the present invention provides the use of GlutaMAX in preparing a product for increasing protein translation in cells.

[0020] Furthermore, the cells are selected from hematopoietic stem cells.

[0021] Furthermore, the hematopoietic stem cells are human hematopoietic stem cells.

[0022] Furthermore, the increasing protein translation in the cells is to increase the translation of Cas9 mRNA in the cells after LNP transfection.

[0023] Furthermore, the product also includes cell culture medium.

[0024] Furthermore, the cell culture medium is selected from IMDM culture medium.

[0025] Furthermore, the IMDM culture medium further comprises FBS, BSA, double antibody, SCF, interleukin, β-mercaptoethanol, and sodium pyruvate.

[0026] Furthermore, the interleukin is selected from IL-3.

[0027] A third aspect of the present invention provides a culture medium capable of increasing protein translation in cells, wherein the culture medium comprises GlutaMAX.

[0028] Furthermore, the cells are selected from hematopoietic stem cells.

[0029] Furthermore, the hematopoietic stem cells are human hematopoietic stem cells.

[0030] Furthermore, the increasing protein translation in the cells is to increase the translation of Cas9 mRNA in the cells after LNP transfection.

[0031] Furthermore, the culture medium is a cell culture medium.

[0032] Furthermore, the cell culture medium is selected from IMDM culture medium.

[0033] Furthermore, the IMDM culture medium further comprises FBS, BSA, double antibody, SCF, interleukin, β-mercaptoethanol, and sodium pyruvate.

[0034] Furthermore, the interleukin is selected from IL-3.

[0035] The fourth aspect of the present invention provides the use of the LNP-mRNA delivery system described in the first aspect of the present invention in transfecting and editing human hematopoietic stem cells.

[0036] The fifth aspect of the present invention provides use of the LNP-mRNA delivery system described in the first aspect of the present invention in preparing a pharmaceutical composition for treating a disease.

[0037] Furthermore, the disease is selected from sickle cell anemia.

[0038] Furthermore, the mobilization method of the pharmaceutical composition is a continuous mobilization method.

[0039] Furthermore, the mobilization agents used in the continuous mobilization method are G-CSF and AMD3100, and the Primegene brand is the best G-CSF.

[0040] Furthermore, the pharmaceutical composition is injected subcutaneously.

[0041] Furthermore, the subcutaneous injection is a subcutaneous injection in the neck.

[0042] Furthermore, the pharmaceutical composition also includes pharmaceutically acceptable excipients.

[0043] Advantages and beneficial effects of the present invention:

[0044] This application conducts a series of explorations on the ratio of lipid material formulas, the optimal cell culture and editing system, the Cas9 mRNA:sgRNA ratio of the editing system, and the optimization of Cas9 mRNA design, and explores a system suitable for transfection and editing of human hematopoietic stem cells. While saving costs, this application can completely replace the problem that existing commercial transfection reagents cannot effectively transfect primary cells, achieve a significant improvement in the editing efficiency in primary cells, and thus achieve a good therapeutic effect in vivo. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Conventional synthetic LNP and transfection reagent RNAiMax can efficiently transfect K562 cells, but cannot transfect human hematopoietic stem cell CD34 + Cell Map;

[0046] Figure 2 is the effect of LNP formulation on the particle size, PDI, and surface potential of LNP-mRNA;

[0047] Figure 3 Is the LNP-EGFP mRNA formulation effective for CD34 + Effect diagram of cell transfection efficiency and activity;

[0048] Figure 4 LNP-encapsulated mRNA can stably and effectively transfect human hematopoietic stem cells CD34 + Cell Map;

[0049] Figure 5 Human hematopoietic stem cell CD34 + Optimal LNP oil phase concentration for cell transfection;

[0050] Figure 6 This is a diagram of the editing strategy for the sgRNAHBG targeted site;

[0051] Figure 7 This is a diagram of cells edited with different ratios of LNP-encapsulated Cas9 mRNA and sgRNA (1×NLS Cas9mRNA);

[0052] Figure 8 It is GlutaMAX TM Figure 1: The additive significantly enhances protein translation in human hematopoietic stem cell editing in vitro (1×NLS Cas9 mRNA).

[0053] Figure 9 This is the editing efficiency detection bar graph and original peak graph after LNP encapsulated Cas9 mRNA and sgRNA with different nuclear entry signals edited cells;

[0054] Figure 10 This is the image of CFU colony formation and editing efficiency of cells after LNP encapsulated Cas9 mRNA and sgRNA with different nuclear entry signals were inoculated into solid culture medium;

[0055] Figure 11 After LNP encapsulated 3×NLS Cas9 mRNA / sgRNA edited cells, HBG mRNA, HbF and CD235a were detected respectively. + CD71 + Group diagram;

[0056] Figure 12 This is a graph showing the positive rate of mouse hematopoietic stem cell LSK in peripheral blood collected from mice at different time points after GROβ+AMD3100 injection;

[0057] Figure 13 This is a graph showing the positive rate of mouse hematopoietic stem cells LSK in peripheral blood collected from mice at different time points after G-CSF+AMD3100 injection;

[0058] Figure 14 This is a diagram exploring the delivery efficiency of mouse hematopoietic stem cells by subcutaneous injection sites of different mobilization agents;

[0059] Figure 15 This is a graph showing the editing efficiency of different populations of mouse bone marrow one week after LNP-3×NLS Cas9 mRNA / sgRNA was injected into humanized sickle cell anemia mice.

[0060] Figure 16 This is a graph showing the activated globin content in the peripheral blood of humanized sickle cell anemia mice detected by high-performance liquid chromatography 2 weeks after LNP-3×NLS Cas9 mRNA / sgRNA injection;

[0061] Figure 17 Figure 3 shows the positive rate of globin-expressing cells and mRNA content in peripheral blood detected by flow cytometry and qPCR at different time points after LNP-3×NLS Cas9 mRNA / sgRNA was injected into humanized sickle cell anemia mice.

[0062] Figure 18 This figure shows the peripheral blood routine indicators of humanized sickle cell anemia mice tested at the end of treatment after LNP-3×NLS Cas9 mRNA / sgRNA was injected into the mice. The indicators include red blood cell count (RBC), hematocrit (HCT), and hemoglobin content (HGB);

[0063] Figure 19 This is an image of peripheral blood cell morphology, reticulocytes, and sickle cells detected in humanized sickle cell anemia mice at the end of treatment after LNP-3×NLS Cas9 mRNA / sgRNA injection.

[0064] Figure 20 This is a graph of the detection of hepatitis-related factors alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) in the peripheral blood of mice and survival analysis at the end of treatment after LNP-3×NLS Cas9 mRNA / sgRNA injection into humanized sickle cell anemia. DETAILED DESCRIPTION

[0065] The following provides definitions of some terms used in this specification. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0066] The present invention provides an LNP-mRNA delivery system, which includes an LNP carrier loaded with one or more mRNAs, and the ratio of the LNP to the mRNA is (4-10):1.

[0067] In some embodiments, the LNP comprises ionizable amino lipids, PEG lipids, phospholipids, cholesterol.

[0068] In some embodiments, ionizable amino lipids refer to a class of lipid molecules containing an amino group (-NH2 or -NR2, R is an alkyl group) and can be ionized under specific conditions, including but not limited to ALC0315 and SM-102.

[0069] In a specific embodiment, the ionizable amino lipid is selected from ALC0315.

[0070] In some embodiments, PEG lipids (PEGylated lipids) are lipid molecules modified with polyethylene glycol (PEG). The PEG lipids are selected from ALC0159 (DMG-PEG2000).

[0071] In some embodiments, phospholipids are a type of lipid containing phosphoric acid and are the main components of biological membranes. The phospholipids include glycerophospholipids, sphingomyelin, and other phospholipids.

[0072] Among them, glycerophospholipids include phosphatidylcholine, cephalin (phosphatidylethanolamine), serine phospholipids (phosphatidylserine), inositol phospholipids (phosphatidylinositol), and phosphatidylglycerol.

[0073] In a preferred embodiment, the phospholipid is selected from glycerophospholipids, the glycerophospholipid is selected from phosphatidylcholine, and the phosphatidylcholine is selected from DSPC (distearoylphosphatidylcholine).

[0074] The present invention provides the use of GlutaMAX in preparing a product for improving protein translation in cells.

[0075] In some embodiments, the product can be a culture medium. The culture medium is any culture medium suitable for hematopoietic stem cells, including but not limited to IMDM culture medium, RPMI-1640 culture medium, DMEM / F-12 culture medium, Culture medium, StemSpan TM SFEM medium.

[0076] In a specific embodiment, the culture medium is selected from IMDM medium.

[0077] In some embodiments, the culture medium further comprises other factors, including but not limited to FBS, BSA, double antibody, SCF, interleukin, β-mercaptoethanol, sodium pyruvate, erythropoietin (EPO), granulocyte stimulating factor (G-CSF), and megakaryocyte stimulating factor (M-CSF).

[0078] The present invention provides use of the LNP-mRNA delivery system or the lipid nanoparticles in preparing a pharmaceutical composition for treating a disease.

[0079] The pharmaceutical composition further includes pharmaceutically acceptable excipients.

[0080] In some embodiments, a pharmaceutically acceptable excipient is used to refer to a material that is compatible with a recipient, preferably a mammal, more preferably a human, and suitable for delivering the active agent to the target site without disrupting the activity of the agent. The toxicity or side effects associated with the pharmaceutically acceptable excipient (if any) are preferably commensurate with a reasonable risk / benefit ratio for the intended use of the active agent.

[0081] Pharmaceutically acceptable excipients include, but are not limited to, diluents, binders, surfactants, humectants, adsorbents, lubricants, fillers, and disintegrants. These excipients are used, as needed, to enhance the stability of the formulation, improve its activity or bioavailability, or produce an acceptable taste or odor when taken orally. The formulations used in such drugs may be in the form of the original compound itself or, optionally, in the form of a pharmaceutically acceptable salt. The pharmaceutical composition thus formulated may be administered in any appropriate manner known to those skilled in the art.

[0082] Among them, diluents include but are not limited to lactose, sodium chloride, glucose, urea, starch, and water.

[0083] Binders include, but are not limited to, starch, pregelatinized starch, dextrin, maltodextrin, sucrose, gum arabic, gelatin, methylcellulose, carboxymethylcellulose, ethylcellulose, polyvinyl alcohol, polyethylene glycol, polyvinylpyrrolidone, alginic acid and alginates, xanthan gum, hydroxypropyl cellulose, and hydroxypropyl methylcellulose.

[0084] Surfactants include, but are not limited to, polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, stearic acid monoglyceride, and cetyl alcohol.

[0085] Humectants include, but are not limited to, glycerin.

[0086] Adsorptive supports include, but are not limited to, bentonite, silica gel, kaolin, and bentonite.

[0087] Lubricants include, but are not limited to, zinc stearate, glyceryl monostearate, polyethylene glycol, talc, calcium and magnesium stearate, polyethylene glycol, boric acid powder, hydrogenated vegetable oil, sodium stearyl fumarate, polyoxyethylene monostearate, monolauric sucrose ester, sodium lauryl sulfate, magnesium lauryl sulfate, and magnesium lauryl sulfate.

[0088] Fillers include, but are not limited to, mannitol (granular or powdered), xylitol, sorbitol, maltose, erythrose, microcrystalline cellulose, polymeric sugars, coupling sugars, glucose, lactose, sucrose, dextrin, starch, sodium alginate, laminarin powder, agar powder, calcium carbonate, and sodium bicarbonate.

[0089] Disintegrants include, but are not limited to, cross-linked vinyl pyrrolidone, sodium carboxymethyl starch, low-substituted hydroxypropyl methyl, cross-linked sodium carboxymethyl cellulose, and soybean polysaccharides.

[0090] The present invention will be further described below with reference to specific examples. It should be understood that the specific embodiments described herein are presented by way of example and are not intended to limit the present invention. The main features of the present invention may be applied to various embodiments without departing from the scope of the present invention.

[0091] Example 1 Study on the formulation and preparation process of LNP carrier

[0092] 1. Materials and Methods

[0093] 1) Experimental Materials

[0094] Lipid material formulation: ALC0315 (medkoo, 556006), ALC0159 (medkoo, 556014), DSPC (Avanti, 850365), Cholesterol (Echelon Biosciences, L-6012); Quant-iT TM RNA reagent (Thermo Fisher, R11490), Triton TM X-100 solution (Sigma-Aldrich, 93443); citric acid (C6H8O7·H2O), sodium citrate (C6H5Na3O7·2H2O), DEPC water; sterile enzyme-free ultrapure water, anhydrous ethanol, PBS buffer; screw-cap syringe (Xinhua), 1.5ml, 15ml, 50ml sterile enzyme-free tubes, ultrafiltration tubes (Merck, UFC903024), high-speed centrifuge, microplate reader, Malvern dynamic light scattering instrument.

[0095] 2) Experimental methods

[0096] The lipid ethanol solution was prepared according to the molar ratio of ALC0315:DSPC:Chol:ALC0159(DMG-PEG2000) of 50:10:38.5:1.5. The concentration of mRNA was measured and diluted to the required concentration using pH=4 sodium citrate solution according to the lipid concentration. An LNP preparation device was built using a syringe pump, T-junction and connecting pipes. The ethanol solution of lipid molecules and the mRNA aqueous solution were mixed in a certain proportion to obtain LNP-mRNA. The collected solution was diluted 50 times with PBS, and after ultrafiltration purification, the particle size, uniformity and ζ potential of LNP-mRNA were measured using a dynamic light scattering instrument. Quant-iT TM Triton for RNA detection TM The amount of nucleic acid in the X-100 solution before and after demulsification was calculated based on the difference in the amount of nucleic acid. The drug loading capacity and encapsulation efficiency were calculated.

[0097] Figure 1 :Effects of LNPs encapsulating EGFP-mRNA on human myeloid leukemia cells K562 and human hematopoietic stem cells CD34 + The cells were transfected and divided into the following groups: K562 cells untreated negative control group (Control), LNP-EGFP mRNA transfection group (LNP), RNA transfection reagent RNAiMAX positive control group (RNAiMAX); CD34 + Cells were untreated in the negative control group (Control), LNP-EGFP mRNA transfection group (LNP), and RNA transfection reagent RNAiMAX positive control group (RNAiMAX).

[0098] The cells were gently pipetted and the cell suspensions were collected using 1640 medium containing 1% double antibody and 10% FBS (K562 cells); IMDM medium containing 30% FBS, 10% BSA, 1% double antibody, SCF, IL-3, β-mercaptoethanol, and sodium pyruvate (CD34 + Cells). Centrifuge at room temperature at 800 rpm for 5 min (K562), at room temperature at 800 g for 10 min (CD34 + cells), and 0.5×10 6 Cells were transfected in 24-well plates. RNAiMAX, an RNA transfection reagent, was used as a control transfection experiment. For the LNP transfection group, mRNA-encapsulated LNPs were directly added, with a transfection volume of 1 μg. Flow cytometry was used to assess EGFP positivity and cell viability.

[0099] LNP synthesis with different relative ratios of cationic lipids and mRNA

[0100] Figure 2 : The synthesis process is shown in 1) and 2). Four types of LNPs were synthesized according to the relative mass ratio of cationic lipid to mRNA of 4:1-10:1, and the particle potential, particle size, and PDI were physically characterized and detected using a Malvern particle size analyzer.

[0101] Figure 3 :CD34 + The cells were not treated in the negative control group, LNP-EGFP mRNA transfection group (4 kinds of LNPs were synthesized according to the relative mass ratio of cationic lipid to mRNA of 4:1-10:1 to transfect CD34 + After the cells were transfected, the transfection procedure was the same as Figure 1 The transfection dose was 1 μg, and the EGFP positive rate and cell viability were detected by flow cytometry 48 hours later.

[0102] Figure 4 :CD34 + The cells were untreated in the negative control group, LNP-EGFP mRNA transfection group (different dose groups 1, 2, 4, 8 μg) and transfected with CD34 + After the cells were transfected, the transfection procedure was the same as Figure 1 The samples were collected at different time points (48, 72, and 96 h) and the EGFP positive rate and cell viability were detected by flow cytometry.

[0103] Figure 5 After the ratio of cationic lipid to mRNA was determined to be 8:1, the total lipid concentration in the ethanol phase was configured to 12mM, 8mM, 6mM, and 4mM, respectively, and mixed with the aqueous phase to prepare different LNPs (different dose groups of 2 and 4μg) for transfection of CD34 + After the cells were transfected, the transfection procedure was the same as Figure 1 The green fluorescence intensity of the cells was observed under a fluorescence microscope after 48 hours.

[0104] Figure 7 :LNPs were synthesized at different Cas9 mRNA:sgRNA ratios. The synthesis process is shown in Figure 7 Four types of LNPs were synthesized using the ratio of 1×NLS Cas9 mRNA (synthesized by Yunzhou Biotechnology Co., Ltd.): sgRNA (synthesized by Sythgo, sgRNA sequence: CUUGUCAAGGCUAUUGGUCA (SEQ ID NO: 1)) Cas9 mRNA: sgRNA of 4:1, 3:1, 2:1, 1:2, and 1:3, respectively. The particle potential, particle size, and PDI were physically characterized using a Malvern particle size analyzer. CD34 cells were transfected at a dose of 4 μg. +Cells, K562 cells, transfection operation is the same Figure 1 The supernatant was discarded after centrifugation at 800 g for 10 min at room temperature, and DNA was extracted using a DNA extraction kit (Quanshijin, EE181-01). After PCR amplification, agarose electrophoresis was performed, and the bands were cut and sent for Sanger first-generation sequencing to detect gene editing.

[0105] Cas9 mRNA editing system: sgRNA ratio, Cas9 mRNA nuclear entry signal design, and exploration of the optimal editing system

[0106] Figure 8 :GlutaMAX TM No added group (0mM), GlutaMAX TM Add low-dose group (1mM), GlutaMAX TM Adding medium dose group (2mM), GlutaMAX TM A high dose group (4 mM) was added.

[0107] LNP-1×NLS Cas9 mRNA / sgRNA transfected cells were transfected with CD34 at a dose of 4 μg + Cells, culture medium system see Figure 1 The culture system used in the experiment was supplemented with different concentrations of GlutaMAX. TM , 72 h after transfection, cell lysates were collected and processed for protein extraction, and Western blotting experiments were performed using Cas9 protein reagent (Cell Signaling Technology, 14697) and GAPDH antibody (Proteintech, 20536-1-AP).

[0108] Figure 9 :CD34 + The cells were untreated in the negative control group, LNP-1×NLS Cas9 mRNA / sgRNA transfection group, and LNP-3×NLS Cas9 mRNA / sgRNA transfection group. Based on the Cas9 mRNA with one nuclear import signal (NLS), a Cas9 mRNA with three NLSs was designed (synthesized by Yunzhou Bio). LNP was synthesized at a ratio of 1:2 for Cas9 mRNA:sgRNA and transfected into CD34 at a dose of 4 μg. + Cells were induced to differentiate into the erythroid lineage 72 h after transfection (3 dpt). At different time points (ED d4-ED d8), cells were centrifuged at 800 g for 10 min at room temperature, and the supernatant was discarded. DNA was extracted using a DNA extraction kit (Quanshijin, EE181-01). After PCR amplification, agarose electrophoresis was performed, and the bands were cut and sent for Sanger sequencing to detect gene editing.

[0109] Figure 10 :CD34 + CD34 T cells were collected 72 hours after transfection in the untreated negative control group, LNP-1×NLS Cas9 mRNA / sgRNA transfection group, and LNP-3×NLS Cas9 mRNA / sgRNA transfection group. + After 15 days of inoculation of cells on solid culture medium (stem cell, H4434), images were taken under a microscope, and colony-forming units (CFUs) were collected for DNA extraction and testing for gene editing. DNA was extracted using a DNA extraction kit (Quanshijin, EE181-01). After PCR amplification, DNA was subjected to agarose gel electrophoresis, and the excised bands were sent for Sanger sequencing to detect gene editing.

[0110] Figure 11 :CD34 + Cells in the untreated negative control group and the LNP-3×NLS Cas9 mRNA / sgRNA transfection group were collected and washed in PBS on day 4 after erythroid differentiation induction. Total RNA was isolated using a PCR product (Full-Form Gold, ER601-01-V2) according to the manufacturer's protocol. Reverse transcription was performed using M-MLV reverse transcriptase (Promega, Madison, WI, USA). Real-time quantitative PCR was used to analyze the expression levels of GAPDH, HBB, and HBG. All real-time PCR reactions were performed using a Biorad real-time PCR detection system. Product quality was confirmed by melting curve analysis. The following expression primers were used: forward (F) primer CATTGCCCTCAACGACCACT (SEQ ID NO: 2) and reverse (R) primer GGTGGTCCAGGGGTCTTACT (SEQ ID NO: 3) for GAPDH, F primer GCCCTGGCCCACAAGTATC (SEQ ID NO: 4) and R primer GCCCTTCATAATATCCCCCAGTT (SEQ ID NO: 5) for HBB, and F primer GGTGACCGTTTTTGGCAATCC (SEQ ID NO: 6) and R primer GTATCTGGAGGACAGGGCAC (SEQ ID NO: 7) for HBG. The HBG mRNA percentage refers to the abundance of HBG mRNA expressed relative to the sum of the abundance of γ-globin and β-globin transcripts ([HBG / (HBB+HBG]*100)).

[0111] To determine the expression of HbF in cells, the cells were fixed, permeabilized, and stained using an intracellular labeling kit (InsideStain Kit, Miltenyi Biotec) and anti-HbF-Fitc antibody (Miltenyi Biotec) according to the manufacturer's instructions, and then detected by flow cytometry.

[0112] To detect the erythroid differentiation ability of cells, Brilliant Violet 421 TM After incubating the cells with anti-human CD71 Antibody (Biolegend, 334121) and APC anti-human CD235ab Antibody (Biolegend, 306608), the cells were washed with PBS and then tested on an immunoassay.

[0113] 2. Experimental Results

[0114] 1) Ratio of lipid material formula

[0115] First, when LNP synthesis was performed according to the conventional description in the literature, the obtained particles were the same as the common transfection reagent RNAiMAX (negative control) on the market, which could efficiently transfect K562 cells, but could not effectively transfect human hematopoietic stem cells in vitro ( Figure 1 ).

[0116] The influence of the relative ratio of cationic lipid to mRNA (4:1-10:1) on the physicochemical properties of LNP-mRNA was further investigated. First, the prepared nanoparticles had a small particle size and good uniformity, with the particle size maintained at around 100nm and a good PDI (preferably ≤0.3). In addition, as the proportion of cationic lipid increased, the potential gradually increased ( Figure 2 ). In human hematopoietic stem cells CD34 + Studies have shown that a low or high ratio of cationic lipids will significantly affect the transfection positive rate. When the ratio of cationic lipids is 8:1 or 10:1, the transfection efficiency is the best and does not affect the cell viability ( Figure 3 ).

[0117] These results demonstrate that cationic lipids significantly impact LNP transfection into human hematopoietic stem cells and are a key component of the lipid formulation. When optimizing the lipid formulation, the type, ratio, and absolute concentration of the cationic lipid must be comprehensively considered. A cationic lipid:EGFP mRNA ratio of 8:1 resulted in a stable particle size (around 100 nm), minimal PDI (i.e., uniform particle size), and excellent transfection efficiency. Therefore, this ratio will be selected for subsequent experiments.

[0118] The results of continuous testing up to 96h showed that the transfection efficiency gradually increased with time and finally maintained at a high transfection efficiency of 98% ( Figure 4 ), cell activity assays showed that the liposomes did not affect the normal growth of cells.

[0119] 2) Optimal concentration of oil phase for transfection of hematopoietic stem cells

[0120] When synthesizing LNP, there is an ethanol phase (dissolving lipid material, referred to as the oil phase) and an aqueous phase (dissolving mRNA, referred to as the aqueous phase). This study found that, based on the optimal ratio of the basic LNP formula for transfecting human hematopoietic stem cells, simply by adjusting the oil phase concentration, the lipid transfection of human hematopoietic stem cells and the strong expression of EGFP fluorescent protein can be further enhanced. For human hematopoietic stem cells, when LNP is synthesized, the best effect is to maintain the oil phase concentration at 6mM ( Figure 5 ).

[0121] 3) Editing system Cas9 mRNA: sgRNA ratio, Cas9 mRNA nuclear entry signal design, and exploration of the optimal editing system. At present, gene regulatory elements are used as targets to reactivate γ-globin (HBG) expression to treat thalassemia and sickle cell anemia. This trend has become widespread in the past two years because it is not affected by mutation sites and has a wide range of uses. BCL11A protein negatively regulates the expression of HbF protein. This application targets the BCL11A binding site in the HBG gene promoter region for gene editing to activate γ-globin expression. In 1×NLS Cas9 mRNA

[0122] Based on the Cas9-Nucleoplasmin NLS, two additional nuclear import signals were added, namely 3×NLS Cas9mRNA (Myc NLS-Cas9-SV40 NLS-Nucleoplasmin NLS). The editing strategy sgRNA HBG targeting site is shown in Figure 6 .

[0123] The above-mentioned LNP basic formula was used to encapsulate the editing system. In view of the fact that primary cells are difficult to transfect and edit, this application synthesized LNP-Cas9 mRNA:sgRNA-HBG=4:1, 3:1, 2:1, 1:2, 1:3. After in vitro transfection of cells, the editing efficiency was detected at 48h. The results showed that for human hematopoietic stem cells, the editing efficiency was highest when the ratio was 1:2, indicating that for human hematopoietic stem cells, there is an optimal ratio for the content of the two RNAs. Too much or too little will significantly affect the editing efficiency of primary cells. In addition, when the ratio was 1:2, the efficient editing of K562 cells reached 80%, and that of CD34 cells was 1:2. + Cell editing reached 8%, further indicating that the difficulty of transfection and editing of primary cells is much greater than that of transfection and editing of cell lines ( Figure 7 ).

[0124] To further improve the editing efficiency, this study found that adding GlutaMAX to the culture medium TM The additive can significantly improve the translation of Cas9 mRNA in human hematopoietic stem cells after LNP transfection. Subsequent experiments use this culture medium system for the next step ( Figure 8 ).

[0125] It is known that Cas9 mRNA is translated and imported into the nucleus for editing. Based on the Cas9 mRNA with one nuclear import signal (NLS), this application designed a nuclear import signal with three NLSs. After encapsulation with LNP, 4 μg of the transfected cells were used to edit human hematopoietic stem cells. The results showed that 3×NLS Cas9 mRNA achieved the highest editing effect ( Figure 9 ), and the in vitro transfection system of this application can achieve up to 70% editing with a low dose of only 4 μg, which is lower than the dose used in existing studies. For primary cells such as human hematopoietic stem cells, the design of the nuclear entry signal (type selection and quantity) is crucial.

[0126] Further, cells transfected with LNP-1×NLS Cas9 mRNA / sgRNA and LNP-3×NLS Cas9 mRNA / sgRNA for 72 hours were inoculated into solid culture medium, and photographed under a microscope 15 days later to detect the editing efficiency. The results showed that compared with untransfected cells, LNP-1×NLS Cas9 mRNA / sgRNA and LNP-3×NLS Cas9 mRNA / sgRNA transfection had no significant effect on progenitor cell colony formation. At the same time, the colony editing efficiency of cells transfected with LNP-3×NLS Cas9 mRNA / sgRNA was higher ( Figure 10 ). Since the editing strategy of this application is to activate the expression of γ-globin, the CD34 + The cells were induced to differentiate into erythroid cells and the phenotype was detected. The results showed that the cells were erythroid cells with normal expression compared with the untreated CD34 + Compared with the untreated group, the expression of HBG mRNA in the transfected cells increased significantly on Day 4 after induction. The expression of globin HbF was detected by flow cytometry on Day 4, Day 8 and Day 11, which were significantly higher than those in the untreated group. + CD71 + There was no significant effect on the positive rate of the two groups, suggesting that the optimized editing system in this application is effective in editing primary cells CD34 + cells, without affecting the normal erythroid differentiation ability of the cells ( Figure 11 ).

[0127] In summary, this application has developed a mature in vitro system for transfecting and editing human hematopoietic stem cells. By adjusting each parameter and process, we have successfully achieved efficient transfection and editing of human hematopoietic stem cells at low doses using basic LNPs without conjugating them to any antibodies, and significantly increased globin expression. Compared to other studies, this system is cost-effective and simpler to synthesize.

[0128] Example 2 Study on factors affecting in vivo delivery

[0129] 1. Experimental Methods

[0130] Figure 12 :After dissolving and injecting mice (subcutaneously) according to the reagent instructions, 50 μL of blood was collected from the tail vein at different time points and incubated with mouse antibody PerCP Cy5 anti-Mouse Lin - , BV510 anti-Mouse Ckit, PE-Cy7 anti-MouseSca1, to detect the positive rate of mouse hematopoietic stem cells mobilization from the bone marrow to the peripheral blood.

[0131] Figure 13 :After dissolving and injecting mice (subcutaneously) according to the reagent instructions, 50 μL of blood was collected from the tail vein at different time points and incubated with mouse antibody PerCP Cy5 anti-mouse Lin - , BV510 anti-mouse Ckit, and PE-Cy7 anti-mouseSca1 were used to detect the positive rate of mouse hematopoietic stem cell mobilization from the bone marrow to the peripheral blood (all antibodies were from Biolegend).

[0132] Figure 14 : PBS injection control group, LNP-EGFP mRNA injection group (mobilization injection at different sites).

[0133] After synthesizing LNP-EGFP mRNA according to the above optimal formula, it was injected into mice through the tail vein. After 24 hours, the mouse bone marrow cells were obtained and incubated with mouse antibody BV605 anti-mouse Lin - , BV421 anti-mouse Ckit, PE-Cy7 anti-mouse Sca1, PE anti-mouse CD135, APC anti-mouse CD34, flow cytometry detection of the positive rate of EGFP mRNA expression in different mouse hematopoietic stem cell populations LSK, LT-LSK, and ST-LSK (all antibodies were from Biolegend).

[0134] Figure 15 :Untreated disease mice group, LNP-treated disease mice group

[0135] After LNP-Cas9 mRNA / sgRNA was injected into humanized sickle cell anemia mice, bone marrow cells were obtained from the mice 1 week after tail vein injection and incubated with mouse antibody BV605 anti-mouse Lin - , BV421 anti-mouse C kit, and PE-Cy7 anti-mouse Sca1 (all antibodies from Biolegend). After flow cytometry sorting of different mouse hematopoietic stem cell populations, DNA was extracted using a DNA extraction kit (Quanshijin, EE181-01). After PCR amplification, agarose gel electrophoresis was performed, and the excised bands were sent for Sanger sequencing to detect gene editing.

[0136] Figure 16-17 :Healthy control group, disease mouse untreated group, disease mouse LNP treated group

[0137] After LNP-Cas9 mRNA / sgRNA was injected into humanized sickle cell anemia mice, peripheral blood was collected from the mice at 2 weeks, 10 weeks, and 12 weeks after tail vein injection. The blood was lysed after repeated freezing and thawing with ultrapure water to obtain protein supernatant, and then high-performance liquid chromatography (HPLC) was used to detect whether the γ-globin chain was activated. After extracting mRNA from the peripheral blood of the mice, qPCR was performed. The detailed operation was the same as that of the Figure 11 method.

[0138] Figures 18-20 : After LNP-Cas9 mRNA / sgRNA was injected into humanized sickle cell anemia mice from the healthy control group, the untreated disease mouse group, and the LNP-treated disease mouse group, peripheral blood was collected from the mice 16 weeks after tail vein injection. RBC, HGT, and HGB indicators were detected by routine blood testing instruments; ALT, AST, and ALB were detected by biochemical instruments; blood smears were stained with Giemsa, new methylene blue, and sickle cell test, and then observed and photographed under a microscope; finally, survival curves were drawn based on the death of mice.

[0139] 2. Experimental Results

[0140] 1) Exploration of different mobilization drug combinations and drug injection methods in mice

[0141] After synthesizing LNP according to the above optimal formula, we first hope to mobilize hematopoietic stem cells from the bone marrow into the peripheral blood by using a mobilizing agent, which will be more conducive to binding with the LNP injected through the tail vein, thereby improving delivery efficiency.

[0142] ① Exploration of different mobilization agent combinations to mobilize mouse bone marrow hematopoietic stem cells into peripheral blood: divided into rapid mobilization method (GROβ+AMD3100 combination) and continuous mobilization method (G-CSF+AMD3100 combination, in which G-CSF contains 2 different brands). The results showed that the continuous mobilization method was significantly more effective in mobilizing mouse hematopoietic stem cells LSK into peripheral blood than the rapid mobilization method. In addition, in the continuous mobilization method, the effects of different brands of G-CSF were also very different. The continuous mobilization method (G-CSF-Primegene+AMD3100) will be used in the next step of the experiment ( Figure 12-13 ).

[0143] ②Exploration of the delivery efficiency of mouse hematopoietic stem cells at different injection sites of mobilizers: Based on the above exploration, the optimal mobilizer combination was confirmed. On this basis, the drug delivery efficiency was greatly different at different mobilization sites (subcutaneous injection of the neck and subcutaneous injection of the abdomen): The expression of EGFP mRNA in mouse hematopoietic stem cells (long-term hematopoietic stem cells and short-term hematopoietic stem cells) injected subcutaneously at the neck was significantly higher than that injected subcutaneously at the abdomen ( Figure 14 ).

[0144] In summary, this application, for the first time, explored different hematopoietic stem cell mobilization methods and different administration routes to develop a set of optimal combined methodologies for LNP delivery efficiency to hematopoietic stem cells in vivo. Subsequently, this approach was used to treat humanized diseased mice in vivo using an LNP encapsulation editing system, achieving significant results.

[0145] 2) Achieving in vivo treatment of humanized sickle cell anemia

[0146] One week after low-dose, single-injection transfection of mouse HSPCs, the bone marrow LSK editing efficiency reached 20%, globin expression was significantly increased, the ratio of globin-positive cells in peripheral blood increased, the proportion of abnormal morphological red blood cells such as sickle-shaped decreased, the abnormal increase in reticulocytes was significantly reduced, and phenotypes such as blood routine were successfully corrected. Biochemical indicators ALT and AST showed that there was no abnormal increase in the treatment group, that is, no obvious in vivo toxicity was caused in the mice. In addition, the survival time of the diseased mice was significantly prolonged. During the treatment period, there was no death in the diseased mice in the treatment group compared with the untreated group ( Figure 15-20 ).

[0147] The above embodiments are only provided for understanding the method and core concept of the present invention. It should be noted that, without departing from the principles of the present invention, a number of improvements and modifications may be made to the present invention by a person skilled in the art, and such improvements and modifications shall fall within the scope of protection of the claims of the present invention.

Claims

1. A LNP-mRNA delivery system for human hematopoietic stem cells, characterized in that: The LNP-mRNA delivery system includes an LNP carrier loaded with one or more mRNAs, the ratio of the LNP to the mRNA is 8:1; the concentration of the oil phase in the LNP is 6 mM; the mRNA is Cas9 mRNA; the LNP-mRNA delivery system also includes sgRNA; the ratio of mRNA to sgRNA is 1:2; the LNP includes ionizable amino lipids, PEG lipids, phospholipids, and cholesterol; the ionizable amino lipids are selected from ALC0315; the PEG lipids are selected from ALC0159; the phospholipids are selected from DSPC; the Cas9 mRNA is 3×NLS Cas9mRNA, 3×NLS Cas9 mRNA is Myc NLS-Cas9-SV40 NLS-Nucleoplasmin NLS, and the sgRNA sequence is shown in SEQ ID NO:

1.

2. Use of the LNP-mRNA delivery system according to claim 1 in preparing a pharmaceutical composition for treating a disease, wherein the disease is selected from sickle cell anemia.

3. The use according to claim 2, characterized in that The pharmaceutical composition further includes pharmaceutically acceptable excipients.

Images