Gene reconstruction method and application thereof

Abstract

The invention provides a gene reconstruction method and application thereof, the gene reconstruction comprises gene mutation repair and insertion of a short chain sequence, the method comprises the following steps: (1) designing a long primer pair: designing a pair of forward primer and reverse primer containing an upstream base sequence 30-50bp and a downstream base sequence 30-50bp of a site to be subjected to gene reconstruction; (2) recombination: mixing the forward primer and the reverse primer designed in the step (1) with a linearized vector of a gene to be reconstructed, and then carrying out recombination; wherein in the recombination reaction system, the concentration of the forward primer is (0.1-2) nM / [mu] L, the concentration of the reverse primer is (0.1-2) nM / [mu] L, and the concentration of the linearized vector of the gene to be reconstructed is (4-5) ng / [mu] L. The method disclosed by the invention is simple, convenient and feasible, has high reconstruction success rate and can be applied to repairing mutant genes or constructing new functional genes.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a gene reconstruction method and application thereof. Background Art

[0002] With the rapid development of synthetic biology, the demand for heterologous gene optimization and synthesis is increasing. In the process of artificial gene synthesis, due to the limitations of single-stranded oligonucleotide accuracy and purity, as well as the complexity of gene sequences, such as repeated sequences, uneven distribution of GC content, and complex secondary structures, the synthesized genes will mutate. If the synthesized gene inserts or deletes one or several base pairs (except 3 or multiples of 3) in the DNA coding sequence, the DNA coding frame after the insertion or deletion point will be completely changed, which will cause the type and order of partially translated amino acids after the insertion or deletion to change, thereby affecting the biological function of the protein or enzyme. If it is synthesized from scratch, it faces the dual risks of low success rate and waste of time and resources. Gene mutations caused by these objective factors are unavoidable in conventional gene synthesis. Gene mutation repair is obviously a simpler, more feasible, more successful, time-saving and cost-reducing method. Gene mutation repair can use a commercial site-directed mutagenesis kit, but the kit is expensive and has low efficiency when targeting various complex situations of synthetic gene mutations. The more commonly used gene mutation repair technology, bridge PCR, although less expensive, requires PCR, gel recovery, and connection and screening, so the steps are somewhat cumbersome and the cycle is slightly longer.

[0003] In addition, in existing synthetic biology, in order to obtain a gene with a special function, gene fragments with the target function are usually inserted into the gene sequence or some gene fragments are inserted at certain special positions to make the gene express the target function; for example, shRNA is constructed on certain vectors. The usual method for constructing shRNA is to design primers, anneal them, and then perform T4 connection with the vector. This method is relatively complicated and time-consuming.

[0004] Therefore, there is an urgent need to provide a simple, feasible and rapid gene reconstruction method so as to quickly repair gene mutations or obtain genes with target functions. Summary of the invention

[0005] The purpose of the present invention is to provide a gene reconstruction method and its application. The method of the present invention is simple and feasible and has a high reconstruction success rate, and can be used in repairing mutant genes or constructing new functional genes.

[0006] The above objects of the present invention are achieved through the following technical solutions:

[0007] In a first aspect, the present invention provides a gene reconstruction method, wherein the gene reconstruction includes gene mutation repair and insertion of a short chain sequence, and the method comprises the following steps:

[0008] (1) Designing a long primer pair: Design a pair of forward primers and reverse primers that contain 30 to 50 bp of the upstream base sequence and 30 to 50 bp of the downstream base sequence of the site to be genetically reconstructed;

[0009] (2) Recombination: The forward primer and reverse primer designed in step (1) are mixed with the linearized vector of the gene to be reconstructed and then recombined; wherein, in the recombination reaction system, the concentration of the forward primer is (0.1-2) nM / μL, the concentration of the reverse primer is (0.1-2) nM / μL, and the concentration of the linearized vector of the gene to be reconstructed is (4-5) ng / μL.

[0010] In some embodiments of the present invention, when performing gene mutation repair, the base of the mutation site is included in the middle of the sequence of one of the forward primer and the reverse primer, and the complementary base of the mutation site is included in the middle of the sequence of the other. For example, when a mutant base of DNA single strand 1 in a double-stranded DNA (composed of DNA single strand 1 and NDA single strand 2) needs to be repaired, the sequence of the forward primer is 30 to 50 bp of the upstream base sequence of the mutant base of DNA single strand 1 + the mutant base + 30 to 50 bp of the downstream base sequence of the mutant base of DNA single strand 1, and the sequence of the reverse primer is 30 to 50 bp of the upstream base sequence of the complementary base of the mutant base of NDA single strand 2 + the complementary base of the mutant base + 30 to 50 bp of the downstream base sequence of the complementary base of the mutant base of NDA single strand 2.

[0011] In some embodiments of the present invention, when inserting a short-chain sequence, the sequence of one of the forward primer and the reverse primer contains a single-stranded sequence of the short-chain sequence in the middle, and the sequence of the other contains another single-stranded sequence of the short-chain sequence in the middle. For example, it is necessary to insert a short-chain double-stranded sequence (composed of DNA single strand 5 and NDA single strand 6) into a double-stranded DNA (composed of DNA single strand 3 and NDA single strand 4), and the sequence of the forward primer is 30 to 50 bp of the upstream base sequence of the site where NAD single strand 5 is to be inserted on single strand 3 + NAD single strand 5 + 30 to 50 bp of the downstream base sequence of the site where NAD single strand 5 is to be inserted on single strand 3; the sequence of the reverse primer is 30 to 50 bp of the upstream base sequence of the site where NAD single strand 6 is to be inserted on single strand 4 + NAD single strand 6 + 30 to 50 bp of the downstream base sequence of the site where NAD single strand 6 is to be inserted on single strand 4.

[0012] In some embodiments of the present invention, in the recombination reaction system, the concentrations of the forward primer and the reverse primer are the same.

[0013] In some embodiments of the present invention, in the recombination reaction system, the mass ratio of the forward primer, the reverse primer, and the linearized vector of the gene to be reconstructed is 1:1:4 to 1.6:1.6:4.

[0014] In some embodiments of the present invention, in step (2), the forward primer and the reverse primer are first dissolved and prepared into forward primer reagent and reverse primer reagent with a concentration of 0.6-7nM / μL, and then the forward primer reagent and the reverse primer reagent are mixed with the linearized vector of the gene to be reconstructed; preferably, sterile water is used for dissolution and dilution.

[0015] In some embodiments of the present invention, the short chain sequence is a sequence with a length of 1 to 60 bp.

[0016] In some embodiments of the present invention, the short-chain sequence includes any one or more of shRNA, direct repeat sequence and inverted repeat sequence, high GC content sequence and low GC content sequence.

[0017] In some embodiments of the present invention, the method further comprises step (3) transforming the recombinant product obtained in step (2) into competent cells; preferably, the transformation ratio is 10 to 20 μL of the recombinant product per 100 μL of competent cells.

[0018] In some embodiments of the present invention, the step (3) of transforming the recombinant product obtained in step (2) into competent cells specifically comprises the following steps:

[0019] (3-1) Mix the recombinant product obtained in step (2) with competent cells and place on ice for 5 to 7 minutes;

[0020] (3-2) subjecting the mixture obtained in step (3-1) to heat shock treatment in a 42° C. water bath; preferably, the heat shock time is 60 to 120 seconds; after the heat shock, the reaction product is immediately placed on ice for 60 to 180 seconds;

[0021] (3-3) Add antibiotic-free LB liquid culture medium to the reaction solution obtained in step (3-2), and then culture at 37°C for 30 to 60 minutes.

[0022] In some embodiments of the present invention, the method further comprises step (4) of expanding the culture of the cells obtained in step (3); preferably, the conditions for the expanded culture include: a culture temperature of 30 to 37° C. and a culture time of 12 to 16 hours.

[0023] In some embodiments of the present invention, step (4) includes first identifying the cell colonies obtained by preliminary culture, screening out colonies with positive clones as strains and then further expanding the culture.

[0024] In some embodiments of the present invention, the method further comprises obtaining a linearized vector of the gene to be reconstructed by PCR amplification reaction or enzyme cleavage reaction; preferably, the method further comprises gel recovery of the product obtained by PCR amplification reaction or enzyme cleavage reaction.

[0025] In some embodiments of the present invention, obtaining a linearized vector of the gene to be reconstructed by PCR amplification reaction includes designing a pair of universal primers according to the upstream base sequence and the downstream base sequence of the site to be reconstructed and using the primer pair to amplify the sequence to be reconstructed to obtain a double-stranded amplification product.

[0026] In some embodiments of the present invention, the universal primer is a pair of primers in which the sequence of the forward primer is identical to the upstream base sequence of the site to be genetically reconstructed, and the sequence of the reverse primer is identical to the downstream base sequence of the site to be genetically reconstructed. Preferably, the length of the universal primer is 10 to 30 bp.

[0027] In some embodiments of the present invention, obtaining the linearized vector of the gene to be reconstructed by enzyme digestion reaction includes using a double cutter to cut the vector from the site where the gene reconstruction is to be performed.

[0028] In some embodiments of the present invention, the products obtained from the PCR amplification reaction or the enzyme cleavage reaction are subjected to gel recovery; preferably, a DNA gel recovery kit is used for recovery; for example, a DNA gel recovery kit (safe and portable) produced by Beijing Qingke Biotechnology Co., Ltd. is used for gel recovery according to its instructions.

[0029] In some embodiments of the present invention, the products obtained by PCR amplification reaction or enzyme cleavage reaction are subjected to gel recovery, and the specific steps are as follows:

[0030] ① Place the adsorption column in a collection tube, add 250 μL Buffer BL, centrifuge at 12000×g for 1 min, and discard the waste liquid;

[0031] ② Cut the target DNA band from the amplified product, and try to remove the gel that does not contain the target DNA band. The smaller the gel volume, the better (when using ultraviolet light to cut the gel, in order to avoid damage to DNA caused by long ultraviolet exposure time, it is necessary to cut the gel quickly);

[0032] ③ Place the gel containing the target DNA band into a 2mL centrifuge tube and add 500μL Buffer GL (if the gel block is too large, the amount of Buffer GL added can be more than 500μL); then place the centrifuge tube in a 65℃ water bath for 4-6 minutes, invert it every 2-3 minutes to mix, until the gel in the centrifuge tube is completely melted and a light yellow solution is obtained (if the solution obtained after this step is light purple, continue to add an appropriate amount of Buffer GL and repeat the water bath and mixing steps until the solution turns light yellow);

[0033] ④ Transfer the solution obtained in step ③ into the adsorption column, centrifuge at 12000×g for 1 min, discard the waste liquid, and put the adsorption column back into the empty collection tube;

[0034] ⑤ Add 700 μL of Buffer W2 (168 mL of anhydrous ethanol was first added to Buffer W2) to the adsorption column, centrifuge at 12000 × g for 1 min, and discard the waste liquid;

[0035] ⑥Repeat step ⑤ once;

[0036] ⑦ Place the adsorption column back into the empty collection tube and centrifuge at 12000×g for 2 minutes;

[0037] ⑧Take out the adsorption column, place it in a clean 1.5mL centrifuge tube, add 40μL Eluent (preheat Eluent at 60℃) to the middle of the adsorption membrane, then place it in an environment of 20-25℃ for 2min, and centrifuge it at 12000×g for 2min. To ensure that a large amount of DNA is obtained, the solution obtained by centrifugation is transferred back to the adsorption column and centrifuged for 2min. The liquid part obtained by two centrifugations is recovered to obtain the linearized vector product.

[0038] In some embodiments of the present invention, the gene reconstruction method comprises the following steps:

[0039] (I) Designing a long primer pair: Designing a pair of forward primers and reverse primers containing 30 to 50 bp of upstream base sequence and 30 to 50 bp of downstream base sequence of the site to be genetically reconstructed;

[0040] (II) Linearization of the gene vector to be reconstructed: Using the vector containing the gene to be reconstructed as a template, a linearized vector of the gene to be reconstructed is obtained by PCR amplification reaction or enzyme digestion reaction followed by gel recovery;

[0041] (III) Recombination: the forward primer and reverse primer designed in step (I) are mixed with the linearized vector of the gene to be reconstructed obtained in step (II) and then recombined; wherein, in the recombination reaction system, the concentration of the forward primer is (0.1-2) nM / μL, the concentration of the reverse primer is (0.1-2) nM / μL, and the concentration of the linearized vector of the gene to be reconstructed is (4-5) ng / μL;

[0042] (IV) Transforming competent cells: transforming the recombinant product obtained in step (III) into competent cells; preferably, the transformation ratio is 10 to 20 μL of the recombinant product per 100 μL of competent cells;

[0043] (V) Cell culture: Expanding and culturing the cells obtained in step (IV); preferably, the conditions for the expanded culture include: a culture temperature of 30 to 37° C. and a culture time of 12 to 16 hours.

[0044] In a second aspect, the present invention provides an application of the method described in the first aspect in repairing mutant genes or constructing new functional genes.

[0045] In some embodiments of the present invention, the mutant gene includes a gene in which more than one base is mutated.

[0046] In some embodiments of the present invention, the constructing of a new functional gene includes constructing shRNA in the gene.

[0047] The beneficial effects of the present invention are as follows:

[0048] The present invention proposes a method for reconstructing genes by designing a long primer pair of appropriate length according to the upstream base sequence and the downstream base sequence of the site to be reconstructed, mixing the long primer pair with a linearized vector at a certain concentration to prepare a recombination reagent and performing a recombination reaction. The method is simple and feasible and has a high reconstruction success rate, and can be used in repairing mutant genes or constructing new functional genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 is a diagram showing the corresponding relationship between each primer pair and the linearized vector in Application Example 1;

[0050] Figure 2 It is a simplified flow chart of application embodiment 2. DETAILED DESCRIPTION

[0051] The following examples further illustrate the technology of the present invention. These examples are for illustration and example of the present invention and are not intended to limit the scope of the present invention in any form.

[0052] Example 1

[0053] A method for gene reconstruction by repairing mutant genes comprises the following steps:

[0054] (I) Design of long primer pairs: design a pair of forward primers and reverse primers containing the gene mutation site and 30 bp of the upstream base sequence and 30 bp of the downstream base sequence of the gene mutation site;

[0055] (II) Linearization of the gene vector to be reconstructed: Using the vector containing the gene to be reconstructed as a template, a linearized vector of the gene to be reconstructed is obtained by enzyme digestion followed by gel recovery;

[0056] (III) Recombination: mixing the forward primer and reverse primer designed in step (I) with the linearized vector of the gene to be reconstructed obtained in step (II) and performing recombination; wherein, in the recombination reaction system, the concentration of the forward primer is 0.1 nM / μL, the concentration of the reverse primer is 0.1 nM / μL, and the concentration of the linearized vector of the gene to be reconstructed is 4 ng / μL;

[0057] (IV) Transformation into competent cells: The recombinant product obtained in step (III) is transformed into competent cells at a transformation ratio of 10 μL of recombinant product per 100 μL of competent cells;

[0058] (V) Cell culture: The cells obtained in step (IV) are subjected to expanded culture; the conditions for the expanded culture include: a culture temperature of 30° C. and a culture time of 16 h.

[0059] Example 2

[0060] A method for gene reconstruction by repairing mutant genes comprises the following steps:

[0061] (I) Designing a long primer pair: designing a pair of forward primers and reverse primers containing the gene mutation site and 40 bp of the upstream base sequence and 40 bp of the downstream base sequence of the gene mutation site;

[0062] (II) Linearization of the gene vector to be reconstructed: Using the vector containing the gene to be reconstructed as a template, a PCR amplification reaction is performed followed by gel recovery to obtain the linearized vector of the gene to be reconstructed;

[0063] (III) Recombination: mixing the forward primer and reverse primer designed in step (I) with the linearized vector of the gene to be reconstructed obtained in step (II) and performing recombination; wherein, in the recombination reaction system, the concentration of the forward primer is 1 nM / μL, the concentration of the reverse primer is 1 nM / μL, and the concentration of the linearized vector of the gene to be reconstructed is 4.5 ng / μL;

[0064] (IV) Transformation into competent cells: The recombinant product obtained in step (III) is transformed into competent cells at a transformation ratio of 15 μL of the recombinant product per 100 μL of competent cells;

[0065] (V) Cell culture: The cells obtained in step (IV) are subjected to expansion culture, wherein the conditions for the expansion culture include: a culture temperature of 37° C. and a culture time of 12 h.

[0066] Example 3

[0067] A method for gene reconstruction by repairing mutant genes comprises the following steps:

[0068] (I) Design of long primer pairs: design a pair of forward primers and reverse primers containing the gene mutation site and 50 bp of the upstream and downstream base sequences of the gene mutation site;

[0069] (II) Linearization of the gene vector to be reconstructed: Using the vector containing the gene to be reconstructed as a template, a PCR amplification reaction is performed followed by gel recovery to obtain the linearized vector of the gene to be reconstructed;

[0070] (III) Recombination: mixing the forward primer and reverse primer designed in step (I) with the linearized vector of the gene to be reconstructed obtained in step (II) and performing recombination; wherein, in the recombination reaction system, the concentration of the forward primer is 2 nM / μL, the concentration of the reverse primer is 2 nM / μL, and the concentration of the linearized vector of the gene to be reconstructed is 5 ng / μL;

[0071] (IV) Transformation into competent cells: The recombinant product obtained in step (III) is transformed into competent cells at a transformation ratio of 20 μL of the recombinant product per 100 μL of competent cells;

[0072] (V) Cell culture: The cells obtained in step (IV) are subjected to expansion culture, wherein the conditions for the expansion culture include: a culture temperature of 37° C. and a culture time of 12 h.

[0073] Example 4

[0074] A method for gene reconstruction by inserting a short chain sequence comprises the following steps:

[0075] (I) Design of long primer pairs: Design a pair of forward primers and reverse primers containing 30 bp of the upstream base sequence and 30 bp of the downstream base sequence of the short chain sequence and the site where the short chain sequence is to be inserted;

[0076] (II) Linearization of the gene vector to be reconstructed: Using the vector containing the gene to be reconstructed as a template, a linearized vector of the gene to be reconstructed is obtained by enzyme digestion followed by gel recovery;

[0077] (III) Recombination: mixing the forward primer and reverse primer designed in step (I) with the linearized vector of the gene to be reconstructed obtained in step (II) and performing recombination; wherein, in the recombination reaction system, the concentration of the forward primer is 0.1 nM / μL, the concentration of the reverse primer is 0.1 nM / μL, and the concentration of the linearized vector of the gene to be reconstructed is 4 ng / μL;

[0078] (IV) Transformation into competent cells: The recombinant product obtained in step (III) is transformed into competent cells at a transformation ratio of 10 μL of recombinant product per 100 μL of competent cells;

[0079] (V) Cell culture: The cells obtained in step (IV) are subjected to expanded culture; the conditions for the expanded culture include: a culture temperature of 30° C. and a culture time of 16 h.

[0080] Example 5

[0081] A method for gene reconstruction by inserting a short chain sequence comprises the following steps:

[0082] (I) Design of long primer pairs: Design a pair of forward primers and reverse primers containing 40 bp of the upstream base sequence and 40 bp of the downstream base sequence of the short chain sequence and the site where the short chain sequence is to be inserted;

[0083] (II) Linearization of the gene vector to be reconstructed: Using the vector containing the gene to be reconstructed as a template, a PCR amplification reaction is performed followed by gel recovery to obtain the linearized vector of the gene to be reconstructed;

[0084] (III) Recombination: mixing the forward primer and reverse primer designed in step (I) with the linearized vector of the gene to be reconstructed obtained in step (II) and performing recombination; wherein, in the recombination reaction system, the concentration of the forward primer is 1 nM / μL, the concentration of the reverse primer is 1 nM / μL, and the concentration of the linearized vector of the gene to be reconstructed is 4.5 ng / μL;

[0085] (IV) Transformation into competent cells: The recombinant product obtained in step (III) is transformed into competent cells at a transformation ratio of 15 μL of the recombinant product per 100 μL of competent cells;

[0086] (V) Cell culture: The cells obtained in step (IV) are subjected to expansion culture, wherein the conditions for the expansion culture include: a culture temperature of 37° C. and a culture time of 12 h.

[0087] Example 6

[0088] A method for gene reconstruction by inserting a short chain sequence comprises the following steps:

[0089] (I) Design of long primer pairs: Design a pair of forward primers and reverse primers containing 50 bp of the upstream base sequence and 50 bp of the downstream base sequence of the short chain sequence and the site where the short chain sequence is to be inserted;

[0090] (II) Linearization of the gene vector to be reconstructed: Using the vector containing the gene to be reconstructed as a template, a PCR amplification reaction is performed followed by gel recovery to obtain the linearized vector of the gene to be reconstructed;

[0091] (III) Recombination: mixing the forward primer and reverse primer designed in step (I) with the linearized vector of the gene to be reconstructed obtained in step (II) and performing recombination; wherein, in the recombination reaction system, the concentration of the forward primer is 2 nM / μL, the concentration of the reverse primer is 2 nM / μL, and the concentration of the linearized vector of the gene to be reconstructed is 5 ng / μL;

[0092] (IV) Transformation into competent cells: The recombinant product obtained in step (III) is transformed into competent cells at a transformation ratio of 20 μL of the recombinant product per 100 μL of competent cells;

[0093] (V) Cell culture: The cells obtained in step (IV) are subjected to expansion culture, wherein the conditions for the expansion culture include: a culture temperature of 37° C. and a culture time of 12 h.

[0094] Application Example 1 (Repair of base T to base A on the LacZa gene on the PUC19 cloning vector)

[0095] Compared to the correct gene, the PUC19 plasmid has a mutation at the 96th base of the LacZ gene, and the base T needs to be repaired to the base A.

[0096] In order to investigate the effect of primers of different lengths on the repair effect, three pairs of primers of different lengths were designed. The three pairs of primers were designed according to the base position of the gene mutation, including the gene of the gene mutation site and the upstream base sequence and the downstream base sequence of the gene mutation site. Among them, the first pair of primers is a primer pair containing 30 bp of the upstream base sequence and the downstream base sequence of the gene mutation site. The forward repair primer and the reverse repair primer of the first pair of primers are named PUC19-60bp-XF-F, ... F-R; the second pair of primers is a primer pair containing 40 bp of the upstream base sequence and the downstream base sequence of the gene mutation site, and the forward repair primer and the reverse repair primer of the second pair of primers are named PUC19-80bp-XF-F and PUC19-80bp-XF-R respectively; the third pair of primers is a primer pair containing 50 bp of the upstream base sequence and the downstream base sequence of the gene mutation site, and the forward repair primer and the reverse repair primer of the third pair of primers are named PUC19-100bp-XF-F and PUC19-100bp-XF-R respectively.

[0097] The sequence of the forward repair primer PUC19-60bp-XF-F is:

[0098] ctcgaattcactggccgtcgttttacaacgAcgtgactgggaaaaccctggcgttaccca

[0099] The sequence of the reverse repair primer PUC19-60bp-XF-R is:

[0100] tgggtaacgccagggttttcccagtcacgTcgttgtaaaacgacggccagtgaattcgag

[0101] The sequence of the forward repair primer PUC19-80bp-XF-F is:

[0102] ggtaccgagctcgaattcactggccgtcgttttacaacgAcgtgactgggaaaaccctggcgttacccaacttaatcgcc

[0103] The sequence of the reverse repair primer PUC19-80bp-XF-R is:

[0104] ggcgattaagttgggtaacgccagggttttcccagtcacgTcgttgtaaaacgacggccagtgaattcgagctcggtacc

[0105] The sequence of the forward repair primer PUC19-100bp-XF-F is:

[0106] aggatccccgggtaccgagctcgaattcactggccgtcgttttacaacgAcgtgactgggaaaaccctggcgttacccaac

[0107] ttaatcgccttgcagcaca

[0108] The sequence of the reverse repair primer PUC19-100bp-XF-R is:

[0109] tgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgTcgttgtaaaacgacggccagtgaattcgagc

[0110] tcggtacccggggatcct

[0111] In order to investigate the effect of primers of different concentrations on the repair effect, 10 μM dry powder of the forward repair primer and the reverse repair primer of the above three pairs of primers were taken respectively, 300 μL of sterile water was added to each to dissolve the dry powder to obtain the primer reagent stock solution, and then each primer reagent stock solution was diluted 5 times, 25 times, and 50 times, respectively, to obtain a total of 24 primer reagents.

[0112] The primer reagents obtained above are used to perform base repair according to the following steps:

[0113] (1) Using the plasmid containing the mutant gene as a template, designing a 25 bp forward amplification primer PUC19-TB-F and a reverse amplification primer PUC19-TB-R for amplifying the template plasmid according to the upstream base sequence and the downstream base sequence of the mutation site, respectively, using the designed amplification primers to prepare an amplification reagent according to Table 1 and amplifying the plasmid containing the mutant gene according to the amplification program in Table 2;

[0114] Table 1 Amplification reagents

[0115] Components volume Plasmid containing mutant gene (about 10ng / μL) 1.0μL PUC19-TB-F (about 100 nmol / μL) 1.5μL PUC19-TB-R (about 100 nmol / μL) 1.5μL Polymerase (2X T8 High-Fidelity Master Mix) 25.0μL <![CDATA[ddH 2 The]]> 21.0μL

[0116] Table 2 Amplification procedures

[0117]

[0118] In Table 2, 20s / Kb means that the reaction was performed for 20s per Kb according to the length of the plasmid containing the mutant gene.

[0119] The sequence of the forward amplification primer PUC19-TB-F is: cgtgactgggaaaaccctggcgtta

[0120] The sequence of the reverse amplification primer PUC19-TB-R is: cgttgtaaaacgacggccagtgaat

[0121] The corresponding relationship between each primer pair and the linearized vector in this application example is shown in FIG. Figure 1 shown.

[0122] (2) The product amplified in step (1) is subjected to gel recovery using a DNA gel recovery kit (safe and portable) produced by Beijing Qingke Biotechnology Co., Ltd. according to its instructions to obtain a linearized vector product. The specific steps are as follows:

[0123] ① Place the adsorption column in a collection tube, add 250 μL Buffer BL, centrifuge at 12000×g for 1 min, and discard the waste liquid;

[0124] ② Cut the target DNA band from the amplified product and try to remove the gel that does not contain the target DNA band;

[0125] ③Put the gel containing the target DNA band into a 2mL centrifuge tube and add 500μL Buffer GL; then place the centrifuge tube in a 65℃ water bath for 4-6 minutes, inverting it every 2-3 minutes to mix until the gel in the centrifuge tube is completely melted to obtain a light yellow solution;

[0126] ④ Transfer the solution obtained in step ③ into the adsorption column, centrifuge at 12000×g for 1 min, discard the waste liquid, and put the adsorption column back into the empty collection tube;

[0127] ⑤ Add 700 μL Buffer W2 (add 168 mL of anhydrous ethanol to Buffer W2) to the adsorption column, centrifuge at 12000×g for 1 min, and discard the waste liquid;

[0128] ⑥Repeat step ⑤ once;

[0129] ⑦ Place the adsorption column back into the empty collection tube and centrifuge at 12000×g for 2 minutes;

[0130] ⑧Take out the adsorption column and place it in a clean 1.5mL centrifuge tube. Add 40μL of 60℃ Eluent to the middle part of the adsorption membrane, then place it in an environment of 20-25℃ for 2min, and centrifuge it at 12000×g for 2min. Transfer the solution obtained by centrifugation back into the adsorption column and centrifuge it for 2min. Recover the liquid parts obtained by two centrifugations and combine them to obtain the linearized vector product.

[0131] (3) Use the designed three pairs of primers of different lengths and the linearized vector (concentration of 40 ng / μL) obtained in step (2) to perform homologous recombination. The recombination reaction conditions are: 50°C for 30 min, 4°C forever; the recombination reaction system (18 μL) includes: 4.0 μL of forward repair primer, 4.0 μL of reverse repair primer, 2.0 μL of linearized vector, 8.0 μL of homologous recombination enzyme, the forward repair primer and the reverse repair primer used in the same recombination reaction system are a pair of primers (i.e., the length of the forward repair primer is the same as the length of the reverse repair primer), and the concentration of the forward repair primer is equal to the concentration of the reverse repair primer; use the 24 primer reagents prepared above to prepare 12 different recombination reaction systems, and make these 12 different recombination reaction systems react according to the recombination reaction conditions to obtain 12 recombination products.

[0132] (4) Each of the 12 recombinant products obtained in step (3) is transformed into a DH5a competent cell to obtain 12 competent cells containing the recombinant product. The specific steps for transforming each recombinant product into a DH5a competent cell are as follows:

[0133] 1) Take 100 μL of competent cells into a reaction tube and place the reaction tube in an ice bath. After the competent cells melt, add 18 μL of the recombinant product obtained in step (3) into the reaction tube, shake gently and place on ice for 6 minutes;

[0134] 2) Place the reaction tube of step 1) in a 42°C water bath for 90 seconds, and immediately place on ice for 2 minutes after heat shock;

[0135] 3) Add 700 μL of antibiotic-free LB liquid culture medium to the reaction tube in step 2), mix well, and culture at 37°C with gentle shaking for 45 min;

[0136] 4) Take 25 μL of the LB bacterial solution obtained in step 3) and spread it on a plate, then place it in a 37°C incubator and culture it overnight for 14 hours;

[0137] 5) performing PCR identification on the colonies cultured in step 4) to screen out colonies with positive clones;

[0138] 6) The colonies with positive clones obtained by screening in step 5) are sent for sequencing.

[0139] The results of step 5) bacterial testing and step 6) sequencing are shown in Tables 3, 4, and 5. As can be seen from Table 3, the repair effect of point mutation repair using the first pair of primers is the best; as can be seen from Tables 4 and 5, the best effect is achieved by using a 25-fold dilution of the primer stock solution and the linearized vector for homologous recombination.

[0140] Table 3 Repair effects of primers of different lengths on the same dilution factor

[0141]

[0142] Table 4 Repair effect of different dilution multiples of the first pair of primers

[0143]

[0144] In Table 4, Y-CZ-PUC19-60-F+R indicates that the PUC19-60bp-XF-F and PUC19-60bp-XF-R primer stock solutions were used to perform homologous recombination with the linearized vector, 5-CZ-PUC19-60-F+R indicates that the 5-fold dilution of the PUC19-60bp-XF-F and PUC19-60bp-XF-R primer stock solutions were used to perform homologous recombination with the linearized vector, and 25- CZ-PUC19-60-F+R means that a 25-fold dilution of the original primer solution of PUC19-60bp-XF-F and PUC19-60bp-XF-R is used for homologous recombination with the linearized vector, and 50-CZ-PUC19-60-F+R means that a 50-fold dilution of the original primer solution of PUC19-60bp-XF-F and PUC19-60bp-XF-R is used for homologous recombination with the linearized vector.

[0145] Table 5 Repair effect of the second pair of primers at different dilution multiples

[0146]

[0147] In Table 5, Y-CZ-PUC19-80-F+R indicates that the PUC19-80bp-XF-F and PUC19-80bp-XF-R primer stock solutions were used to perform homologous recombination with the linearized vector, 5-CZ-PUC19-80-F+R indicates that the 5-fold dilution of the PUC19-80bp-XF-F and PUC19-80bp-XF-R primer stock solutions were used to perform homologous recombination with the linearized vector, and 25- CZ-PUC19-80-F+R means that a 25-fold dilution of the original primer solution of PUC19-80bp-XF-F and PUC19-80bp-XF-R is used for homologous recombination with the linearized vector, and 50-CZ-PUC19-80-F+R means that a 50-fold dilution of the original primer solution of PUC19-80bp-XF-F and PUC19-80bp-XF-R is used for homologous recombination with the linearized vector.

[0148] Application Example 2 (shRNA Construction into pLKO.1-CMV-copGFP-PURO-0801)

[0149] A forward primer and a reverse primer containing the shRNA target sequence were designed according to the intended shRNA construction site; wherein the pair of primers contained the shRNA sequence and 30 bp of the upstream base sequence and the downstream base sequence of the intended shRNA construction site, the forward primer was named 21184-CMV-F, and the reverse primer was named 21184-CMV-R.

[0150] The sequence of the forward primer 21184-CMV-F is:

[0151] CTTTATATATCTTGTGGAAAGGACGAAACACCGGTTAAAGTCAAAGAGGG

[0152] CTCGCCTCGAGGCGAGCCCTCTTTGACTTTAATTTTTTAATTCTCGACCTCG

[0153] AGACAAATGGCAGTAT

[0154] The sequence of the reverse primer 21184-CMV-R is:

[0155] ATACTGCCATTTGTCTCGAGGTCGAGAATTAAAAAAATTAAAGTCAAAGAG

[0156] GGCTCGCCTCGAGGCGAGCCCTCTTTGACTTTAACCGGTGTTTCGTCCTTTC

[0157] CACAAGATATATAAAG

[0158] In order to investigate the effect of different concentrations of primers on the repair effect, 10 μM dry powder of the forward primer 21184-CMV-F and the reverse primer 21184-CMV-R were taken, 300 μL of sterile water was added to each to dissolve the dry powder to obtain the primer reagent stock solution, and then each primer reagent stock solution was diluted 25 times and 50 times, respectively, to obtain a total of 6 primer reagents.

[0159] Use the primer reagents obtained above to construct shRNA into

[0160] pLKO.1-CMV-copGFP-PURO-0801 (Simplified process diagram as shown in Figure 2 shown):

[0161] (1) The plasmid pLKO.1-CMV-copGFP-PURO-0801 was treated with AgeI and EcoRI, wherein the enzyme treatment system is shown in Table 6, and the reaction procedure of the enzyme treatment is shown in Table 7;

[0162] Table 6 Enzyme digestion system

[0163] Components volume Plasmid (about 200ng / μL) 15.0μL AgeI 1.5μL EcoRI 1.5μL Buffer 5.0μL <![CDATA[ddH 2 The]]> 27.0μL

[0164] Table 7 Reaction procedures for enzyme digestion

[0165] Reaction temperature Reaction time 37℃ 2h 65℃ 20min 4℃ forever

[0166] (2) The product obtained by the enzyme digestion treatment in step (1) is subjected to gel recovery using a DNA gel recovery kit (safe and portable) produced by Beijing Qingke Biotechnology Co., Ltd. according to its instructions to obtain a linearized vector product. The specific steps are as follows:

[0167] ① Place the adsorption column in a collection tube, add 250 μL Buffer BL, centrifuge at 12000×g for 1 min, and discard the waste liquid;

[0168] ② Cut the target DNA band from the product obtained by enzyme digestion, and try to remove the gel that does not contain the target DNA band;

[0169] ③Put the gel containing the target DNA band into a 2mL centrifuge tube and add 500μL Buffer GL; then place the centrifuge tube in a 65℃ water bath for 4-6 minutes, inverting it every 2-3 minutes to mix until the gel in the centrifuge tube is completely melted to obtain a light yellow solution;

[0170] ④ Transfer the solution obtained in step ③ into the adsorption column, centrifuge at 12000×g for 1 min, discard the waste liquid, and put the adsorption column back into the empty collection tube;

[0171] ⑤ Add 700 μL Buffer W2 (add 168 mL of anhydrous ethanol to Buffer W2) to the adsorption column, centrifuge at 12000×g for 1 min, and discard the waste liquid;

[0172] ⑥Repeat step ⑤ once;

[0173] ⑦ Place the adsorption column back into the empty collection tube and centrifuge at 12000×g for 2 minutes;

[0174] ⑧Take out the adsorption column and place it in a clean 1.5mL centrifuge tube. Add 40μL of 60℃ Eluent to the middle part of the adsorption membrane, then place it in an environment of 20-25℃ for 2min, and centrifuge it at 12000×g for 2min. Transfer the solution obtained by centrifugation back into the adsorption column and centrifuge it for 2min. Recover the liquid parts obtained by two centrifugations and combine them to obtain the linearized vector product.

[0175] (3) Use the designed primers and the linearized vector obtained in step (2) (concentration of 40ng / μL) for homologous recombination. The recombination reaction conditions are: 50℃30min, 4℃forever; the recombination reaction system (18μL) includes: 4.0μL forward primer, 4.0μL reverse primer, 2.0μL linearized vector, 8.0μL homologous recombination enzyme, and the concentration of the forward primer in the same recombination reaction system is equal to the concentration of the reverse primer; use the 6 primer reagents prepared above to prepare 3 different recombination reaction systems, and make these 3 different recombination reaction systems react according to the recombination reaction conditions to obtain 3 recombination products.

[0176] (4) Each of the three recombinant products obtained in step (3) is transformed into a DH5a competent cell to obtain three competent cells containing the recombinant products. The specific steps for transforming each recombinant product into a DH5a competent cell are as follows:

[0177] 1) Take 100 μL of competent cells into a reaction tube and place the reaction tube in an ice bath. After the competent cells melt, add 18 μL of the recombinant product obtained in step (3) into the reaction tube, shake gently and place on ice for 6 minutes;

[0178] 2) Place the reaction tube of step 1) in a 42°C water bath for 90 seconds, and immediately place on ice for 2 minutes after heat shock;

[0179] 3) Add 700 μL of antibiotic-free LB liquid culture medium to the reaction tube in step 2), mix well, and culture at 37°C with gentle shaking for 45 min;

[0180] 4) Take 25 μL of the LB bacterial solution obtained in step 3) and spread it on a plate, then place it in a 37°C incubator and culture it overnight for 14 hours;

[0181] 5) performing PCR identification on the colonies cultured in step 4) to screen out colonies with positive clones;

[0182] 6) The colonies with positive clones obtained by screening in step 5) are sent for sequencing.

[0183] The results of step 5) bacterial testing and step 6) sequencing are shown in Table 8.

[0184] Table 8 Construction results of primer pairs with different concentrations

[0185]

[0186] In Table 8, Y-21184-CMV F+R indicates that homologous recombination was carried out between 21184-CMV-F and 21184-CMV-R primer stock solutions and the linearized vector, 25-21184-CMV F+R indicates that homologous recombination was carried out between 21184-CMV-F and 21184-CMV-R primer stock solutions and the linearized vector, and 50-21184-CMV F+R indicates that homologous recombination was carried out between 50-fold dilutions of 21184-CMV-F and 21184-CMV-R primer stock solutions and the linearized vector.

[0187] The specific process of step 5) in the above embodiment 1 and embodiment 2 is as follows:

[0188] 1. Single colony picking

[0189] Pour LB medium into the gun slot, then use the gun to add 400 μL of LB medium to the 48-well deep-well plate, use tweezers to take the sterilized small white gun tip to pick up the single colony on the plate in step 4) and put it into the 48-well deep-well plate, and at the same time, make a record on the 48-well deep-well plate and the corresponding bacterial inspection form. The 48-well deep-well plate and the bacterial inspection form correspond one to one. Cover the selected 48-well deep-well plate with sealing film and make corresponding marks (date, plate number, etc.), use a hole puncher to punch holes in the sealing film, and place it on a 37°C shaker for 1 hour.

[0190] 2. Colony PCR Reaction

[0191] Design forward bacterial detection primer F and reverse bacterial detection primer R in advance according to the target sequence and vector; wherein, the sequence of the forward bacterial detection primer F used in Example 1 is: gcaacgcaattaatgtgagttagct, and the sequence of the reverse bacterial detection primer R is: gcgacacggaaatgttgaatactca; the sequence of the forward bacterial detection primer F used in Example 2 is: ctcgacggtatcgatcacgaga, and the sequence of the reverse bacterial detection primer R is: acttgatgtactgccaagtggg. Prepare 50 μL of PCR reaction system according to Table 9, add the prepared reaction solution to the 96-well reaction plate respectively, and make sure to mark the 96-well reaction plate. Place the 96-well reaction plate on the PCR instrument, cover it with a rubber pad, and react according to the PCR reaction program in Table 10.

[0192] Table 9 Bacteria detection PCR reaction system

[0193]

[0194]

[0195] Table 10 Bacteria detection PCR reaction program

[0196]

[0197] In Table 10, 20s / Kb means that the reaction time is 20s per Kb according to the length of the gene to be amplified.

[0198] 3. Agarose Gel Electrophoresis

[0199] Weigh 1.2 g of agarose and add 100 mL of TAE to prepare agarose gel. Take 10 μL of the 96-well reaction plate after PCR reaction in step 2 and spot it. Take a photo of the agarose gel after electrophoresis, name it and save it. Determine whether there is a positive clone based on the bands in the agarose gel electrophoresis.

[0200] It should be noted that the embodiments described above are only used to explain the present invention and do not constitute any limitation of the present invention. The present invention has been described with reference to the embodiments, but it should be understood that the words used therein are descriptive and explanatory words, rather than restrictive words. The present invention may be modified as specified within the scope of the claims of the present invention, and the present invention may be revised without departing from the scope and spirit of the present invention. Although the present invention described therein relates to specific methods, materials and embodiments, it does not mean that the present invention is limited to the specific examples disclosed therein, on the contrary, the present invention can be extended to all other methods and applications with the same functions.

Claims

1. A gene reconstruction method, characterized in that: The gene reconstruction includes gene mutation repair and insertion of short chain sequences, and the method includes the following steps: (1) Designing a long primer pair: Design a pair of forward primers and reverse primers that contain 30 to 50 bp of the upstream base sequence and 30 to 50 bp of the downstream base sequence of the site to be genetically reconstructed; (2) Recombination: The forward primer and reverse primer designed in step (1) are mixed with the linearized vector of the gene to be reconstructed and then recombined; wherein, in the recombination reaction system, the concentration of the forward primer is (0.1-2) nM / μL, the concentration of the reverse primer is (0.1-2) nM / μL, and the concentration of the linearized vector of the gene to be reconstructed is (4-5) ng / μL.

2. The method according to claim 1, characterized in that When repairing a gene mutation, the middle of the sequence of one of the forward primer and the reverse primer contains the base of the mutation site, and the middle of the sequence of the other primer contains the complementary base of the mutation site; And / or, when inserting a short chain sequence, the sequence of one of the forward primer and the reverse primer contains a single-stranded sequence of the short chain sequence in the middle, and the sequence of the other primer contains another single-stranded sequence of the short chain sequence in the middle.

3. The method according to claim 1 or 2, characterized in that: In the recombination reaction system, the concentrations of the forward primer and the reverse primer are the same; And / or, in the recombination reaction system, the mass ratio of the forward primer, the reverse primer, and the linearized vector of the gene to be reconstructed is 1:1:4 to 1.6:1.6:

4.

4. The method according to any one of claims 1 to 3, characterized in that In the step (2), the forward primer and the reverse primer are first dissolved and prepared into forward primer reagent and reverse primer reagent with a concentration of 0.6-7 nM / μL, and then the forward primer reagent and the reverse primer reagent are mixed with the linearized vector of the gene to be reconstructed; preferably, sterile water is used for dissolution and dilution.

5. The method according to any one of claims 1 to 4, characterized in that: The method further comprises step (3) of transforming the recombinant product obtained in step (2) into competent cells; preferably, the transformation ratio is 10 to 20 μL of the recombinant product per 100 μL of competent cells.

6. The method according to claim 5, characterized in that In step (3), transforming the recombinant product obtained in step (2) into competent cells specifically comprises the following steps: (3-1) Mix the recombinant product obtained in step (2) with competent cells and place on ice for 5 to 7 minutes; (3-2) subjecting the mixture obtained in step (3-1) to heat shock treatment in a 42° C. water bath; preferably, the heat shock time is 60 to 120 seconds; after the heat shock, the reaction product is immediately placed on ice for 60 to 180 seconds; (3-3) Add antibiotic-free LB liquid culture medium to the reaction solution obtained in step (3-2), and then culture at 37°C for 30 to 60 minutes.

7. The method according to claim 5 or 6, characterized in that: The method further comprises step (4) of expanding the culture of the cells obtained in step (3); preferably, the conditions of the expanded culture include: a culture temperature of 30 to 37° C. and a culture time of 12 to 16 hours.

8. The method according to any one of claims 1 to 7, characterized in that: The method further comprises obtaining a linearized vector of the gene to be reconstructed by PCR amplification reaction or enzyme cleavage reaction; preferably, the method further comprises gel recovery of the product obtained by the PCR amplification reaction or enzyme cleavage reaction.

9. The method according to claim 8, characterized in that Obtaining a linearized vector of the gene to be reconstructed by PCR amplification reaction includes designing a pair of universal primers according to the upstream base sequence and the downstream base sequence of the site to be reconstructed and using the primer pair to amplify the sequence to be reconstructed to obtain a double-stranded amplification product; And / or, obtaining the linearized vector of the gene to be reconstructed by enzyme digestion reaction includes using a double cutter to cut the vector from the site where the gene reconstruction is to be performed.

10. Use of the method according to any one of claims 1 to 9 in repairing a mutant gene or constructing a new functional gene.

Images