Specific primer of molecular marker of ujimqin sheep fertility related gene tgf-beta1 and application thereof

Abstract

The application belongs to the field of molecular biology, and particularly relates to a specific primer of a molecular marker of a Wuzhumuqin sheep fertility related gene TGF-beta 1 and application thereof. The specific primer of the molecular marker of the Wuzhumuqin sheep fertility related gene TGF-beta 1 has the primer sequence shown in SEQ ID NO. 1 and SEQ ID NO. 2. The application designs the specific primer, detects whether a C->T mutation exists at a 312bp position of a TGF-beta 1 gene coding region in a Wuzhumuqin sheep genome, determines a genotype of a Wuzhumuqin sheep individual at the site, realizes single nucleotide polymorphism detection of a TGF-beta 1 gene c.312C>T, and compares polymorphism of the TGF-beta 1 gene c.312C>T in a Wuzhumuqin sheep breed. The application uses TGF-beta 1 gene c.312C>T polymorphism to assist Wuzhumuqin sheep breeding, improves lambing number of the Wuzhumuqin sheep, and can be used as an effective method for assisting improvement of a Wuzhumuqin sheep multiple pregnancy trait.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology, and particularly relates to a specific primer of a molecular marker of a Ujimqin sheep fertility related gene TGF-β1 and application thereof. BACKGROUND

[0002] The Ujimqin sheep is produced in the Ujimqin grassland in the east of Xilingol League, Inner Mongolia, and mainly distributed in the east and west Ujimqin banners, etc. The Ujimqin sheep is suitable for year-round grazing and feeding, has the characteristics of fast weight gain, strong fat accumulation capacity, high meat yield, early sexual maturity, etc., is suitable for grazing and fattening or planned fat lamb production during the growth period of pasture. At the same time, the Ujimqin sheep is also a good recipient sheep for purebred breeding embryo transfer. The offspring lambs have strong disease resistance and good adaptability. The Ujimqin sheep has formed an excellent population through long-term local selection.

[0003] TGF-β1 (transforming growth factor beta 1) belongs to the transforming growth factor beta (TGF-β) superfamily member, and the TGF-β1 signaling pathway participates in the attachment of the trophoblast and the endometrium as a molecular mechanism, and plays an important role in maintaining successful pregnancy. The TGF-β1 gene of sheep is located on chromosome 14, contains 7 exons, the coding region is 1194 bp long, and encodes 397 amino acids. TGF-β1 widely participates in the regulation of important physiological processes such as embryonic development, stem cell renewal and differentiation, reproductive cell and somatic cell proliferation and apoptosis, tissue fibrosis, immune response and various pathologies. Notably, TGF-β1 plays an important role in the reproductive physiology of female animals, is highly expressed in various ovarian cell types, and can be used as an important intrafollicular regulatory factor to regulate cell proliferation and differentiation, hormone secretion, follicular angiogenesis and granulosa luteinization in a paracrine or autocrine manner. In addition, TGF-β1 participates in the regulation of maintaining the primordial follicle pool and normal ovarian function. The physiological function of TGF-β1 in the ovary depends on the classic downstream signal transduction factor SMAD, and also involves other non-classical pathways such as p38, ERK1 / 2 and S6K1 / rpS6 signaling pathways. SUMMARY

[0004] The present application aims to provide a specific primer of a molecular marker of a Ujimqin sheep fertility related gene TGF-β1.

[0005] The present application further aims to provide the application of the specific primer.

[0006] The application adopts DNA sequencing technology to detect whether a C→T mutation exists at 312bp of the coding region of TGF-β1 gene in the genome of Ujimqin sheep, and determines the genotype of the individual Ujimqin sheep at the site, detects the single nucleotide polymorphism of TGF-β1 gene c.312C>T, compares the polymorphism of TGF-β1 gene c.312C>T in the Ujimqin sheep breed, and judges that c.312C>T is a molecular marker related to the multiple pregnancy trait of Ujimqin sheep.

[0007] The nucleotide sequence of Ujimqin sheep TGF-β1 gene c.312C>T is the region from 50043066bp to 50062674bp of sheep chromosome 14 of NCBI Reference Sequence NC_056067.1.

[0008] The specific primer of the molecular marker of the Ujimqin sheep fertility-related gene TGF-β1 according to the specific embodiment of the application has the following sequences:

[0009] SEQ ID NO. 1: 5'-ACCCTCCTACCTTTTCCTCG-3';

[0010] SEQ ID NO. 2: 5'-AAGCGGTCCACTTCACTCAC-3'.

[0011] The specific primer of the molecular marker of the Ujimqin sheep fertility-related gene TGF-β1 of the application can be applied to a kit for detecting the multiple pregnancy trait of Ujimqin sheep, or applied to assist in Ujimqin sheep breeding.

[0012] Preferably, the application provides the application of the specific primer of the molecular marker of the Ujimqin sheep fertility-related gene TGF-β1 in assisting in judging the fertility of Mongolian sheep.

[0013] Preferably, the application provides a kit for detecting the multiple pregnancy trait of Ujimqin sheep, which comprises the specific primer. More preferably, the kit comprises 1μL of the specific primer, 1μL of the template, 10μL of the premix, and 7μL of deionized water. The PCR amplification procedure suitable for the kit is 95℃ pre-denaturation for 5min, 98℃ denaturation for 10s, 58℃ annealing for 5s, 68℃ extension for 5s, 35 cycles, 72℃ extension for 3s, 4℃ preservation, and then sequencing.

[0014] The method for screening Ujimqin sheep with high fertility according to the specific embodiment of the application comprises the step of amplifying the genomic DNA of Ujimqin sheep by using the specific primer.

[0015] Specifically, the method for screening the high-fertility Ujimqin sheep according to the specific embodiment of the application comprises the following steps:

[0016] (1) extracting the genomic DNA of the Ujimqin sheep to be tested;

[0017] (2) taking the genomic DNA of the Ujimqin sheep extracted in step (1) as a template, performing PCR amplification with specific primers, and obtaining an amplification product;

[0018] (3) judging the genotype of the nucleotide at position 312 of the TGF-β1 gene in the genome of the Ujimqin sheep in the amplification product, and selecting the Ujimqin sheep with the genotype TT at position 312 of the coding region of the TGF-β1 gene as the parent for breeding.

[0019] The method for detecting the c.312C>T SNP of the TGF-β1 gene in the genome of the Ujimqin sheep comprises the following steps:

[0020] amplifying the fragment of the nucleotide at positions 50043066bp to 50062674bp of the TGF-β1 gene of the Ujimqin sheep with GenBank Accession Number NC_056067.1 by using the PCR method, and performing DNA sequencing on the amplification product;

[0021] if a single peak appears at the position of the 50061764th base of chromosome 14 and the genotype is C, the genotype is CC,

[0022] if a double peak appears at the position of the 50061764th base of chromosome 14, the genotype is CT, and if a single peak appears at the position of the 50061764th base of chromosome 14 and the genotype is T, the genotype is TT.

[0023] The average number of lambs born by the Ujimqin sheep with the genotype TT is higher than that of the Ujimqin sheep with the genotype CT, and the average number of lambs born by the Ujimqin sheep with the genotype CT is higher than that of the Ujimqin sheep with the genotype CC.

[0024] In the application, the fertility of the Ujimqin sheep is specifically embodied as the number of lambs produced per pregnancy.

[0025] In the method for screening the high-fertility Ujimqin sheep according to the specific embodiment of the application, when performing the PCR amplification in step (2), the total volume of the amplification system is 20μL, wherein 1μL of the upstream primer and 1μL of the downstream primer, 1μL of the template, 10μL of the premix, and 7μL of the deionized water.

[0026] According to the method for screening the high-reproductive Ujimqin sheep according to the specific embodiment of the application, the PCR amplification procedure in step (2) is 5 min of pre-denaturation at 95 DEG C, 10 s of denaturation at 98 DEG C, 5 s of annealing at 58 DEG C, 5 s of extension at 68 DEG C, 35 cycles, 3 s of extension at 72 DEG C, and 4 DEG C storage, and then sequencing.

[0027] The application has the following beneficial effects:

[0028] The application finds that the nucleotide sequence NCBI Reference Sequence of the region from 50043066 bp to 50062674 bp of the 14th chromosome of the sheep of the Ujimqin sheep multiple pregnancy trait related molecular marker exists in the c.312C>T of the TGF-β1 gene.

[0029] The application designs specific primers, adopts the DNA sequencing technology to detect whether the C→T mutation exists at the 312 bp of the coding region of the TGF-β1 gene in the genome of the Ujimqin sheep, determines the genotype of the Ujimqin sheep individual at the site, realizes the single nucleotide polymorphism detection of the c.312C>T of the TGF-β1 gene, and compares the polymorphism of the c.312C>T of the TGF-β1 gene in the Ujimqin sheep breed.

[0030] The data statistical result shows that the specific primers of the application can detect the molecular marker, so that the specific primers can be used for assisting the Ujimqin sheep breeding, screening the high-reproductive Ujimqin sheep, and improving the lambing number of the Ujimqin sheep, and the method of the application can be used as an effective method for assisting the improvement or screening of the multiple pregnancy trait of the Ujimqin sheep. BRIEF DESCRIPTION OF DRAWINGS

[0031] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description only show some embodiments of the application, and for those skilled in the art, other drawings can also be obtained without creative labor based on these drawings.

[0032] Figure 1 It is the PCR product diagram of the NC_056067.1:c.312C>T of the TGF-β1 of the application.

[0033] Figure 2 It is the sequencing result diagram of the NC_056067.1:c.312C>T of the TGF-β1 of the application. DETAILED DESCRIPTION

[0034] In order to make the objectives, technical solutions and advantages of the present application clearer, the technical solutions of the present application will be described in detail below. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work belong to the scope of protection of the present application.

[0035] Example 1: Establishing a method for detecting molecular markers of the multiple birth trait of Ujimqin sheep

[0036] 1) Template material preparation

[0037] Blood samples of Ujimqin sheep were collected, and the number of lambing and parity were recorded. The collected Ujimqin sheep were from Dong Ujimqin Banner, Xilin Gol League, Inner Mongolia, and the blood samples were stored in an anticoagulant tube for later use.

[0038] 2) Sequencing of PCR products

[0039] Twelve Ujimqin sheep (6 consecutive twin lambing ewes + 6 consecutive single lambing ewes) were randomly selected for PCR product sequencing, and a SNP site located in the coding region of the TGF-β1 gene, NC_056067.1: c.312C > T, was found.

[0040] 3) Primer design

[0041] According to the sheep gene sequence reported by GeneBank (GeneBank accession number: NC_056067.1), the present application designed the upstream and downstream primers F and R, and through comparison and screening, the primer sequences were finally obtained as follows:

[0042] F: 5'-ACCCTCCTACCTTTTCCTCG-3';

[0043] R: 5'-AAGCGGTCCACTTCACTCAC-3'.

[0044] The genome extracted from the Ujimqin sheep experimental material was used as a template, and the above primers were used for amplification, respectively.

[0045] The amplification system of the upstream and downstream primers was consistent, and the total volume of the amplification system was 20 μL, of which the upstream and downstream primers were 1 μL each, the template was 1 μL, the premix was 10 μL, and the deionized water was 7 μL.

[0046] The amplification product was pre-denatured at 5℃ for 5 min, denatured at 98℃ for 10 s, annealed at 58℃ for 5 s, extended at 68℃ for 5 s, 35 cycles, extended at 72℃ for 3 s, and stored at 4℃. The amplification product was sequenced.

[0047] The PCR amplification results of NC_056067.1: c.312C>T of TGF-β1 are shown in Figure 1 .

[0048] The nucleotide sequence of the PCR product is shown in SEQ ID NO. 3:

[0049] ACCCTCCTACCTTTTCCTCGGGAGACCCCCACCCACCCCAGCCCCTGTAGGGGCGGGGCCTCCCTCTTCCCACCCCAGTCCAGCTCGCGCTCTCGGCTGTGCCTGGGGGCGCCGCCTCCCCCATGCCGCCCTCGGGGCTGCGGCTGCTGCCGCTGCTGCTGCCGCTGCTGTGGCTACTAATGCTGACGCCTGGCCGGCCGGTCGCCGGACTGTCCACCTGCAAGACCATCGACATGGAGCTGGTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGATTTTGTCCAAACTTCGGCTCGCCAGTCCCCCGAGCCAGGGGGACGTGCCACCCGGCCCGCTGCCCGAGGCCATACTGGCCCTTTACAACAGTACCCGCGACCGGGTGGCCGGGGAAAGTGCCGAAACGGAGCCTGAGCCAGAGGCGGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAATACGGCAACAGTGAGCTCGCAGGGGCAGGGGACCCTGGAGGGGAGCCCCCAGGGGGCGCCGGAGTGCAGGGGTCACGGGGAGGAAACTGCTGGTAGAGGAAACTGGCTGGAGGAAGAGAACC CCGGGGGCGCCGGGAACGTGTGTGGGGGGAGGGGTCCCAAAGAGCATAGAGCTGAGCTCCCTAACCCCCAAGGTATCTATCTGGTCTTGAATAAGAGATAGTGAGTGAAGTGGACCGCTT

[0050] The sequencing results are shown in Figure 2If a single peak appears at the position of 50061764th base of chromosome 14 and the genotype is C, then the genotype is CC, if a double peak appears at the position of 50061764th base of chromosome 14, then the genotype is CT, if a single peak appears at the position of 50061764th base of chromosome 14 and the genotype is T, then the genotype is TT.

[0051] Example 2 Statistical analysis of TGF-β1 genotype and its relationship with the multiple birth traits of Wuzhumuqin sheep population

[0052] According to the primers designed in Example 1, the genes of Wuzhumuqin sheep were detected, and the genotype frequency and allele frequency of Wuzhumuqin sheep were calculated. The statistical results are shown in Table 1.

[0053] Table 1 Statistical results of genotype frequency and allele frequency of Wuzhumuqin sheep

[0054]

[0055] Note: The number in the brackets is the sample number.

[0056] As shown in Table 1, the genotype frequencies of CC, CT and TT of Wuzhumuqin sheep are 0.481, 0.277 and 0.242 respectively, and the allele frequencies of C and T are 0.619 and 0.381 respectively, and the C allele is the dominant allele.

[0057] The correlation analysis of TGF-β1 genotype and its relationship with the multiple birth traits of Wuzhumuqin sheep was carried out, and the specific experiment was as follows:

[0058] (1) The individual genotype of part of the selected sample population was analyzed, the allele frequency and genotype frequency were calculated, and χ 2 test was carried out.

[0059] (2) According to the test results, the gene frequency and genotype frequency of the site were calculated, and the chi-square goodness-of-fit test of Hardy-Weinberg equilibrium of the genotype distribution of the site was carried out. The correlation analysis of the multiple birth traits of Wuzhumuqin sheep population and the genotype was carried out by using SPSS19.0 software, in which the statistical model included genotype as fixed effect and ram as random effect, and the mixed linear model (MLM) was constructed as follows:

[0060] Y = μ + G + R + e

[0061] Wherein: Y is the record value of lambing number; μ is the population average value; G is the genotype effect, R is the ram effect; e is the random residual effect.

[0062] The average value and standard error of different genotypes and lambing number of Wuzhumuqin sheep are shown in Table 2.

[0063] Table 2 statistical results of different genotypes and average and standard error of lambing number of Ujimqin sheep

[0064]

[0065] Note: a, c: p < 0.01.

[0066] As shown in Table 2, the TT genotype is 0.31 higher than the CC genotype in the number of lambs, which indicates that the mutation of the C allele to the T allele has a certain effect on the lambing trait of the Ujimqin sheep, and the difference in the number of lambs of different genotypes at this site reaches a significant level (p < 0.01). The results show that the genetic diversity of this site can be used to screen and improve the multiple pregnancy traits of Ujimqin sheep.

[0067] Example 3 method for improving the reproductive force of Ujimqin sheep

[0068] The method for improving the reproductive force of Ujimqin sheep of the present embodiment comprises the following steps:

[0069] (1) extracting the genomic DNA of the Ujimqin sheep to be tested;

[0070] (2) performing PCR amplification with specific primers;

[0071] The genomic extracted from the Ujimqin sheep experimental material is used as a template, and the primer described in Example 1 is used for amplification. The total volume of the amplification system is 20 μL, wherein 1 μL of the upstream and downstream primers, 1 μL of the template, 10 μL of the premix, and 7 μL of the deionized water;

[0072] After amplification, the product is pre-denatured at 5°C for 5 min, denatured at 98°C for 10 s, annealed at 58°C for 5 s, extended at 68°C for 5 s, 35 cycles, extended at 72°C for 3 s, and stored at 4°C for sequencing;

[0073] (3) judging the genotype of the 312th nucleotide of the TGF-β1 gene in the Ujimqin sheep genome,

[0074] If a single peak appears at the position of the 50061764th base of chromosome 14 and the genotype is C, then the genotype is CC; if a nested peak appears at the position of the 50061764th base of chromosome 14, then the genotype is CT; if a single peak appears at the position of the 50061764th base of chromosome 14 and the genotype is T, then the genotype is TT;

[0075] Select the Ujimqin sheep with the TT genotype at the 312th position of the coding region of the TGF-β1 gene as the parent for breeding.

[0076] The above merely illustrates the specific embodiments of the present application, but the protection scope of the present application is not limited thereto, any person skilled in the art can easily think of the changes or replacements within the technical range disclosed by the present application, which should be covered in the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. The application of specific primers of molecular markers of TGF-β1 related to the reproductive ability of Ujimqin sheep in assisting in judging the reproductive ability of Ujimqin sheep, characterized in that, The molecular marker is located at position 50061764 of NC_056067.1, and the single nucleotide polymorphism is C / T.

2. Use according to claim 1, characterized in that, The specific primer sequences are as follows: SEQ ID NO. 1: 5'-ACCCTCCTACCTTTTCCTCG-3'; SEQ ID NO. 2: 5'-AAGCGGTCCACTTCACTCAC-3'.

3. A method for screening high prolificacy Ujimqin sheep, characterized by, The method comprises the following steps: (1) extracting the genomic DNA of the Ujimqin sheep to be tested; (2) using the genomic DNA of the Ujimqin sheep extracted in step (1) as a template, performing PCR amplification with specific primers to obtain an amplification product; (3) judging the genotype of the nucleotide at position 50061764 of the TGF-β1 gene NC_056067.1 in the Ujimqin sheep genome in the amplification product, and selecting the Ujimqin sheep with the TT genotype of the nucleotide at position 50061764 of the TGF-β1 gene as the parent for breeding.

4. The method for screening high-fertility Ujimqin sheep according to claim 3, characterized in that, The specific primer sequences are as follows: SEQ ID NO. 1: 5'-ACCCTCCTACCTTTTCCTCG-3'; SEQ ID NO. 2: 5'-AAGCGGTCCACTTCACTCAC-3'.

5. The method for screening high-fertility Ujimqin sheep according to claim 3, characterized in that, In step (2), the total volume of the amplification system is 20 μL, wherein the specific primers are each 1 μL, the template is 1 μL, the premix is 10 μL, and the deionized water is 7 μL.

6. The method for screening high-fertility Ujimqin sheep according to claim 3, characterized in that, The amplification program of step (2) is as follows: pre-denaturation at 95℃ for 5 min, denaturation at 98℃ for 10 s, annealing at 58℃ for 5 s, extension at 68℃ for 5 s, 35 cycles, and extension at 72℃ for 10 min.

Images