A CNTN5 gene related to a host chicken salmonella pullorum resistance trait and a SNP molecular marker and application thereof

By locating the CNTN5 gene SNP molecular marker at 185063016 bp on chicken chromosome 1 through genome-wide association analysis, the problems of high purification costs and antibiotic resistance in the prevention and control of Salmonella pullorum in chickens have been solved. This has enabled rapid screening of highly resistant chicken breeds, simplified the breeding process, and provided genetic analysis support.

CN119876412BActive Publication Date: 2025-11-25SHANGHAI JIAOTONG UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510042694.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-10
Publication Date
2025-11-25
Estimated Expiration
2045-01-10

AI Technical Summary

Technical Problem

Existing technologies for controlling Salmonella pullorum in chickens suffer from high purification costs, poor accuracy, and antibiotic resistance due to antibiotic use. Traditional breeding methods are complex and time-consuming.

Method used

Using the CNTN5 gene and its SNP molecular markers, a base mutation at 185063016 bp on chicken chromosome 1 was located through genome-wide association analysis. The mutation of base C to T indicates that chickens are highly resistant to Salmonella pullorum. Primer pairs were provided for genotyping to screen for highly resistant chicken breeds.

Benefits of technology

This technology enables rapid and effective screening of chicken breeds highly resistant to Salmonella pullorum, simplifies the breeding process, improves breeding efficiency, and provides technical support for genetic analysis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876412B_ABST
    Figure CN119876412B_ABST
Patent Text Reader

Abstract

The present application relates to a CNTN5 gene related to a host chicken Salmonella pullorum resistance trait and a SNP molecular marker and application thereof, the CNTN5 gene and the SNP molecular marker are used for breeding or assisting breeding of chicken breeds with high resistance to chicken Salmonella pullorum, the nucleotide sequence of the CNTN5 gene is shown as SEQ ID NO. 1, the CNTN5 gene SNP molecular marker is located in the intron region of the CNTN5 gene on chromosome 1 of the chicken, at the 185063016bp site on the chromosome 1, and the polymorphism is T or C; when the base at the CNTN5 gene SNP molecular marker is T, the chicken has high resistance to chicken Salmonella pullorum; when the base at the CNTN5 gene SNP molecular marker is C, the chicken has low resistance to chicken Salmonella pullorum. The CNTN5 gene and the SNP molecular marker provided by the present application can be used to quickly and effectively screen and breed chicken breeds with high resistance to chicken Salmonella pullorum.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the CNTN5 gene and its SNP molecular markers and applications associated with resistance traits to Salmonella pullorum in host chickens. Background Technology

[0002] Pullorum disease, caused by Salmonella pullorum, is one of the priority animal diseases for prevention and eradication in my country. As a specific pathogen in chickens, Salmonella pullorum primarily affects chicks under 20 days old, with high morbidity and mortality rates, causing significant economic losses to the poultry industry. Salmonella pullorum spreads through both vertical and horizontal routes. Currently, two main methods are used for prevention and control: first, purifying breeding poultry based on antibody detection results from whole blood agglutination tests to block vertical transmission; second, using antibiotics to prevent horizontal transmission, thereby controlling infection and disease. While these two methods effectively prevent the spread of pullorum, they also have serious problems: the first method suffers from high purification costs and poor accuracy, while the second method increases bacterial resistance and leads to excessive antibiotic use. To improve these issues, selective breeding of chickens is necessary. However, traditional breeding methods mainly rely on phenotypic and pedigree information for crossbreeding, which presents challenges for traits with low heritability and complex measurement requirements, including high testing costs, long testing times, and complex breeding processes. Summary of the Invention

[0003] The purpose of this invention is to overcome the deficiencies of the prior art by providing a CNTN5 gene and its SNP molecular markers and applications that are related to the host Salmonella pullorum resistance trait.

[0004] The objective of this invention can be achieved through the following technical solutions:

[0005] One of the technical solutions of the present invention is to provide the application of the CNTN5 gene in the selection or assisted selection of chicken breeds with high resistance to Salmonella pullorum, wherein the nucleotide sequence of the CNTN5 gene is shown in SEQ ID NO.1.

[0006] The second technical solution of the present invention is to provide the application of the CNTN5 gene SNP molecular marker in the selection or assisted selection of chicken breeds with high resistance to Salmonella pullorum. The CNTN5 gene SNP molecular marker is located at the 185063016bp site on chromosome 1 of chicken, in the intron region of the CNTN5 gene, and the polymorphism of this site is T or C.

[0007] In some specific embodiments, the CNTN5 gene SNP molecular marker is used for breeding or assisting in the breeding of chickens with high resistance to Salmonella pullorum. The criteria for breeding or assisting in breeding are as follows: when the base at the CNTN5 gene SNP molecular marker is T, it corresponds to high resistance of chickens to Salmonella pullorum; when the base at the CNTN5 gene SNP molecular marker is C, it corresponds to low resistance of chickens to Salmonella pullorum.

[0008] The third technical solution of the present invention is to provide a method for screening chicken breeds with high / low resistance to Salmonella pullorum, characterized in that it utilizes the CNTN5 gene SNP molecular marker as described in the second technical solution above.

[0009] In some specific implementations, the following steps are also included:

[0010] S1. Collect chicken tissue or blood samples and extract their genomic DNA;

[0011] S2. Detect the genotype at the SNP molecular marker of the CNTN5 gene.

[0012] In some specific embodiments, in step S2, the genomic DNA obtained in step S1 is amplified using primer pairs as shown in SEQ ID NO.2-3 to obtain a nucleotide fragment containing the CNTN5 gene, and the genotype at the SNP molecular marker of the CNTN5 gene is detected.

[0013] The fourth technical solution of the present invention is to provide a primer pair for amplifying the CNTN5 gene SNP molecular marker as described in the second technical solution above, the nucleotide sequences of which are shown in SEQ ID NO.2 to 3 respectively.

[0014] The fifth technical solution of the present invention provides an application of the primer pair described in the fifth technical solution above in the preparation of any of the following products:

[0015] Y1) Application in the preparation of reagents for detecting or assisting in the detection of the level of resistance of chickens to Salmonella pullorum;

[0016] Y2) Application in the preparation of reagents for screening or identifying chicken breeds with high / low resistance to Salmonella pullorum;

[0017] Application of Y3 in the preparation of early predictive reagents for the trait of chickens against Salmonella pullorum.

[0018] The sixth technical solution of the present invention is to provide a reagent comprising the primer pair as described in the fourth technical solution above.

[0019] The seventh technical solution of the present invention is to provide the reagent described in the sixth technical solution above in any of the following applications:

[0020] Y1) Application of molecular marker-assisted breeding for resistance to Salmonella pullorum in chickens;

[0021] Application of Y2 in breed improvement of chickens resistant to Salmonella pullorum.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] This invention provides a molecular marker for the CNTN5 gene and its single nucleotide polymorphism (SNP) site, which are associated with resistance to Salmonella pullorum in chickens. This molecular marker was obtained based on genome-wide association analysis and is located at a single nucleotide polymorphism at 185063016 bp on chromosome 1 of chicken, also within an intron region of the CNTN5 gene. The mutation is a C-to-T mutation, resulting in high resistance to Salmonella pullorum in chickens. Using the CNTN5 gene SNP molecular marker provided by this invention, chicken breeds with high resistance to Salmonella pullorum can be rapidly and effectively screened and bred, providing candidate genes for improving chicken resistance to pullorum and offering technical support for the genetic analysis of other important economic traits in livestock and poultry. Attached Figure Description

[0024] Figure 1 To screen for genome-wide association analysis, the CNTN5 gene and its SNP molecular markers associated with resistance to Salmonella pullorum were identified. Detailed Implementation

[0025] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0026] Example 1:

[0027] 1) Extraction and resequencing of chicken genomic DNA

[0028] 149 chickens (3 days old) challenged with Salmonella pullorum were selected. Liver samples were collected from deceased individuals and surviving individuals on day 13 after challenge. Genomic DNA was extracted and genome resequencing was performed on the samples.

[0029] Genomic DNA was extracted from liver tissue using the Tiangen Blood / Cell / Tissue Genomic DNA Extraction Kit. First, 30 mg of liver tissue was collected and cut with scissors to facilitate cell lysis. Then, tissue DNA was extracted according to the kit's procedure. After extraction, the DNA underwent quality control. The total DNA amount was measured using the Quant-iT PicoGreen dsDNAAssay Kit. Once all DNA samples passed PicoGreen fluorescence detection, DNA integrity was assessed using 1% agarose gel electrophoresis. If all DNA bands were clear, bright, and intact, they were used for subsequent sequencing.

[0030] Genome resequencing was performed using second-generation sequencing technology based on the Illumina NovaSeq sequencing platform. The preparation of the genome libraries was performed according to the standard Illumina TruSeq Nano DNALT experimental procedure. In this example, 149 libraries were constructed using the TruSeq™ DNASample Prep Kit, and these libraries were sequenced with paired ends (2 × 150 bp).

[0031] 2) Sequencing data filtering

[0032] The sequencing data is stored in paired-end FASTQ format, and data quality is assessed based on Q20 and Q30 (resulting in a sequencing error rate of 0.1%). The assessed data then undergoes further filtering using PLINK software to process the raw library data.

[0033] There are three criteria for filtering. First, contaminated connectors are removed using AdapterRemoval software to remove 3' connector contamination. Second, quality filtering is performed using a sliding window method with a window size of 5 bp and a step size of 1 bp. The window moves forward one base at a time, and the average Q value is calculated based on 5 bases. When the average Q value is less than or equal to 20, only the second-to-last base and the bases before it in that window are retained. Finally, data with unacceptable lengths are filtered out, specifically those paired-end sequences with a length less than or equal to 50 bp.

[0034] 3) Statistical comparison with reference genome

[0035] The resequencing sequences obtained by BWA (version 0.7.12-r1039) were compared with the NCBI chicken reference genome GRCg6a. The alignment rate, sequencing depth, genome coverage, and other information for each sample were obtained by statistical analysis based on the position of Clean Reads on the reference genome. The alignment results were sorted and indexed using Samtools software.

[0036] Then, downstream analysis was performed using GenomeAnalysisTK v4.0 (GATK) software: First, GATAMarkDuplicates was used to remove sequence duplications caused by PCR. Then, GATK Haplotypecaller was used to search for variants across the entire genome. Finally, GATK VariantFiltration was used for hard filtering of variant sites. To ensure the accuracy of SNP sites, SNP sites were filtered, and the filtering conditions were set as follows:

[0037] (1) Quality by Depth (QD) < 2. QD is the quality value after depth correction. It is the quality value (Q value) divided by the depth before site filtering. Because the Q value is positively correlated with the depth, QD can eliminate the influence of sequencing depth and determine the true quality value of the site.

[0038] (2) Fisher Strand(FS)>60, where FS is determined by Fisher’s precise test to determine whether the current mutation has a tendency to be strand-specific;

[0039] (3) RMS Mapping Quality (MQ) < 40. MQ is the root mean square of the alignment quality of all aligned reads, used to determine the average alignment quality of a site.

[0040] (4) Strand Odds Ratio (SOR) > 3. SOR is the OR value used to determine the degree of chain specificity of the variant site. The larger the value, the higher the degree of chain specificity.

[0041] (5) Mapping Quality Rank Sum Test (MQRankSum) < -12.5. MQRankSum is the Man Whitney rank sum test result of the alignment quality between different bases of the heterozygous site. The reliability of the site is evaluated by the difference in alignment quality between the reference base (ref) and the mutant base (alt).

[0042] (6) Read Pos Rank Sum Test (Read Pos Rank Sum) < -8, which is still a rank sum test for heterozygous sites to see if different bases tend to appear at specific positions on the sequence (e.g., near the start or end of the sequence).

[0043] The filtering criteria for InDel sites include: FS>200; QD<2; SOR>10; MQRankSum<-12.5; ReadPosRankSum<-8.

[0044] Finally, Vcftools software was used to filter the SNPs in the mutations based on the population mutation distribution. The filtering thresholds included:

[0045] (1) The number of minor alleles is greater than 3;

[0046] (2) The SNP deletion rate exceeds 5%;

[0047] (3) The SNP mass is greater than 30;

[0048] (4) Minimum sequencing depth 5;

[0049] (5) The minimum isoelectric frequency is less than 0.05;

[0050] After quality control, a total of 3,102,334 SNP variant sites were obtained that could be used for genome-wide association analysis.

[0051] 4) Genome-wide association analysis:

[0052] Filtered SNPs were used for genome-wide association analysis. rMVP software was used to perform genome-wide association analysis using the general linear model (GLM), mixed linear model (MLM), and unified method of fixed and randomized cycle probability (FarmCPU) to identify key candidate genes and loci affecting chicken resistance to Salmonella pullorum.

[0053] Finally, 195 significant SNP loci associated with host Salmonella pullorum resistance were screened and identified, with a significance level of P < 1.38 × 10⁻⁶. -6 .

[0054] The gene location of the significant site was determined, and the g.185063016T>C variant was located in the CNTN5 gene (its nucleotide sequence is shown in SEQ ID NO.1), with a p-value of 7.27 × 10⁻⁶. -8 The most significant and located within the gene region, such as Figure 1 As shown. Correspondingly, after being challenged with Salmonella pullorum, the genome of the dead chickens showed a C base at 185063016 bp on chromosome 1, while the genome of the surviving chickens showed a T base at the same location.

[0055] Therefore, the CNTN5 genotype can be detected to further select or breed chickens to improve the host's resistance to Salmonella pullorum.

[0056] SEQ ID NO.1 (CNTN5 gene):

[0057] ATGAGGTTCAACACGGCAAAGTGCAGGGTTTTGCACTTGGGCCAGAGGAACCCCAGGCATCTATACAGACTGGAAGGAGCAGTCCTTGAGAGCAGCTCT GCAGAGAAGGACCTGCGGGTCCTGATGGATGACAAACTTAACATGAGCCAGCAGTGTGTTCTTGCAGCTCGGAAAGCAAATGGTATCCCAGGCTGCATCATGAGAGGGGTGGACAGCAGGGACAGGGAGGTGATTGT CCCTCTCTACTCTGCTCTTGTGAGGCCCCATCTGGAGTACTGTGTCCAGGTATGGAGCCCCCAGTACAAGAAAGACAGAGAGCTATTTGAGAGGGTCCAGAGAAGGGCCACAAAGATGATCAGGGGGCTGGAGCACCT CCCCTACGAGGACAGGCTGAGGGAGCTGGGCTTGTTCGACCTGGAGAAGAGAAGGCTGCGGGGTGACCTCATTGCAGCCTTTCAGTACCTGAAGAGAGCCTATGAACAGGAAGGGAGTAAACTTTTTGAAAGGGTAG ATAACAGCAGGACAAGGGGGAATGGTTTTAAGTTGAAAGAGGGAAGATTTAGGTTGGATGTTAGGGGGAAGTTCTTTACTATGAGTGTGGTGAGGTGCTGGAACGGGCTGCCCAGAGAGGTTGTGGATGCCCCGTCCC T GGAGGTTTTCAAGGCCAGGTTGGATGAGGCCCCGGGCAACCTGGTCTACTAA

[0058] The double-underlined bases are SNP molecular marker sites of the CNTN5 gene associated with the host's resistance to Salmonella pullorum. When the base is T, it corresponds to high resistance to Salmonella pullorum, indicating a surviving individual; when the base is C, it corresponds to low resistance to Salmonella pullorum, indicating a dead individual.

[0059] This embodiment also provides a pair of primers for amplifying the CNTN5 gene, as shown in SEQ ID NO.2-3 respectively:

[0060] SEQ ID NO.2 (upstream primer): 5'-ATGAGGTTCAACACGGCAAA-3';

[0061] SEQ ID NO.3 (downstream primer): 5'-TTAGTAGACCAGGTTGCCCG-3'.

[0062] Example 2: Application of CNTN5 gene SNP molecular marker in the identification of resistance to Salmonella pullorum in chickens

[0063] Another 100 chickens (3 days old) were selected after being challenged with Salmonella pullorum. Liver samples were collected from the deceased individuals and the surviving individuals on the 13th day after challenge, and genomic DNA was extracted from them.

[0064] PCR amplification was performed using primer pairs shown in SEQ ID NO.2-3 to obtain the CNTN5 gene fragment, and the CNTN5 gene fragment was then subjected to genotyping detection.

[0065] PCR amplification reaction system:

[0066]

[0067] PCR amplification reaction conditions:

[0068]

[0069] The results showed that, after being challenged with Salmonella pullorum, the base at the SNP site of the CNTN5 gene in the genome of the deceased individuals was C, while the base at the SNP site of the CNTN5 gene in the genome of the surviving individuals was T.

[0070] The results shown above demonstrate that the molecular markers and primer combinations provided by this invention are accurate and can effectively distinguish between different genotypes.

[0071] In summary, this invention is the first to discover a locus in the CNTN5 gene associated with the level of resistance to Salmonella pullorum in host chickens, providing an effective candidate gene for breeding chicken strains with superior traits. Simultaneously, this invention uses marker-associated trait analysis to identify a SNP (g.185063016T>C) in the CNTN5 gene that is significantly associated with Salmonella pullorum resistance in host chickens. This locus can be applied to association analyses related to Salmonella pullorum resistance in host chickens, providing a new genetic marker resource for marker-assisted selection of Salmonella pullorum resistance in host chickens. In short, this invention employs a genome-wide association analysis (GWAS) approach to screen and identify genes related to Salmonella pullorum resistance in host chickens. For the identified candidate genes, this invention further uses a candidate gene method strategy to determine whether there are loci in the studied genes associated with Salmonella pullorum resistance traits in host chickens, thereby further verifying the relationship between candidate genes and Salmonella pullorum resistance performance in host chickens. Furthermore, by using the candidate gene method, the SNPs identified as being associated with Salmonella pullorum resistance in host chickens can serve as molecular markers for breeding superior traits in chickens, contributing to the genetic progress of Salmonella pullorum resistance in host chickens. This invention is characterized by its simplicity, short processing time, and high accuracy in selecting markers, and also provides technical support for the genetic analysis of other important economic traits in livestock and poultry.

[0072] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. CNTN5 The application of gene SNP molecular markers in breeding chicken breeds with high resistance to Salmonella pullorum is characterized by, The CNTN5 The gene SNP molecular marker is located at the 185063016 bp site on chromosome 1 of the chicken reference genome GRCg6a. CNTN5 The intronic region of a gene, where the polymorphism is T or C.

2. The application according to claim 1, characterized in that, The CNTN5 Gene SNP molecular markers are used to select chickens with high resistance to Salmonella pullorum. The selection criteria are: when... CNTN5 When the base at the gene SNP molecular marker is T, it corresponds to high resistance in chickens to Salmonella pullorum. when CNTN5 When the base at the gene SNP molecular marker is C, it corresponds to low resistance in chickens to Salmonella pullorum.

3. A method for screening chicken breeds with high / low resistance to Salmonella pullorum, characterized in that, Utilizing the method described in claim 1 CNTN5 Gene SNP molecular markers 。 4. The method according to claim 3, characterized in that, It also includes the following steps: S1. Collect chicken tissue or blood samples and extract their genomic DNA; S2, Detection CNTN5 Genotype at the SNP molecular marker of a gene.

5. The method according to claim 4, characterized in that, In step S2, the genomic DNA obtained in step S1 is amplified using primer pairs as shown in SEQ ID NO. 2~3 to obtain a product containing... CNTN5 nucleotide fragments of genes, detection CNTN5 Genotype at the SNP molecular marker of a gene.

6. The use of a primer pair in the preparation of any of the following products: Y1) Application in the preparation of reagents for detecting high / low resistance in chickens to Salmonella pullorum; Y2) Application in the preparation of reagents for screening or identifying chicken breeds with high / low resistance to Salmonella pullorum; Y3) Application in the preparation of early predictive reagents for the trait of chicken resistance to Salmonella pullorum; The nucleotide sequences of the primer pairs are shown in SEQ ID NO.2~3, respectively.

7. The application of a reagent in molecular marker-assisted breeding or breed improvement of chickens to resistance to Salmonella pullorum, characterized in that, The reagent includes the primer pair as described in claim 6.

Citation Information

Patent Citations

  • Molecular marker primer combination for identifying Shouguang chicken breeds and identification method

    CN112481389A