A molecular marker related to betaine content in cattle muscle and its application
Through whole-genome association analysis, a SNP site on cattle chromosome 9 was discovered, and primer pairs and kits were designed to solve the problem of screening betaine content in cattle muscle, achieve efficient breeding, improve beef quality, and increase corporate profits.
Patent Information
- Application Number
- CN202510100875.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-22
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2045-01-22
AI Technical Summary
Existing technologies make it difficult to efficiently screen and improve the betaine content in cattle muscle, resulting in slow breeding progress and an inability to meet consumers' increasing demands for meat quality.
Through genome-wide association analysis, the SNP site g.102029509A>G polymorphism on cattle chromosome 9 was discovered. Primer pairs were designed and a kit was established to detect the betaine content in cattle muscle, realizing molecular marker-assisted selection.
Accurately and at low cost screen out cattle with high muscle betaine content, improve breeding efficiency, shorten breeding time and increase economic benefits.
Smart Images

Figure CN119876420B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular biotechnology and molecular marker technology, and particularly relates to a molecular marker located on bovine chromosome 9 and associated with the betaine content in bovine muscle, and an application thereof. Background Art
[0002] Betaine is an alkaloid commonly found in plants and animals. It is an intermediate product of animal metabolism and regulates osmotic pressure, alleviates stress, promotes fat metabolism and protein synthesis, and increases lean meat percentage. With rising living standards, consumer demand for beef is expanding beyond quantity to include higher quality. To accelerate the breeding of cattle for traits related to meat quality, betaine, as a key metabolic marker, is gaining increasing attention from researchers and breeders and is expected to become a component of beef cattle breeding programs. In livestock and poultry nutrition, betaine is a key feed additive, enhancing growth performance and improving meat quality. Identifying key SNPs for betaine content in cattle muscle through genetic breeding techniques and incorporating these SNPs into molecular marker-assisted selection could accelerate genetic improvement of traits such as beef quality, potentially increasing the economic benefits of livestock farming operations. Summary of the Invention
[0003] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide a molecular marker associated with the level of betaine content in cattle muscle, which is obtained through whole genome association analysis and can significantly affect the trait of betaine content in cattle muscle.
[0004] Another object of the present invention is to provide a primer pair for detecting the above-mentioned SNP molecular markers.
[0005] Another object of the present invention is to provide a kit for detecting the above-mentioned SNP molecular markers, which comprises the above-mentioned primer pair.
[0006] The fourth object of the present invention is to provide applications of the above-mentioned SNP molecular markers, primer pairs and kits.
[0007] A fifth object of the present invention is to provide a method for screening cattle breeds with high or low muscle betaine content.
[0008] The sixth object of the present invention is to provide a method for genetic improvement of cattle.
[0009] The above purpose of the present invention is achieved like this:
[0010] A molecular marker located on chromosome 9 of the bovine reference genome ARS-UCD1.2 and associated with the betaine content in bovine muscle. The SNP site of the molecular marker corresponds to an A>G mutation at base position 102029509 from the 5′ end on chromosome 9 of the bovine reference genome ARS-UCD1.2 in the bovine reference genome sequence in the GenBank database. The polymorphism of the base at this site leads to different traits of betaine content in bovine muscle. Specifically, when the single nucleotide at the SNP site is A, the bovine muscle betaine content is high; when the single nucleotide at the SNP site is G, the bovine muscle betaine content is low.
[0011] Preferably, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, wherein M in the sequence is A or G.
[0012] A primer pair for detecting the aforementioned molecular marker comprises an upstream primer U and a downstream primer D, the nucleic acid sequence of which is as follows:
[0013] U (upstream primer): 5′-CGTCTGCAAGTAGGCATGAG-3′ (SEQ ID No. 2);
[0014] D (downstream primer): 5'-CCCAGGTCTTGTCCCACTC-3' (SEQ ID No. 3).
[0015] A kit for detecting the aforementioned molecular marker, the kit comprising the primer pair according to claim 3.
[0016] The aforementioned molecular markers, primer pairs or kits are used in identifying the high or low betaine content in cattle muscle, screening cattle breeds with high or low betaine content in cattle muscle or cattle genetic breeding, and the cattle include Huaxi cattle and its synthetic line.
[0017] A method for identifying the betaine content in cattle muscle comprises the following steps: detecting the aforementioned molecular marker SNP site on cattle chromosome 9, and judging the betaine content in cattle muscle according to the genotype of the SNP site; when the SNP site is the AA genotype, the betaine content in cattle muscle is significantly higher than that in cattle muscle with the AG genotype; and when the SNP site is the AG genotype, the betaine content in cattle muscle is significantly higher than that in cattle muscle with the GG genotype.
[0018] The cattle with the AA genotype are cattle whose base 102029509 from the 5′ end on chromosome 9 of the cattle reference genome ARS-UCD1.2 is A;
[0019] The cattle with the AG genotype are cattle whose bases at positions 102029509 from the 5′ end on chromosome 9 of the cattle reference genome ARS-UCD1.2 are A and G;
[0020] The cattle with the GG genotype are cattle whose base 102029509 from the 5′ end on chromosome 9 of the cattle reference genome ARS-UCD1.2 is G;
[0021] The bovine reference genome ARS-UCD1.2 is the bovine reference genome sequence in the GenBank database.
[0022] A method for screening cattle breeds with high betaine content in cattle muscle comprises the following steps: detecting the SNP site of the molecular marker described in claim 1 or 2 on chromosome 9 of the cattle, eliminating individuals whose single nucleotide at the SNP site is G, and retaining individuals whose single nucleotide at the SNP site is A as breeding cattle; the cattle include Huaxi cattle and their synthetic lines.
[0023] Preferably, the aforementioned detection method comprises the following steps:
[0024] (1) Extracting genomic DNA from the cattle to be tested;
[0025] (2) using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 as amplification primers, and using the genomic DNA of the bovine to be tested obtained in step (1) as template DNA, performing PCR amplification to obtain a PCR amplification product;
[0026] (3) Sequencing the PCR amplification product to obtain sequencing results;
[0027] (4) Based on the sequencing results, determine the genotype.
[0028] A method for genetic improvement of cattle, comprising the following steps: determining the molecular markers of claim 1 or 2 of cattle in a core group of breeding cattle, and making corresponding selections based on the molecular markers: selecting cattle with AA or AG genotypes at base position 102029509 from the 5′ end on chromosome 9 of the cattle reference genome ARS-UCD1.2 for successive breeding, and eliminating cattle with GG genotypes at this point, so as to increase the frequency of allele A at this site generation by generation, thereby increasing the betaine content in the muscle of offspring cattle; the cattle include Huaxi cattle and synthetic lines thereof.
[0029] The aforementioned molecular markers, primer pairs and / or any of the methods described are used in cattle breeding.
[0030] The present invention has the following advantages and effects compared to the prior art:
[0031] The method used in the present invention is to detect the bases at the g.102029509A>G polymorphic site on chromosome 9 of the cattle reference genome ARS-UCD1.2, determine the genotype of individual cattle, select cattle based on muscle betaine content, and obtain cattle with higher muscle betaine content. The method provided by the present invention can be used for early screening of candidate cattle, effectively solving the problem of in vivo determination of muscle betaine content in cattle in actual production, reducing breeding costs, and effectively increasing or decreasing muscle betaine content in cattle in actual production. The method has high accuracy, low detection costs, and can achieve automated detection, and has high practical application value in cattle breeding.
[0032] (1) The present invention detected a significant molecular marker on the nucleotide sequence of chromosome 9 of cattle that is associated with the level of betaine content in cattle muscle through genome-wide association study (GWAS). The present invention established a molecular marker-assisted selection breeding technology for improving the level of betaine content in cattle muscle, improved the process of breeding cattle with high muscle betaine content in Huaxi cattle and its synthetic lines, adapted to market demand, and contributed to increasing sales profits and improving core competitiveness for enterprises.
[0033] (2) The present invention provides a primer pair and a kit for detecting a SNP molecular marker located on chromosome 9 of cattle and associated with the high or low betaine content in cattle muscle. Through the primer pair and the kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select traits, which can be applied to the genetic improvement of high betaine content in the muscles of breeding cattle, thereby improving the excellent quality of beef, accelerating the breeding process, and thereby increasing corporate profits and core competitiveness.
[0034] (3) The present invention provides a method for cattle breeding by optimizing the dominant allele of the molecular marker, which can accelerate the genetic progress of the cattle herd and shorten the time for improving Huaxi cattle, thereby effectively improving the economic benefits of breeding cattle. The present invention can ultimately achieve improved economic benefits of commercial cattle by optimizing the dominant allele (A) with high betaine content in cattle muscle from individual SNP molecular markers. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 This is a genome-wide association study (GWAS) analysis of betaine content in cattle muscle on chromosome 9 in Huaxi cattle;
[0036] Figure 2 This is a graph showing the high and low betaine content in the muscles of cattle of different genotypes.
[0037] Figure 3These are the sequencing results of the sequence near the g.102029509A>G polymorphism site on chromosome 9 of the reference genome ARS-UCD1.2 of individual cattle with AA, AG and GG genotypes. DETAILED DESCRIPTION
[0038] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the embodiments of the present invention are not limited thereto.
[0039] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0040] Example 1 Identification of Betaine Content in Cattle Muscle
[0041] 1. Experimental Animals
[0042] The experimental cattle herds used in the present invention are all from the bull resource group established by the cattle genetic breeding team of the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences.
[0043] A total of 116 Huaxi cattle bulls from this resource were selected for this study. All cattle were slaughtered uniformly at an average fattening age of 24 months. The slaughter process was strictly carried out in accordance with the "Meat Procurement Specifications." Slaughter, carcass, and meat quality data were measured in accordance with the requirements of GB / T 27643-2011, "Guidelines for the Determination of Carcass and Meat Quality Traits After Slaughter."
[0044] 2. Sample Collection and Metabolite Determination
[0045] 20 mg of longissimus dorsi muscle was collected and added to 600 μL of metabolite extraction solution. Metabolites were obtained through vortexing, homogenization, centrifugation, and drying. Nontargeted metabolomics analysis was performed using a high-resolution UPLC-HRMS system. Metabolomics data were normalized using the SERRF R package to correct for batch effects. Quantitative information obtained by the aforementioned methods was combined, and quantitative information detected by multiple methods was excluded to ensure metabolite uniqueness. Metabolites were then log2 transformed for final statistical analysis.
[0046] 3. Whole-genome 770k high-density chip for SNP typing
[0047] Longissimus dorsi muscle samples were collected from 116 cattle from the aforementioned resource population. After grinding with liquid nitrogen, whole-genome DNA was extracted using the standard phenol-chloroform method. The DNA concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately measured using a Nanodrop 2000 / 2000C nucleic acid protein detector. DNA samples that passed the NanoDrop 2000 / 2000C nucleic acid protein detector were diluted to approximately 50 ng / μL according to the test concentration. Six μl of the extracted DNA sample to be tested was then mixed with 2 μl of Loading Buffer, loaded onto a 1% agarose gel, and run on the gel to verify DNA integrity. DNA samples were sent to Newgene Biotech (Shanghai) Co., Ltd. for genotyping using the bovine whole-genome Illumina BovineHD chip 770K SNP chip (Illumina, USA) according to the company's standard procedures. PLINK v1.90 software was used to perform quality control on the 770K microarray scanned genotyping data for all samples, ultimately generating valid genotype data for 507,812 SNPs. Furthermore, Beagle 5.4 was used to impute the filtered autosomal SNPs to the sequence level based on a reference cohort of 1,847 individuals. After quality control, a total of 8,221,244 imputed SNPs were used for genome-wide metabolite association analysis.
[0048] 4. Genome-wide association analysis
[0049] Metabolic phenotypes were corrected for age (months), batch, and the first two principal components based on SNPs, followed by rank-based inverse normal transformation using GenABEL. Associations between SNPs and metabolite phenotypes were performed using mixed linear models (--mlm) in GCTA software. The significance threshold for association between SNPs and metabolites was 5 × 10 -8 GWAS analysis results are as follows. Figure 1 As shown. Figure 1 It can be seen that there is a site on chromosome 9 that significantly affects the betaine content in cattle muscle. The molecular marker SNP site g.102029509A>G is extremely significantly correlated with betaine content (P<2.96x 10 -11 The phenotypes of the different genotypes within the population showed significant differences. The muscle betaine content of AA cattle was significantly higher than that of GG cattle, while the muscle betaine content of heterozygous AG cattle was somewhere between the two homozygous genotypes. This suggests that this molecular marker significantly affects cattle muscle betaine content, and it could be used in marker-assisted selection to increase muscle betaine content in cattle within this population, thereby accelerating breeding for this trait.
[0050] 5. Determination of the cattle SNP site g.102029509A>G polymorphism
[0051] (1) The longissimus dorsi muscles of three cattle were used as experimental materials, and genomic DNA was extracted from each of them.
[0052] (2) Primer design and synthesis
[0053] Based on the cattle reference genome ARS-UCD1.2 sequence, the following primers were designed and synthesized:
[0054] U (upstream primer): 5′-CGTCTGCAAGTAGGCATGAG-3′ (SEQ ID No. 2);
[0055] D (downstream primer): 5'-CCCAGGTCTTGTCCCACTC-3' (SEQ ID No. 3).
[0056] (3) PCR amplification
[0057] The three cow genomic DNAs obtained in step (1) were used as templates and PCR amplification was performed using U and D as primers to obtain PCR amplification products, which were named products 1, 2 and 3, respectively.
[0058] PCR amplification system: 100 ng of genomic DNA, 25 μL of Green Taq Mix, 200 nM of upstream and downstream primers, and the system was made up to 50 μL with ddH2O.
[0059] PCR amplification program: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, and extension at 72°C for 60 seconds, for a total of 35 cycles; and final extension at 72°C for 5 minutes.
[0060] (4) Sequencing and sequence analysis
[0061] Products 1, 2, and 3 were sequenced to obtain the sequences of products 1, 2, and 3. The three product sequences differed by only one base, which was an M (A / G) mutation at position 121 from the 5' end. Figure 1 , where the horizontal axis represents the chromosome number of cattle; the vertical axis represents -log10(P). Figure 1 As shown in , there are SNPs on chromosome 9 of the cattle reference genome ARS-UCD1.2 that significantly affect the betaine content in cattle muscle, among which the 102029509th base from the 5′ end is the causative mutation. Figure 2 The difference in betaine content between different genotypes at this site was determined. This site was named SSC9g.102029509A>G. The sequencing results are shown below:
[0062] CCCAGGTCTTGTCCCACTCGGGGGTCTGGAGGCTCGAAGGGGCCCCTCC
[0063] ACGTGGTGCCAGTGGGGGGAGGGGCAGCGCGCGAGCCTGTGGCCACTTTCTTACCCGGCGCACGGTCTCCCM(A / G)
[0064] GTCCCTGGGGTCAGGGCGCTGTAGCCTCTGCGCAGACTTCCAGGGCTTG
[0065] CTCATGCTGTCCCGCTCTCCAAGGTGGTCAGTTGCCCTTTCTGTGAAG
[0066] GGAGCGAAGTCAGGAAGGACCTGTGTCACCATCGTGGTGACATCATTCT
[0067] CCCAAAATACTTCTTAGAAGAGACGTCCGCCAGGAGGGCTTCCAAACTG
[0068] TTACTGTGAGGAAGGCAGTCATGTGACACTTTCCCCACGATCAGAGGGG
[0069] CCCGGGCTCAGAGGTGTTCCTACCAACTCATGCCTACTTGCAGACG
[0070] Note: The M marked in the sequence is the mutation site, and the mutated bases in brackets are allele mutations.
[0071] The individual whose base at position 102029509 from the 5' end on chromosome 9 of the bovine reference genome ARS-UCD1.2 (or the base at position 121 from the 5' end of the PCR amplification product obtained in step (iii) is A is a homozygous individual, and the genotype of this individual is named AA. The individual whose base at position 102029509 from the 5' end on chromosome 9 of the bovine reference genome ARS-UCD1.2 (or the base at position 121 from the 5' end of the PCR amplification product obtained in step (iii) is G is a homozygous individual, and the genotype of this individual is named GG. The individual whose base at position 102029509 from the 5' end on chromosome 9 of the bovine reference genome ARS-UCD1.2 (or the base at position 121 from the 5' end of the PCR amplification product obtained in step (iii) is A and G is a heterozygous individual, and the genotype of this individual is named AG.
[0072] The present invention provides a SNP molecular marker that can significantly increase the betaine content in the muscle of breeding cattle. Using the SNP molecular marker for marker-assisted selection can greatly accelerate the breeding process of high-content betaine in the muscle of Huaxi cattle. The relative abundance of betaine in the muscle of AA-type individuals is 0.90, and the relative abundance of betaine in the muscle of GG individuals is -1.45. The betaine content in the muscle of AA-type individuals is significantly higher than that in the muscle of GG-type individuals. If the present invention selects all GG-type individuals into AA-type individuals, the potential economic benefits of a large-scale cattle farm with 10,000 heads is enormous. Among the individuals of this SNP molecular marker, by optimizing the dominant allele (A) of the SNP, it is ultimately possible to improve the economic benefits of commercial cattle, thereby increasing the profits of the enterprise.
[0073] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. The application of molecular markers related to the betaine content in Huaxi cattle muscle is characterized by: The application is any one of the following A1 to A2): A1) Identify the betaine content in Huaxi cattle muscle; A2) Select the Huaxi cattle breed with high muscle betaine content; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein m in the sequence is A or G. The genotype of this site is correlated with the betaine content in the muscle of Huaxi cattle. When the SNP site is the AA genotype, the betaine content in the muscle of the cattle is higher than that of the AG genotype; when the SNP site is the AG genotype, the betaine content in the muscle of the cattle is higher than that of the GG genotype.
2. A method for identifying the betaine content in Huaxi cattle muscle, characterized in that: The following steps are included: S1 extracts the bovine genomic DNA to be tested as a template; S2 designed primers targeting the 121 bp site of the DNA molecule shown in SEQ ID NO.1 and performed PCR amplification; S3 detects the genotype of the 121 bp site of the tested cattle sequence SEQ ID NO.1; S4 The betaine content of the tested cattle muscle is determined by the SNP site genotype obtained in step S3. When the SNP site is the AA genotype, the betaine content of the cattle muscle is higher than that of the AG genotype; when the SNP site is the AG genotype, the betaine content of the cattle muscle is higher than that of the GG genotype.
3. The method according to claim 2, characterized in that The sequences of the primers in step S2 are shown as SEQ ID NO. 2 and SEQ ID NO.
3.
4. A method for breeding Huaxi cattle with high muscle betaine content, characterized in that: The following steps are involved: The genotype at base position 102029509 from the 5' end on chromosome 9 of the tested cattle is detected, and the tested cattle with the AA genotype are selected as parents for breeding. The AA genotype is the homozygous type with A at the 121bp position of the SEQ ID NO.1 sequence; Huaxi cattle individuals with the GG genotype at this SNP site are eliminated to increase the frequency of allele A at this site generation by generation, thereby increasing the muscle betaine content of Huaxi cattle. The reference genome of the cattle is ARS-UCD1.2.