A primer and method for screening Yesso scallops with high temperature tolerance characteristics based on SNPs

By designing SNP screening primers F1 and R1, amplifying and sequencing specific sites in the exon region of the MNK1 gene of the Hokkaido scallops, screening out Hokkaido scallops with high temperature resistance, solving the problem of high temperature death in summer, and improving the genetic stability and efficiency of the screening.

CN119876428BActive Publication Date: 2025-07-04DALIAN OCEAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510388981.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-31
Publication Date
2025-07-04
Estimated Expiration
2045-03-31

AI Technical Summary

Technical Problem

The prior art has failed to effectively screen out Hokkaido scallops with high temperature resistance, resulting in frequent breeding deaths during the high temperature period in summer and causing economic losses.

Method used

Primers F1 and R1 based on SNP screen were designed, and the exon regions of MNK1 gene T652G, C659G and T686T sites of the MNK1 gene were amplified by PCR, and gene sequencing was performed to screen out the Hokkaido scallops with MNK1 genotypes AG, CA, and CA as high-temperature resistant individuals.

Benefits of technology

The genetic stability and accuracy screening of Hokkaido scallops was achieved, and the genetic stability and screening efficiency of Hokkaido scallops with high temperature resistance were improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876428B_ABST
    Figure CN119876428B_ABST
Patent Text Reader

Abstract

The present invention discloses a primer and method for screening Yesso scallops with high temperature tolerance based on SNPs. The DNA sequences of the upstream and downstream primers are shown in SEQ ID No.2 and SEQ ID No.3 respectively. The screening method is carried out in the following steps in sequence: extracting RNA from Yesso scallops and transcribing it into cDNA; using the Yesso scallop cDNA as a template to perform PCR amplification to obtain a target sequence containing MNK1 the target sequences of the T652G, C659G, and T686T sites in the exon region of the gene; performing gene sequencing on the target sequence; using scallops with the genotype AG at the T652G site, the genotype CA at the C659G site, and the genotype CA at the T686T site of Yesso scallops as Yesso scallops with high temperature tolerance, which have the advantages of high genetic stability, accuracy, and efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of aquaculture breeding, and particularly relates to a primer and method for screening Yesso scallops with high temperature tolerance characteristics based on SNPs. Background Art

[0002] The Yesso scallop ( Patinopecten yessoensis ) belongs to the phylum Mollusca, class Lamellibranchia, subclass Pterimorphia, order Pterioida, family Pectinidae, genus Pecten ), and its growth temperature range is 5 - 23°C. It is one of the most important aquaculture varieties in the northern coastal areas of China, and has the characteristics of fast growth, delicious meat, and rich nutrition. In recent years, the summer temperature in the Yesso scallop aquaculture waters in northern China often exceeds 23°C, and the high temperature period also shows a continuous extension trend. Frequent large-scale deaths of cultured Yesso scallops in summer not only affect the market supply of Yesso scallops, but also bring huge economic losses to the Yesso scallop aquaculture industry. Therefore, it is urgent to breed improved varieties of Yesso scallops with high temperature tolerance characteristics.

[0003] Single nucleotide polymorphism (SNP), as one of the preferred markers in genetic breeding research, has the advantages of high polymorphism, wide distribution, and high genetic stability and accuracy. Currently, it has been used as one of the preferred markers in genetic breeding research and is widely applied in the molecular genetic breeding of aquatic animals.

[0004] MNK (Mitogen activated protein kinase interacting kinase) is a substrate or binding factor of extracellular regulated proteinkinases (ERK), encoded by two groups of genes, MKNK1 and MKNK2. Each group of genes is further translated into 2 subtypes through alternative splicing, namely: MNK1a, MNK1b and MNK2a, MNK2b. Existing research shows that as a kinase acting downstream of the MAPK pathway, since it was first discovered in 1997, MNK has been proven to activate the DNA damage response caused by ionizing radiation in Drosophila melanogaster ( Drosophila melanogaster ), thus participating in the process of apoptosis. However, currently, in marine economic animals, the research on MNK is still relatively scarce. So far, there is no relevant report on breeding high temperature tolerant Yesso scallops based on MNK1 SNP sites in the exon region of the gene. Summary of the Invention

[0005] The present invention aims to solve the above-mentioned technical problems existing in the prior art, and provides a primer and method for screening Yesso scallops with high temperature tolerance characteristics based on SNPs.

[0006] The technical solution of the present invention is: a primer for screening Yesso scallops with high temperature tolerance characteristics based on SNPs, and the DNA sequences of its upstream primer F1 and downstream primer R1 are as follows:

[0007] F1: 5'- GGACGGATTGTAGCAAGAAGCGATT - 3';

[0008] R1: 5'-ACTCCGCTTATCTACATCCAGTTTCAC -3'.

[0009] A method for screening Yesso scallops with high temperature tolerance characteristics based on SNPs using the above primers is carried out in the following steps in sequence:

[0010] Step 1. Extract RNA from Yesso scallops and transcribe it into cDNA;

[0011] Step 2. Using Yesso scallop cDNA as a template, perform PCR amplification to obtain a target sequence containing MNK1 the T652G, C659G, and T686T sites in the gene exon region;

[0012] Step 3. Perform gene sequencing on the target sequence;

[0013] Step 4. Scallops with the genotypes of AG at the T652G site, CA at the C659G site, and CA at the T686T site in the gene exon region of Yesso scallops are defined as high temperature tolerant scallops. MNK1

[0014] The PCR amplification system is calculated based on 10 μL, including 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.8 μL of dNTP, 1 μL of Buffer, 1 μL of DNA template, and 0.2 μL of Taq enzyme, and the balance is made up with ddH2O; the PCR amplification reaction program is pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, annealing at 53.5 °C for 30 s, extension at 72 °C for 1 min, for 35 cycles; final extension at 72 °C for 10 min, and preservation at 4 °C.

[0015] The present invention is based on Yesso scallops MNK1 ​The genotype of T652G site in the exon region of the gene is AG, the genotype of C659G site is CA and the genotype of T686T site is CA as molecular markers (SNPs), PCR primers were designed, and the target sequence was amplified by PCR and sequenced to screen the high temperature resistant varieties of Yesso scallops, which have the advantages of genetic stability, accuracy and high efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the bivalve opening height of the Yesso scallop under high temperature stress of 24℃.

[0017] Figure 2 The scallop was exposed to high temperature at 24℃. MNK1 Schematic diagram of relative gene expression levels.

[0018] Figure 3 Scallop MNK1 Electrophoresis pattern of PCR amplification product fragments in the exon region of the gene and SNP site sequencing results.

[0019] Figure 4 Scallop MNK1 Multiple sequence alignment sequencing results of gene exon region. DETAILED DESCRIPTION

[0020] Step 1. Extract RNA from scallop and transcribe it into cDNA;

[0021] Step 2. Using the cDNA of the scallop as a template, PCR amplification was performed to obtain MNK1 The target sequence of the T652G, C659G and T686T sites in the gene exon region, the PCR amplification system is calculated as 10 μL, including 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.8 μL of dNTP, 1 μL of buffer, 1 μL of DNA template and 0.2 μL of Taq enzyme, and the balance is supplemented with ddH2O. The DNA sequences of the upstream primer F1 and the downstream primer R1 are as follows:

[0022] F1 (SEQ ID No. 2): 5'-GGACGGATTGTAGCAAGAAGCGATT - 3';

[0023] R1 (SEQ ID No.3): 5'- ACTCCGCTTATCTACATCCAGTTTCAC -3';

[0024] Taq enzyme was Taq enzyme [LA Taq PCR enzyme (Mg 2+Pre-mix), product number: RR02MA. The program of the PCR amplification reaction is pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, annealing at 53.5 °C for 30 s, extension at 72 °C for 1 min, 35 cycles; final extension at 72 °C for 10 min, and storage at 4 °C.

[0025] Step 3. Perform gene sequencing on the target sequence, and its DNA sequence is shown as SEQ ID No.1, that is

[0026] TCTTGTTGGTTACGGATTTATGCGAATGCAGTTTTAGTGATAAGATCTGGGAGAGAGCACATTTGTGTTCAAAGTCAAGTGATACAGTTGTTTAAACAAAAGACAACACCAGTTTACCAAAATGTTAGAGGTAGAGCATCAGGCTTTTTATAACCTATCGCCAAGAAGACCATCTAGTCTAATGTTAGACCGCGTACTTGCTGCATTGCCCTCGCTGGACATGGACCCGATTATGGAAGATATTGAGTTGAGAAATATTGAAAGTTCAACAATGAACCGCCGTCCATCAAGAAACAAGAAGAAACGTCGAAAGGAAGACCAACCTGCCCAAAAATTCAATGATCTTTACACCCCTACTGGAGAAAAGCTGGGGAGTGGTGCCTATGCTTCTGTAAATACGTACCGCAAAAATACAACCCAGAAACAGTATGCTGTAAAAGTTATTGAAAAAGATTTTGGAAGGTCACGGAAGAAGGTGTTCAAGGAGATTGAAATTTTTCACTTGTGCCAAAGTGAAGAGAATATTTTACGGTTGCATGAATACTTTGAGGAGGAAGAAAGATTTTATTTGGTGTTTGATTTGATGCATGGAGGAACCCTGTTGAACAACATTGAGAGGAGGGGCCATGTGACGGAGTTTGAAGCAAGCT TAG TGAT CCG AGATATTGCGAAAGCTCTTCACTT TCTTCATAAAGAAGGGGATTGCTCACAGAGACCTGAAACCAGAAAACATTTTTATGCGAGAAGAAAGACGAGGTTGTTTCCCATCCGTATCTGTGACTTTGACCTTGCCAGTGGTGTGCCTATCAATAGTCAGAACGACAACTGTACAACACCTGAACTCCTGACCCCTGTAGGGTCAGCCGAGTACATGGCACCTGAGGTTGTGGATGCTTGGGTTGGCGAATCTTTTTCCTATGACAAGAAATGTGATCTCTGGAGTTTAGGAACAATTTTGTATATCGTGCTGTGTGGCTATCCCCCTTTCTATGGACAATGTGGAGAGGATTGTGGTTGGGAAAGAGGAGAAGCTTGCCAGTCTTGCCAAGAAAATCTTTTTACACGAATTCAAGATGGTGTGTTTGAGTTTCCTGAAAATGAGTGGAGTGAGATATCTGAGGAAGCCAAGGATTTGATCCGAAAGCTTTTGGTTAGGGACCCACGTAGACGGTTATCAGCCAAGGAAGTCCTGAACCATCCCTGGGTGACAACCCCTCCCCTTCCCACCCCGCTGGCCACCCCAAGGATCCTTACAAGAAACAACAGTACAAAAGATCTGGAATGTTTTGCCGGAGAAGCAGTCTCTATCAACAGAATGATGCAACAGCATCTACACATAAATGAGGCACCATCATTTTTCATTGGGCGTAGATCCCGAGGTGGTGAAAGACAGCCAGGAGGATGAGGACGAGTCTGACAGGCAAGTCTATACAATGGA。

[0027] The obtained target sequence contains the SNP sites (the positions indicated by bold underlines) of the Patinopecten yessoensis MNK1 gene: T652G, C659G and T686T sites;

[0028] Step 4. The Patinopecten yessoensis MNK1 scallops with the genotypes of AG at the T652G site, CA at the C659G site, and CA at the T686T site in the exon region of the gene are the Patinopecten yessoensis with the characteristic of high temperature tolerance.

[0029] Experiment:

[0030] Measure the high-temperature tolerance traits of the same family of cultured Patinopecten yessoensis under the same aquaculture management conditions. When the aquaculture temperature is 24°C, select scallop individuals with the opening height of the bivalve shells of Patinopecten yessoensis greater than 0.5 cm ( Figure 1 ), which are the high-temperature intolerant group (HN group); at the same time, select scallop individuals with the bivalve shells of Patinopecten yessoensis tightly closed when the aquaculture temperature is 24°C, which are the high-temperature tolerant group (HR group). Extract the RNA of scallops in each group and reverse transcribe it into cDNA, and use qRT-PCR amplification to analyze MNK1 the relative expression levels of genes in the HR group and the HN group.

[0031] The qRT-PCR amplification system is calculated as 20 μL, including 0.8 μL of the upstream primer, 0.8 μL of the downstream primer, 0.8 μL of ROX Reference Dye, 10 μL of TB Green Premix Ex Taq, 2 μL of the DNA template, and the balance is made up with ddH2O. Subsequently, the program for the qRT-PCR amplification reaction includes: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing at 60°C for 60 s, and reacting for 35 cycles; 10 s at 95°C, 1 min at 65°C, 1 s at 97°C; the sequences of the upstream primer and the downstream primer are as follows:

[0032] Upstream primer F2 (SEQ ID No.4): GATCTGGAATGCTTCGCTGGAGAG;

[0033] Upstream primer R2 (SEQ ID No.5): TCCTCGTCTTCCTGGCTGTCTTC;

[0034] Using the primers of the internal reference gene ( β-actin ), calculate the relative expression levels of the products of each qRT-PCR amplification.

[0035] The high-temperature tolerance traits of scallops in the HR group and the HN group, as well as MNK1 the analysis results of the relative expression levels of genes are as Figure 2 shown, and "**" indicates a highly significant difference compared with the HN group ( P < 0.01). Figure 2 It shows that there are significant differences in the relative expression levels of MNK1 genes in scallops of the HR group and the HN group, and it is judged that this gene is closely related to the high-temperature tolerance traits of Patinopecten yessoensis.

[0036] Furthermore, RNA was separately extracted from each group of Patinopecten yessoensis and reverse transcribed into cDNA. PCR amplification was performed using the primers with DNA sequences shown in SEQ ID No.2 and SEQ ID No.3; the PCR amplification system was formulated to be 10 μL in total, including: 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.8 μL of dNTP, 1 μL of Buffer, 1 μL of DNA template, and 0.2 μL of Taq enzyme, and the remaining volume was made up with ddH2O. Subsequently, PCR amplification reaction was carried out, and the procedure included: pre-denaturation at 95 °C for 10 min; denaturation at 95 °C for 30 s in a cycle, annealing at 60 °C for 30 s, pre-elongation at 72 °C for 1 min 30 s, with 35 cycles of reaction; extension at 72 °C for 10 min, and preservation at 4 °C.

[0037] The amplified products were sequenced, and the obtained SNP sites were genotyped ( Figure 3 ), and MNK1 multiple sequence alignment was performed on the sequencing results of the exon region ( Figure 4 ), and it was found that MNK1 there were three mutation sites, T652G, C659G, and T686T, in the exon region of the gene. Among them, T652G was a transition site, and C659G and T686T were transversion sites. From Table 1, it can be seen that the genotype of the T652G site in the MNK1 gene of the high-temperature tolerant scallop individuals was AG, the genotype of the C659G site was CA, and the genotype of the T686T site was CA. The above genotypes could be used as SNP sites for screening Patinopecten yessoensis with high-temperature tolerance characteristics.

[0038] Table 1 MNK1 Genotype frequencies and allele frequencies of the gene

[0039]

[0040] HN: High-temperature intolerant scallop; HR: High-temperature tolerant scallop; P The values were all compared with the HN group.

[0041] Using the SNP primers in the present invention, PCR amplification and sequencing were performed on the MNK1 gene of 60 individuals from the same cultured Patinopecten yessoensis family under the same aquaculture management conditions. 40 Patinopecten yessoensis individuals were screened out, and the genotype of the T652G site in the MNK1 gene was AG, the genotype of the C659G site was CA, and the genotype of the T686T site was CA. The remaining 20 individuals did not meet the requirement that the genotype of the T652G site in the MNK1 gene was AG, the genotype of the C659G site was CA, and the genotype of the T686T site was CA. A 24 °C high-temperature stress treatment was carried out, and the result was that the screened MNK1All 40 individuals of Patinopecten yessoensis with the genotype AG at the T652G locus, CA at the C659G locus, and CA at the T686T locus in the gene survived, while the remaining 20 individuals all died.

Claims

1. A method for screening Yesso scallops with high temperature tolerance based on SNPs, characterized in that It is carried out successively according to the following steps: Step 1. Extract RNA from Patinopecten yessoensis and transcribe it into cDNA; Step 2. Using the cDNA of Patinopecten yessoensis as a template, perform PCR amplification to obtain a target sequence containing the MNK1 T652G, C659G, and T686T sites in the exon region of the gene; the DNA sequences of the upstream primer F1 and the downstream primer R1 for the PCR amplification are as follows: F1: 5'- GGACGGATTGTAGCAAGAAGCGATT - 3'; R1: 5'-ACTCCGCTTATCTACATCCAGTTTCAC -3'; Step 3. Perform gene sequencing on the target sequence; Step 4. The Patinopecten yessoensis with a DNA sequence as shown in SEQ ID No.1 MNK1 The Patinopecten yessoensis with the genotype AG at the T652G locus, genotype CA at the C659G locus, and genotype CA at the T686T locus in the exon region of the gene has the characteristic of high temperature tolerance.

2. The method for screening Yesso scallops with high temperature tolerance based on SNPs according to claim 1, characterized in that: The PCR amplification system is calculated as 10 μL, including 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.8 μL of dNTP, 1 μL of buffer, 1 μL of DNA template and 0.2 μL of Taq enzyme, and the balance is made up with ddH2O; The procedure of the PCR amplification reaction is pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, annealing at 53.5 °C for 30 s, extension at 72 °C for 1 min, 35 cycles; final extension at 72 °C for 10 min, and storage at 4 °C.