Application of Indel marker dosage typing in detection of sweet potato soft rot resistance

Abstract

The invention discloses application of Indel marker dosage typing in detection of sweet potato soft rot resistance, and belongs to the technical field of plant genetic engineering. The Indel molecular marker related to the sweet potato soft rot resistance is obtained through screening, the nucleotide sequence of the Indel molecular marker is shown as SEQ ID NO.2, and an 8bp sequence is inserted into or deleted from the 161st site of the sequence shown as SEQ ID NO.2. Experiments find that target bands of amplification products are obtained through amplification of the Indel molecular marker and electrophoresis, dosage values of two genotypes are obtained according to gray values of the dyed electrophoretic bands, and results show that the insertion type Indel molecular marker is positively correlated with the sweet potato soft rot resistance. The method is of great significance to the dose effect research and molecular assisted breeding of sweet potato gene functions.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic engineering, and particularly relates to application of Indel marker dosage typing in detection of sweet potato soft rot resistance. BACKGROUND

[0002] Sweet potato (Ipomoea batatas [L.] Lam.) is a hexaploid crop (2n = 6x = 90) that originated in South America and has been domesticated for more than 5,000 years. Sweet potato has high yield, strong environmental adaptability, and contains a large amount of starch, and can be used not only as an important food, but also as a feed, an industrial raw material and a new energy source. Sweet potato is an excellent source of nutrients, including vitamins, potassium, iron, calcium and minerals, and has medicinal value due to its anticancer, antidiabetic and anti-inflammatory activities, and is deeply loved by people.

[0003] There are a large number of Indel allelic variations in the genome of sweet potato, and the Indel allelic variations usually lead to changes in gene expression levels, regulatory functions and translation results. Due to the complex genome and polyploidy of sweet potato, it is impossible to type Indel by traditional PCR-agarose electrophoresis and the like. Therefore, it is impossible to evaluate the differences in gene expression and regulation levels caused by Indel allelic variations, and the development of gene function research of sweet potato is hindered.

[0004] The dose effect cannot be distinguished by using traditional agarose electrophoresis, and the price is high by using high-throughput sequencing. Therefore, it is very important to develop a dosage typing method suitable for homologous hexaploid sweet potato Indel for the gene function research of sweet potato. SUMMARY

[0005] The purpose of the present application is to provide application of Indel marker dosage typing in detection of sweet potato soft rot resistance, so as to solve the problems in the prior art. The corresponding gray values of two genotypes of Indel molecular marker bands are obtained by high-concentration polyacrylamide gel electrophoresis, and the dosage of the Indel molecular marker is calculated according to the proportion of the gray values. It is found that the dosage of the insertion type Indel molecular marker is positively correlated with the resistance of sweet potato to soft rot, which has important significance for the dosage effect research and molecular assisted breeding of sweet potato gene function.

[0006] In order to achieve the above purpose, the present application provides the following scheme:

[0007] The present application provides an Indel molecular marker related to the resistance of sweet potato to soft rot, and the nucleotide sequence of the Indel molecular marker is shown in SEQ ID NO. 2. The sequence shown in SEQ ID NO. 2 is inserted or deleted by 8bp sequences from the 161th position.

[0008] Preferably, the inserted or deleted 8bp sequence is TTGGTCAG.

[0009] The application also provides a primer pair for amplifying the Indel molecular marker, and the nucleotide sequences of the primer pair are shown in SEQ ID NO. 3-4.

[0010] The application also provides a kit for detecting the resistance to soft rot of sweet potato, comprising the primer pair.

[0011] The application also provides the application of the Indel molecular marker, the primer pair or the kit in any of the following aspects:

[0012] (1) the application in detecting the resistance to soft rot of sweet potato;

[0013] (2) the application in the molecular breeding of sweet potato against soft rot;

[0014] (3) the application in screening sweet potato against soft rot.

[0015] Preferably, the dosage of the insertion-type Indel molecular marker is positively correlated with the resistance to soft rot of sweet potato.

[0016] Preferably, the dosage of the insertion-type Indel molecular marker is calculated according to the number of homologous chromosomes occupied by the insertion-type Indel molecular marker in the homologous hexaploid sweet potato chromosome.

[0017] The application also provides a method for detecting the resistance to soft rot of sweet potato, comprising the following steps:

[0018] Taking the genomic DNA of the sweet potato to be detected as a template, the Indel molecular marker is amplified by PCR using the primer pair with the nucleotide sequences shown in SEQ ID NO. 3-4, the amplification product is subjected to electrophoresis, the dosage values of the two genotypes are obtained according to the gray values of the electrophoretic bands after staining, and the resistance to soft rot of the sweet potato to be detected is determined according to the dosage values of the two genotypes.

[0019] Preferably, the dosage values of the two genotypes are calculated according to the number of homologous chromosomes occupied by the Indel molecular marker of the two different genotypes in the homologous hexaploid sweet potato chromosome.

[0020] Preferably, the determination method is that the dosage of the insertion-type Indel molecular marker is positively correlated with the resistance to soft rot of sweet potato.

[0021] The application discloses the following technical effects:

[0022] This invention proposes a dose-typing method for Indels in autohexaploid sweet potatoes for the first time: by comparing the target sequence with multiple sweet potato genome sequences, the Indel allelic variants of the target band are rapidly obtained. Subsequently, the target Indel region is amplified using specific primers, and the amplicon is separated by electrophoresis using a high-concentration polyacrylamide gel, followed by silver staining to obtain the target band. The Indel dose is obtained by calculating the grayscale ratio using ImageJ. This method enables dose-typing of Indel allelic variants in autohexaploid crops. Based on this method, this invention discovers an Indel molecular marker significantly associated with sweet potato soft rot: an 8 bp inserted Indel with the insertion sequence TTGGTCAG is found in the IbWRKY26 promoter region (upstream of ATG - 536 bp). This inserted molecular marker is positively correlated with sweet potato soft rot, which is of great significance for dose-effect studies of sweet potato gene function and molecular-assisted breeding. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 To determine the Indel location through multiple comparisons between the target sequence and the reference genome;

[0025] Figure 2 To verify the existence of Indel in germplasm;

[0026] Figure 3 The results of sequence analysis of sweet potato varieties Nongdabai (NDB) and Shangshu 19 (S19) with high resistance to soft rot using first-generation sequencing;

[0027] Figure 4 To evaluate the dose-response effect of Indel allelic variation on sweet potato soft rot resistance;

[0028] Figure 5 Genotyping and dosage acquisition for the target Indel allelic variant. Detailed Implementation

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0031] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0032] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0033] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0034] The dose typing method for autohexaploid sweet potato Indel involved in this embodiment of the invention specifically includes the following steps:

[0035] (1) Obtain the Indel allelic variant sequence of the target fragment; use the target nucleotide sequence to perform multiple sequence alignment on multiple reference genomes of sweet potato (https: / / sweetpotato.uga.edu / index.shtml).

[0036] (2) Determine the presence of the target fragment Indel allelic variant in the germplasm; extract genomic DNA from different germplasms, design conserved primers at both ends of the target Indel allelic variant, and perform PCR amplification (amplification product approximately 500 bp). Ligate the amplification product into the PMD19-T vector, transform it into E. coli DH5α, randomly select about 5 single clones for first-generation Sanger sequencing, and further perform multiple sequence alignment on the sequencing results to confirm the actual presence of Indel in the germplasm material (optional step).

[0037] (3) Specific primer design and PCR amplification; Genotyping of the identified Indels and primer design using multiple comparison sequences. Primer design principles include: ① Primers should not contain any SNPs or Indels; ② Amplicon size should be approximately 200 bp; ③ Amplicon should not contain any Indels other than the target Indel, nor should it contain any base insertions or deletions; ④ A small number of base substitutions are allowed in the amplicon; ⑤ Primer length should be approximately 15-25 bp, avoiding the occurrence of continuous repetitive sequences. PCR amplification should be performed according to the parameters of the corresponding DNA polymerase product. The amplification template (genomic DNA) concentration is 100 ng / μL; the obtained amplification products are subjected to agarose gel electrophoresis to determine whether the products have been amplified.

[0038] Indel dose typing using high-concentration polyacrylamide gel: High-concentration polyacrylamide gel electrophoresis was performed using the amplicon obtained in step (3), followed by silver staining of the gel to obtain bands. After taking pictures of the bands, the corresponding gray values ​​of the bands were obtained using ImageJ software, and the Indel dose was calculated by the gray value ratio.

[0039] Based on the above typing method, this invention screened an Indel molecular marker associated with sweet potato soft rot resistance, and conducted a correlation analysis between the dosage of this molecular marker and sweet potato soft rot. The following specific examples further illustrate this.

[0040] Example 1: Indel dose typing and correlation analysis of sweet potato soft rot resistance

[0041] 1. Test materials

[0042] Twenty-five different varieties / lines of sweet potato (Zhe 132, Sushu 8, Nanshu 95, Zhe Zishu 2, Yanshu 25, Longshu 9, Danyan Hongxinshu, Pushu 32, Xushu 33, Anping 1, Yushu 13, Fushu 404, Yanshu 5, Taizhong 11, Shangqiu 52-7, Taizhong 6, Taizi 1506, Funingzi 4, Zheshu 33, Nongda Bai, Xushu 18, Fujian Liancheng, Zheshu 6025, XP139, and Guangzishu 2) were planted at the Hongqi Base of China Agricultural University in Sanya City, Hainan Province. They were planted in single rows with raised beds and mulch, with a plant spacing of 25cm. Each line was planted with 10 replicates. Basic field management, including regular watering and weeding, was carried out. The growth cycle was 120 days, and tubers were harvested.

[0043] 2. Determination of Indel allelic variations related to resistance to soft rot

[0044] Multiple sequence alignments were performed on different reference genomes based on the identified sweet potato soft rot resistance gene IbWRKY26. Figure 1An 8 bp insertional indel was found in the IbWRKY26 promoter region (536 bp upstream of ATG), with the inserted sequence TTGGTCAG. Further specific amplification of this region using different germplasm resources, followed by ligation with PMD19-T and first-generation sequencing, revealed that this indel allelic variant truly exists in different sweet potato germplasms. Figure 2 This can be further used for dose typing. The 8 bp insertion type is named ProIbWRKY26. R The missing 8 bp type is named ProIbWRKY26 S .

[0045] (1) Sequence analysis was performed on the highly resistant sweet potato variety Nongdabai (NDB) and the highly susceptible variety Shangshu 19 (S19) using first-generation sequencing. An 8 bp (TTGGTCAG) Indel allelic variant was found in the promoter, with dose differences observed. The highly resistant variety NDB contained four 8 bp insertion variants, while the highly susceptible variety S19 contained only two, such as... Figure 3 As shown, the dosage of this variant site may be significantly associated with resistance to sweet potato soft rot.

[0046] (2) To assess the dose-effect of this Indel allelic variant on sweet potato soft rot resistance, Hi-tom deep sequencing was used to perform deep sequencing on the amplified sequences of the variant region in eight varieties. The soft rot resistance of the eight varieties was then assessed. The proportions obtained from the sequencing results were converted into their percentages in the hexaploid sweet potato chromosome. The results are as follows: Figure 4 As shown, the 8 bp insert type (ProIbWRKY26) R The higher the proportion of the type (e.g., *Hypertribenza*), the stronger the resistance to sweet potato soft rot. However, Hi-tom deep sequencing is expensive and time-consuming.

[0047] 3. Specific primer design and PCR amplification

[0048] DNA was extracted from the leaves of the 25 different sweet potato varieties mentioned above using the CTAB method. The steps are as follows:

[0049] (1) Prepare a CTAB solution containing 1%-2% β-mercaptoethanol and the same volume of 24:1 (chloroform:isoamyl alcohol), and preheat the prepared CTAB in an oven at 65°C.

[0050] (2) Collect 20 mg of tender tissue from the unfolded leaves of sweet potato, put it into a 2 mL centrifuge tube, freeze the sample with liquid nitrogen, and grind it with a sample grinder (45 Hz, about 60 s).

[0051] (3) Add 800 μL of CTAB solution preheated at 65℃ to the centrifuge tube, mix the sample and solution, and then incubate in a 65℃ oven for 30 min. Take it out and shake it every 5-10 min to mix it thoroughly.

[0052] (4) Add an equal volume of chloroform and isoamyl alcohol mixture (24:1) to CTAB, gently invert and mix 100-400 times, then let stand in a fume hood for 5-10 minutes. Once the supernatant and precipitate are clearly separated, balance the mixture in a centrifuge and centrifuge at 13000 rpm at room temperature for 10 minutes.

[0053] (5) Take 400 μL of isopropanol into a 1.5 mL EP tube in advance and pre-cool it in a -20℃ refrigerator; take 400 μL of supernatant and add it to the pre-cooled isopropanol, mix thoroughly and then place it in a 4℃ refrigerator for 20-30 min.

[0054] (6) After standing, centrifuge at 13000 rpm for 5 min, use a pipette to remove the supernatant, add 600-800 μL of 70% ethanol, centrifuge at 13000 rpm at room temperature for 1 min, and then discard the supernatant.

[0055] (7) Wash with 70% ethanol 2-3 times again, discard the supernatant and dry it in a clean bench.

[0056] (8) Add 100 μL of sterilized deionized water. After the DNA is completely dissolved, use NanoDrop (Thermoscientific) to determine the concentration of extracted DNA.

[0057] (9) Take a small amount of DNA for 1% agarose gel electrophoresis to detect its purity. Use 1×TAE as the electrophoresis buffer, 180 V voltage, 300 mA current for 10 min electrophoresis. Select strains with clear agarose gel electrophoresis bands and DNA concentration greater than 100 ng / μL and store them in an ultra-low temperature freezer at -80℃ for later use.

[0058] Primers were designed using multiple comparison sequences, based on the primer design principles described above: The primers shown below are as follows:

[0059] ProIbWRKY26-dosage-F: 5'-GTCGTGTACAGAGGGGAATC-3' (SEQ ID NO.3);

[0060] ProIbWRKY26-dosage-R: 5'-GTTATTAAGTTAATAGT-3' (SEQ ID NO. 4).

[0061] The PCR system and procedure are shown in Table 1 and Table 2.

[0062] Table 1 PCR reaction system

[0063]

[0064] Table 2 PCR reaction procedure

[0065]

[0066] 4. Indel dose classification

[0067] Non-denaturing high-concentration polyacrylamide gel electrophoresis can be used to distinguish small Indel fragments of a few bp. Furthermore, the dosage values ​​for the two genotypes are obtained using the grayscale values ​​after band staining. The Indel size of this invention is 8 bp, and genotype separation and dosage acquisition are performed using descriptive methods.

[0068] 4.1 Preparation of non-polyacrylamide gel and electrophoresis solution

[0069] First, the amplification products obtained in the above steps were subjected to agarose gel electrophoresis to determine whether the amplification was successful. The amplification products were then further separated by high-concentration non-denaturing polyacrylamide gel electrophoresis. The gel and electrophoresis buffer formulations are shown in Table 3 below.

[0070] Table 3. Main reagents and preparation methods for electrophoresis

[0071]

[0072] 4.2 Non-denaturing polyacrylamide gel electrophoresis

[0073] The preparation method and electrophoresis steps for 12% non-denaturing polyacrylamide gel electrophoresis plates are as follows:

[0074] (1) Glass plate pretreatment: Place the gel attachment plate and the gel peeling plate horizontally, and wipe the dirt and residue on the glass plate with 95% alcohol; wipe the gel attachment plate and the gel peeling plate with the prepared affinity alkylsilane and peeling alkylsilane respectively, and let them air dry for 5 minutes before use.

[0075] (2) Gel preparation: Place the gel attachment plate horizontally, cover it with the gel peeling backing plate and align it with the attachment plate, and clamp it with a clamp. Prepare a 12% polyacrylamide gel solution (60 mL 12% non-denaturing polyacrylamide gel, 400 μL 10% ammonium persulfate, 40 μL TEMED), mix it thoroughly in a 100 mL Erlenmeyer flask, and slowly pour it into the gap between the two glass plates. Slowly insert a comb into the gel solution between the two plates, and let it stand horizontally at room temperature for about 60 min until it solidifies.

[0076] (3) Pre-electrophoresis: After the gel solidifies, install the gel plate vertically on the electrophoresis tank and fix it with a clamp. Add 1×TBE buffer to the electrophoresis tank. The buffer should be flush with the glass plate. Gently pull out the comb and use 190 V voltage and 250 mA current for pre-electrophoresis for 30 min.

[0077] (4) Sample loading: Use a 200 μL pipette to blow out the air bubbles and residual gel in the sample well, and use a 10 μL pipette to slowly inject 2.5-3 μL of PCR product into the sample well.

[0078] (5) Electrophoresis: Electrophoresis is performed at 190 V voltage and 250 mA current. The electrophoresis time is determined according to the size of the amplified product and the position of the indicator. The electrophoresis time is 4 h.

[0079] 4.3 The solutions required for silver staining and development must be prepared fresh for each use. The specific steps for staining and development are as follows:

[0080] (1) Preparation of staining and developing solutions: The staining solution is prepared using silver nitrate. Add 1 g of silver nitrate powder to 800 mL of pure water. After the silver nitrate dissolves, add pure water to bring the total volume to 1 L. The developing solution is prepared using sodium hydroxide and formaldehyde. Add 15 g of sodium hydroxide to 800 mL of pure water. After it dissolves, add pure water to bring the total volume to 1 L. Finally, add 4 mL of formaldehyde solution to the fume hood, mix well, and set aside.

[0081] (2) Staining: After electrophoresis, remove the glass plate and gently peel off the gel back plate with a knife. Place the plate with gel attached into the staining basin and put it into the fume hood. Add the prepared silver nitrate staining solution to cover the gel surface and stain for 20-30 minutes. During this period, shake the staining solution once every 3 minutes.

[0082] (3) Rinsing: After dyeing, rinse the glue surface with pure water for about 30 seconds.

[0083] (4) Development: Pour the prepared developer into the rinsed gel in a fume hood. After the developer covers the gel surface, shake it well and let it stand for 3-5 minutes. When the bands are clearly visible, take a picture and save it. The development is then complete.

[0084] 4.4 Dosage typing: Bands of different genotypes were separated using the above method. ImageJ software was then used to obtain the grayscale values ​​of the bands of different genotypes, and the ratio of grayscale values ​​(areas corresponding to the bands) between the two band types was calculated to obtain the dosage value. The bands were then labeled with 0-6 homologous chromosomes according to their proportion in the hexaploid sweet potato. Figure 5 ).

[0085] 5. Correlation analysis between Indel dose-effect and phenotype

[0086] Using the ProIbWRKY26 obtained above R and ProIbWRKY26 S Correlation analysis between dosage and sweet potato soft rot phenotype demonstrated a significant positive correlation between the dose effect of the 8 bp insertion and sweet potato soft rot. (See [link to relevant documentation]). Figure 5 .

[0087] Seven varieties / lines were selected for further analysis of the association between genotype and phenotype. The results are shown in Table 4.

[0088] Table 4. Soft rot phenotypes of 7 varieties / lines and ProIbWRKY26 R dose

[0089]

[0090] Further analysis of the correlation between ProIbWRKY26R dosage and lesion area in Table 4 shows that ProIbWRKY26 R The dosage was significantly positively correlated with sweet potato soft rot resistance, demonstrating that this Indel may have related soft rot resistance function and can also be used as a molecular marker for molecular breeding of sweet potato soft rot resistance.

[0091] The IbWRKY26 gene sequence involved in this invention (SEQ ID NO.1):

[0092] CCATACACAAGTAACTCCTCGTGCAATGACTACATGCACAATAATGGAAATGTGTTGACTTTATTGATCATTGCGATATTTAGGCATTGGATTCAATTTTCTAGATCATATCGATGAAATTAGATTTTGATTTTGATGTTCATGTTAGTGATGATGTTTAATTTAGGTCAGGTAAAAAGATAGGTTTGAAAAGAAGAGAGTAGAGAGGGAGTGATATTGTATGTGTATTCAAAGAGGAAAATTAACATATAAACGTTATTAAGGTTGTTTTTAGTGAGGGTCGAATTAATGATTAAGAATTTTGACTATATAGTTTATGTTCTTACAAATCATATCAAACTGACGGGATATACGACAAATATAGTGTACAATGCCCTAGATCCGACAAAATCTTAAGACTTCCGCACCTTTAATTTGGAGTTGATTTTCGATCACAGAAGCATCGCATCAACTGTCACTGTCTTGAAAGTCACATCAGCACTA AACACGTGTCACAACCAATCTAAGCCATGCGGTGACTGTCTACCGCGTTAGCCTACCTTGTTAACAAATTTTCAATAGTATGCGTGTTTCCTTCTCTGATCTAACTATATAAATACTATGCTCTACCAATTAATATCTTGAAAATGGATATGATTTATGAAACTCTATACATATTTTCTAACCTAATCAGAGTTTTTCGAGCTCACTTGTAATTTAAGATTGTAATTGACATCTTTACTAAAACCAATAATATTATTACTTCATTTCATTTCATTATCTCTCAACTTTATATTATAATACCTGGTAGTGTATAAATCCCATGCCATCCACGCTATCAGAAACTTAAGCATGATTCTCTTTTTGAGACAAAGCAACTAATTACTTTTACAATTAAATTATTTAGTTGTTTAAACCAAACCAATAACTGTGGAGTACCCTACAAAAATGCAAAATTCCAACAAAAAAAAATTAAAAAGTCTTCGC GTCGTGTACAGAGG GGAATCAAAATACAGTTTTGGAATAAGCGTATGTTACGATGCACATGTGCTGCTTAATATACGGAGAGATGTTGAGGCACATGTCCGACTTTATGAATCAATTTAATCTGCTCACTAAAAATAAAACTTTTAAATTATCACACAAA TTGGTC AGACTATTAACTTAATAAC CACAAAATTTTAAGAGTAATCTATTAACTTTATTAGTTTGAATCGGTTAACTGTAAATAACATAGATTAATTTATATTATCTAAATTTACTCAATATAACTTTCAGTAATGATTACAGATTTATCTCGTCATTAAAAAAAAATTAAAAAATAAAGCATGACGTGGCATGATGACATGTGAAGCGTGGAGCGTGCGGTGTACTGGCGCACAGAGGATCGTGTCACCTCCAGTCTGATTCAGCCGCCGAGAGGCGGT CAAACCCACAAGCTTTGACTCGAGCAAAGACAGAAATATGTGTTTTCCGCGGTCAAACCTCCATCAAGCTTCCTAGAAGAAGCCTTCATGACCTTTTCACCAAGCAATCCACCACCATACATATTAAGC CTCCATCATCTTCTCCCTCACAAAATCTTTCATTTTTTCTTTCATCTTCTCTCCTACTCCTCCTTTTATCTTCTCTGCAAAAACCTGAGAGAGATCGATCCAACGcagcaaaaaccagtcaaaaaaaaa ATG

[0093] Note: Bold + underlined bases represent the 8 bp Indel mentioned in this invention; bold + wavy bases represent transcription start codons; double underlined parts are the upstream and downstream primers for amplifying the Indel molecular marker (the sequence containing the upstream primer, downstream primer and the sequence between them is the Indel molecular marker of this invention, and the gene sequence number is SEQ ID NO.2).

[0094] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An Indel molecular marker associated with resistance to sweet potato soft rot, characterized in that, The nucleotide sequence of the Indel molecular marker is shown in SEQ ID NO.2, where the sequence in SEQ ID NO.2 has an 8bp insertion or deletion starting from position 161.

2. The Indel molecular marker as described in claim 1, characterized in that, The inserted or deleted 8bp sequence is: TTGGTCAG.

3. A primer pair for amplifying the Indel molecular marker as described in claim 1 or 2, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.3-4.

4. A kit for detecting resistance to sweet potato soft rot, characterized in that, Includes the primer pair as described in claim 3.

5. The use of the Indel molecular marker as described in claim 1, the primer pair as described in claim 3, or the kit as described in claim 4 in any of the following: (1) Application in detecting resistance to sweet potato soft rot; (2) Application in molecular breeding for sweet potato resistance to soft rot; (3) Application in screening sweet potatoes resistant to soft rot.

6. The application as described in claim 5, characterized in that, The dosage of the inserted Indel molecular marker was positively correlated with resistance to sweet potato soft rot.

7. The application as described in claim 6, characterized in that, The dosage of the inserted Indel molecular marker is calculated based on the proportion of the inserted Indel molecular marker in the homologous hexaploid sweet potato chromosomes.

8. A method for detecting resistance to sweet potato soft rot, characterized in that, Includes the following steps: Using the genomic DNA of the sweet potato to be tested as a template, the Indel molecular marker described in claim 1 was amplified by PCR using primers with nucleotide sequences as shown in SEQ ID NO.3-4. The amplification products were subjected to electrophoresis, and the dosage values ​​of the two genotypes were obtained based on the gray values ​​of the electrophoretic bands after staining. The soft rot resistance of the sweet potato to be tested was determined based on the dosage values ​​of the two genotypes.

9. The method as described in claim 8, characterized in that, The dosage values ​​for the two genotypes were calculated based on the proportion of the Indel molecular markers of the two different genotypes in the number of homologous chromosomes in the hexaploid sweet potato chromosomes.

10. The method as described in claim 8, characterized in that, The method for determining this is that the dosage of the inserted Indel molecular marker is positively correlated with sweet potato soft rot resistance.

Images