A multiplex detection method for Vibrio parahaemolyticus, white spot syndrome virus and Enterocytozoon hepatopenaei based on RAA technology

Through the multiple detection method based on RAA technology, the rapid, accurate and sensitive detection of Vibrio parahaemolytica, leukoplakia syndrome virus and shrimp hepatic enteroplasm in the prior art was solved, and the efficiency and specificity of completing the detection within 20 minutes were achieved.

CN119876446BActive Publication Date: 2025-05-30SANYA INSTITUTE OF NANJING AGRICULTURAL UNIVERSITY
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510361936.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-26
Publication Date
2025-05-30
Estimated Expiration
2045-03-26

AI Technical Summary

Technical Problem

The prior art is difficult to detect Vibrio parahaemolytica, leukoplakia syndrome virus and enteroplasma shrimp hepatobili, and traditional methods have problems with equipment dependence and operational complexity.

Method used

Using multiple detection methods based on recombinase-mediated amplification technology (RAA) to design specific RAA primers and probes, a fluorescent RAA reaction system is constructed to achieve synchronous amplification and independent identification of the three pathogens.

Benefits of technology

The detection process is completed within 20 minutes, with high sensitivity and specificity, overcomes equipment limitations and operational complexity, and is suitable for grassroots and resource-limited environments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876446B_ABST
    Figure CN119876446B_ABST
Patent Text Reader

Abstract

The present invention provides a multiplex detection method for three pathogens, namely Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatopenaei, based on RAA. The detection method respectively screens target sequences according to the TLH gene fragment of Vibrio parahaemolyticus, the VP28 gene fragment of white spot syndrome virus, and the 18S rRNA gene fragment of Enterocytozoon hepatopenaei. For each of the three pathogens, a pair of specific RAA primers and a probe are designed and screened, as shown in SEQ ID NO: 1-9. DNA in tissue samples is extracted and a fluorescence RAA reaction system is constructed for fluorescence RAA detection. The detection method for Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatopenaei based on the recombinase polymerase amplification technology provided by the present invention can be used for the combined detection of the above three pathogens, and has the characteristics of rapidity, high specificity, and high sensitivity, and can meet the requirements of disease monitoring and screening.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular detection, and particularly relates to a multiplex detection method for Vibrio parahaemolyticus, white spot syndrome virus and Enterocytozoon hepatopenaei based on recombinase-mediated amplification technology. Background Art

[0002] Litopenaeus vannamei is native to the east coast of the Pacific Ocean and was introduced into China in the late 1980s. It has a fast growth rate, delicious meat, and strong reproductive ability, with high economic value. Currently, it has become an important aquaculture variety in China. Statistical data from the Food and Agriculture Organization (FAO) of the United Nations shows that the total output of Litopenaeus vannamei in China reached 2.0986 million tons in 2022. However, in recent years, the aquaculture industry of Litopenaeus vannamei in China has been deeply poisoned by three pathogens, namely Vibrio parahaemolyticus, white spot syndrome virus and Enterocytozoon hepatopenaei, resulting in certain economic losses. Vibrio parahaemolyticus (Vp) is a halophilic Gram-negative bacterium. In 2010, acute hepatopancreatic necrosis disease (AHPND) of Litopenaeus vannamei caused by Vibrio parahaemolyticus was first discovered. It is the main pathogenic bacterium of bacterial diseases in the aquaculture of Litopenaeus vannamei. At the same time, it is also a pathogen that can cause diseases in both humans and fish. After entering the human body, it will cause foodborne poisoning and acute diarrhea, seriously threatening public health and safety; White spot syndrome virus (WSSV) belongs to the genus White spot virus of the family Nudiviridae. It is a pathogen with extremely strong virulence and is widespread in the main aquaculture areas of Asia. The mortality rate of infected animals can reach 100%, and it has become one of the most harmful diseases in global shrimp aquaculture; Enterocytozoon hepatopenaei (EHP) is an obligate intracellular parasitic protozoan, a microsporidium that is an obligate intracellular parasite. It was discovered in Penaeus monodon with slow growth in aquaculture ponds in Thailand in 2009. In recent years, the prevalence rate of EHP in farmed shrimp in China has remained high, and it has become one of the important pathogens endangering farmed shrimp in China.

[0003] Therefore, there is an urgent need in this field for a rapid, accurate and sensitive detection method for Vibrio parahaemolyticus, white spot syndrome virus and Enterocytozoon hepatopenaei, to avoid the drawbacks of etiological microscopy, serological antibody detection and polymerase chain reaction (PCR), detect the target genes of Vibrio parahaemolyticus, white spot syndrome virus and Enterocytozoon hepatopenaei and meet the requirements of disease detection and screening.

[0004] In recent years, the rapidly developing isothermal amplification technology has greatly reduced the dependence on instrument equipment and improved the timeliness of reactions through the high-efficiency amplification of nucleic acids by certain enzymes under constant temperature conditions, getting rid of the limitations of experimental conditions in nucleic acid amplification. Among them, the Recombinase-Aided Amplification (RAA) technology has the advantages of high sensitivity and high specificity. It does not require expensive experimental equipment and consumables, has a wider application range, and is easier to operate. Its rapid amplification of DNA or RNA can be achieved at a lower temperature, with a fast reaction speed, and amplification products can be obtained within 5 - 30 minutes. Based on the above advantages, the RAA technology shows great potential in pathogen detection. However, there are still many challenges in the multiplex detection of three pathogens, namely Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatopenaei. First of all, the RAA technology requires relatively short amplification fragments (90 - 300 bp), which limits the range of selectable target genes. To achieve accurate detection of the three pathogens, a comprehensive analysis of the gene sequences of the three pathogens is needed to screen out highly conserved and species-specific target fragments to meet the detection requirements of high amplification efficiency and strong specificity. Secondly, multiplex detection requires the simultaneous amplification of the three pathogens in the same reaction system, which puts higher requirements on the compatibility of primer-probe combinations. In addition, specific fluorescent probes are innovatively introduced into the multiplex detection system in this study to ensure the independent recognition of signals from different pathogens. The present invention overcomes the technical bottlenecks of the RAA technology in target screening, multiplex primer-probe design, and complex sample detection, and establishes a detection method for three pathogens, namely Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatopenaei, based on RAA, providing an innovative solution for the rapid and accurate detection of Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatopenaei. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides a multiplex detection method for Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatopenaei based on the RAA technology. The detection method is designed according to the Vibrio parahaemolyticus gene fragment with the accession number JQ929914.1, the white spot syndrome virus gene fragment with the accession number KR057961.1, and the Enterocytozoon hepatopenaei gene fragment with the accession number KX981865.1, and a pair of specific RAA primers and a probe are screened for each pathogen. A positive plasmid is synthesized and a fluorescence RAA reaction system is constructed for fluorescence RAA detection.

[0006] The technical solution of the present invention is as follows:

[0007] The first object of the present invention is to provide a primer-probe combination for recombinase-mediated amplification to detect three pathogens, namely Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatopenaei. The primer-probe combination includes:

[0008] (1) Specific recombinase-mediated amplification primers and probes for detecting Vibrio parahaemolyticus:

[0009] Forward primer VP-F:

[0010] 5’-CTTCATGTTGATGACACTGCCAGATGCGACGAA-3’, as shown in SEQ ID NO.1;

[0011] Reverse primer VP-R:

[0012] 5’-TTAGCGTCTCGAACAAGGCGTGAGTATCAAAC-3’, as shown in SEQ ID NO.2;

[0013] Probe VP-P:

[0014] SEQ ID NO.7-iROXdT-T-idSp-G-iBHQ2dT-SEQ ID NO.8-C3-spacer connected in sequence of 5’-3’;

[0015] 5’-AGTACTCAACACAAGAAGAGATCGACAAAA-iROXdT-T-idSp-G-iBHQ2dT-GCGAAAGTGCTTGAG-C3-spacer-3’;

[0016] Among them, "iROXdT" is a dT nucleotide labeled with ROX (maleimide) fluorescence, "idSp" refers to base deletion, "iBHQ2dT" is a dT nucleotide labeled with a BHQ2 quenching group, and "C3-spacer" refers to 3’ hydroxyl group blocking.

[0017] (2) Specific recombinase-mediated amplification primers and probes for detecting white spot syndrome virus:

[0018] Forward primer:

[0019] WSSV-F: 5’-CATCGAAACCCACACAGGCAATATCGAGACA-3’, as shown in SEQ ID NO.3;

[0020] Reverse primer:

[0021] WSSV-R: 5’-GATCCGCATCTTCTTCCTTCATCTGTGCATC-3’, as shown in SEQ ID NO.4;

[0022] Probe WSSV-P:

[0023] SEQ ID NO.9-iHEXdT-G-idSp-A-iBHQ1dT-SEQ ID NO.10-C3-spacer linked in sequence from 5’-3’;

[0024] 5’-AAACCTCCGCATTCCTGTGACTGCTGAGGT-iHEXdT-G-idSp-A-iBHQ1dT-CAGGCTACTTCAAGA-C3-spacer-3’.

[0025] Among them, "iHEXdT" is a dT nucleotide labeled with HEX (hexachlorofluorescein) fluorescence, "idSp" refers to base deletion, "iBHQ1dT" is a dT nucleotide labeled with a BHQ1 quenching group, and "C3-spacer" refers to 3’ hydroxyl group blocking.

[0026] (3) Specific recombinase-mediated amplification primers and probes for detecting Enterocytozoon hepatopenaei:

[0027] Forward primer:

[0028] EHP-F: 5’-AGACACCGCTGTAGTTCTAGCAGTAAACTATGCC-3’, as shown in SEQ ID NO.5;

[0029] Reverse primer:

[0030] EHP-R: 5’-CCGCGTTGAGTTAAATTAAGCAGCACAATCCAC-3’, as shown in SEQ ID NO.6;

[0031] Probe EHP-P:

[0032] SEQ ID NO.11-i6FAMdT-idSp-iBHQ1dT-SEQ ID NO.12-C3-spacer linked in sequence from 5’-3’;

[0033] 5’-ACAATGCTGGGTGTTGCGAGAGCGATGCTTGG-i6FAMdT-idSp-iBHQ1dT-GGGAGAAATCTTAGT-C3-spacer-3’.

[0034] Among them, "i6FAMdT" is a dT nucleotide fluorescently labeled with FAM (carboxyfluorescein), "idSp" refers to base deletion, "iBHQ1dT" is a dT nucleotide labeled with a BHQ1 quenching group, and "C3-spacer" refers to 3'-hydroxyl blocking.

[0035] The second object of the present invention is to provide the use of the aforementioned primer-probe combination in the preparation of reagents or kits for recombinase-mediated amplification for detecting three pathogens, namely Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatopenaei.

[0036] The third object of the present invention is to provide a kit for recombinase-mediated amplification for detecting three pathogens, namely Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatopenaei, and the kit includes the aforementioned primer-probe combination.

[0037] Furthermore, the kit further includes a recombinase-mediated amplification reagent, a buffer, deionized water, and an activator.

[0038] Furthermore, the recombinase-mediated amplification reagent includes a recombinase, a DNA polymerase, a single-stranded DNA binding protein, dNTPs, and an exonuclease;

[0039] In a particular embodiment, the recombinase-mediated amplification reagent is purchased from AmpFuture (Changzhou) Biotechnology Co., Ltd. (product model: WLE8202KIT).

[0040] The buffer is a PEG solution with a volume percentage content of 20%; the activator is magnesium acetate with a molar concentration of 280 mM.

[0041] The fourth object of the present invention is to provide a multiplex detection method for three pathogens, namely Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatopenaei, based on RAA. The detection method respectively screens target sequences according to the gene fragments of Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatopenaei, designs and screens out a pair of specific RAA primers and a probe respectively, constructs a fluorescence RAA reaction system, and performs fluorescence RAA detection. Specifically, the gene fragment of Vibrio parahaemolyticus is the TLH gene fragment of Vibrio parahaemolyticus, the gene fragment of white spot syndrome virus is the VP28 gene fragment of white spot syndrome virus, and the gene fragment of Enterocytozoon hepatopenaei is the 18S rRNA gene fragment of Enterocytozoon hepatopenaei.

[0042] The method includes the following steps:

[0043] S1. Extract the total DNA from the tissue sample to be tested to obtain a DNA template;

[0044] S2. Construction of the fluorescence recombinase-mediated amplification reaction system: Add the aforementioned forward primer, reverse primer, and probe to the recombinase-mediated amplification reaction unit containing the recombinase-mediated amplification reagent, and then add the DNA template, buffer, deionized water, and activator obtained in S1 to the recombinase-mediated amplification reaction unit to construct the fluorescence recombinase-mediated amplification reaction system;

[0045] S3. Fluorescence recombinase-mediated amplification detection: Place the constructed recombinase-mediated amplification reaction system in a fluorescence quantitative PCR instrument for fluorescence recombinase-mediated amplification detection.

[0046] Further, the system for the fluorescence recombinase-mediated amplification detection in S3 is 50 μL and contains: 2 μL of the forward primer in total, 2 μL of the reverse primer in total, 29.4 μL of buffer, 0.6 μL of the probe in total, 6 μL of the DNA template, and 2.5 μL of activator, and make up to 50 μL with deionized water, mix well and transfer to the recombinase-mediated amplification reaction unit containing the recombinase-mediated amplification reagent.

[0047] Further, in the system for the fluorescence recombinase-mediated amplification detection in S3, the concentrations of the forward primer, reverse primer, and probe are 10 μM.

[0048] Further, the conditions for the fluorescence recombinase-mediated amplification detection in S3 are: each cycle of the reaction is set for 30 s, the temperature is kept constant at 39 °C, a total of 40 cycles are set, and the total reaction time is 20 min.

[0049] After the construction of the fluorescence recombinase-mediated amplification reaction system in S2, invert the reaction unit multiple times to fully mix the solution and centrifuge, and immediately perform fluorescence recombinase-mediated amplification detection after the centrifugation ends.

[0050] The beneficial effects of the present invention are as follows:

[0051] The detection techniques for Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatopenaei established in the present invention have certain advantages compared with the qPCR technique which is also a molecular detection method. This method can complete the whole detection process within 20 min, greatly shortening the detection time; the lowest detection limit can reach 10 2 copies / μL, ensuring high sensitivity; and there is no cross-reaction with other common shrimp pathogens, showing excellent specificity. This method is based on isothermal amplification technology, overcomes the equipment limitations of traditional nucleic acid detection, simplifies the operation process, and is conducive to the detection of the three pathogens in grass-roots, on-site, or resource-limited environments. Description of the Drawings

[0052] Figure 1 It is the experimental result diagram of the primer specificity of Vibrio parahaemolyticus in Example 3;

[0053] Figure 2 It is the experimental result diagram of the primer specificity of white spot syndrome virus in Example 3;

[0054] Figure 3 It is the experimental result diagram of the primer specificity of Enterocytozoon hepatopenaei in Example 3;

[0055] Figure 4 It is the experimental result diagram of the multiplex detection of three pathogens in Example 4;

[0056] Figure 5 It is the experimental result diagram of the sensitivity detection of Vibrio parahaemolyticus gene in Example 5;

[0057] Figure 6 It is the experimental result diagram of the sensitivity detection of white spot syndrome virus gene in Example 5;

[0058] Figure 7 It is the experimental result diagram of the sensitivity detection of Enterocytozoon hepatopenaei gene in Example 5. Detailed implementation manners

[0059] The present invention will be further explained below in conjunction with the embodiments, but the embodiments do not impose any form of limitation on the present invention.

[0060] The technical solutions of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention. The materials, instruments, reagents, etc. used in the following embodiments can be obtained from commercial channels without special instructions. The technical means used in the embodiments are conventional means well known to those skilled in the art without special instructions.

[0061] As described in the embodiment:

[0062] RAA refers to: Recombinase Aided Amplification (RAA);

[0063] PCR refers to: Polymerase Chain Reaction (PCR);

[0064] AHPND refers to: Acute Hepatopancreatic Necrosis Disease (AHPND);

[0065] EHP refers to: Enterocytozoon Hepatopenaei (EHP);

[0066] HLV refers to: Highly Lethal Vibrio (HLV);

[0067] TSV refers to: Taura Syndrome Virus (TSV);

[0068] WSSV refers to: White Spot Syndrome Virus (WSSV);

[0069] VP refers to: Vibrio Parahaemolyticus (VP);

[0070] The recombinase-mediated amplification reagent was purchased from: Amp Future (Changzhou) Biotechnology Co., Ltd., with the product number WLE8202KIT.

[0071] Example 1 Obtaining Specific RAA Primers, Probes, and Template DNA

[0072] 1. Design of specific RAA primers and probes:

[0073] In the present invention, target sequences were selected respectively through the Vibrio parahaemolyticus TLH gene fragment, the white spot syndrome virus VP28 gene fragment, and the Enterocytozoon hepatopenaei 18S rRNA gene fragment region. Using the software Oligo7 and SnapGene Viewer, according to the primer design principle of RAA, the primer length is longer compared with that of conventional PCR primers. At the same time, to avoid the appearance of dimers caused by too long primers, it is generally selected between 30 - 35 bp. In addition, the CG base content at both ends of the primer was adjusted to avoid the large aggregation of G at the 5' end, increase the CG ratio at the 3' end, and complete the primer design by hand.

[0074] The names and sequences of the multiplex RAA primers are as follows, and the following sequences are all in the 5'-3' direction:

[0075] VP-F: CTTCATGTTGATGACACTGCCAGATGCGACGAA (SEQ ID NO.1);

[0076] VP-R: TTAGCGTCTCGAACAAGGCGTGAGTATCAAAC (SEQ ID NO.2);

[0077] The size of the VP amplification product is 190 bp.

[0078] WSSV-F: CATCGAAACCCACACAGGCAATATCGAGACA (SEQ ID NO.3);

[0079] WSSV-R: GATCCGCATCTTCTTCCTTCATCTGTGCATC (SEQ ID NO.4);

[0080] The size of the WSSV amplification product is 185 bp.

[0081] EHP-F: AGACACCGCTGTAGTTCTAGCAGTAAACTATGCC (SEQ ID NO.5);

[0082] EHP-R: CCGCGTTGAGTTAAATTAAGCAGCACAATCCAC (SEQ ID NO.6);

[0083] The size of the EHP amplification product is 191 bp.

[0084] The sequences and names of the multiplex RAA probes are as follows. The following sequences are all in the 5'-3' direction:

[0085] VP-P:

[0086] SEQ ID NO.7-iROXdT-T-idSp-G-iBHQ2dT-SEQ ID NO.8-C3-spacer;

[0087] SEQ ID NO.7: AGTACTCAACACAAGAAGAGATCGACAAAA;

[0088] SEQ ID NO.8: GCGAAAGTGCTTGAG;

[0089] The VP-P sequence is:

[0090] AGTACTCAACACAAGAAGAGATCGACAAAA-iROXdT-T-idSp-G-iBHQ2dT-GCGAAAGTGCTTGAG-C3-spacer;

[0091] WSSV-P:

[0092] SEQ ID NO.9-iHEXdT-G-idSp-A-iBHQ1dT-SEQ ID NO.10-C3-spacer;

[0093] SEQ ID NO.9: AAACCTCCGCATTCCTGTGACTGCTGAGGT;

[0094] SEQ ID NO.10: CAGGCTACTTCAAGA;

[0095] The WSSV-P sequence is as follows:

[0096] AAACCTCCGCATTCCTGTGACTGCTGAGGT-iHEXdT-G-idSp-A-iBHQ1dT-CAGGCTACTTCAAGA-C3-spacer;

[0097] EHP-P:

[0098] SEQ ID NO.11-i6FAMdT-idSp-iBHQ1dT- SEQ ID NO.12-C3-spacer;

[0099] SEQ ID NO.11: ACAATGCTGGGTGTTGCGAGAGCGATGCTTGG;

[0100] SEQ ID NO.12: GGGAGAAATCTTAGT;

[0101] The EHP-P sequence is as follows:

[0102] ACAATGCTGGGTGTTGCGAGAGCGATGCTTGG-i6FAMdT-idSp-iBHQ1dT-GGGAGAAATCTTAGT-C3-spacer.

[0103] 2. Obtaining template DNA:

[0104] The DNA template used in the experiment was obtained by extracting tissue samples of Litopenaeus vannamei with an aquatic animal nucleic acid extraction kit (Xingchun Biotechnology Co., Ltd.).

[0105] Example 2 Establishment of a triple detection method based on RAA

[0106] The multiplex RAA system is as follows: buffer 29.4 μL; ddH 2 O 7.5 μL; VP-F 0.6 μL; VP-R 0.6 μL; WSSV-F 0.9 μL; WSSV-R 0.9 μL; EHP-F 0.5 μL; EHP-R 0.5 μL; VP-P 0.2 μL; WSSV-P 0.2 μL; EHP-P 0.2 μL; DNA template of VP 2 μL; DNA template of WSSV 2 μL; DNA template of EHP 2 μL and activator 2.5 μL, with a total volume of 50 μL.

[0107] The concentrations of the forward primer, reverse primer and probe are 10 μM.

[0108] Add the above solution into the freeze-dried powder tube, gently pipette and shake it to mix evenly, centrifuge it, and invert the tube several times to make the liquid in the tube mix evenly. It is used for fluorescence RAA detection. Each cycle of the reaction is set to 30 s, the temperature is kept constant at 39 °C, a total of 40 cycles are set, and the total reaction time is 20 min.

[0109] Example 3 Specificity experiment of the detection method based on RAA

[0110] 1. Specificity experiment of Vibrio parahaemolyticus

[0111] Use the DNA of AHPND, TSV, EHP, HLV, and WSSV as templates respectively, and perform RAA amplification with the primers shown in SEQ ID NO.1 and SEQ ID NO.2 and the VP-P probe to detect the specificity of the Vibrio parahaemolyticus primers. The RAA system for Vibrio parahaemolyticus is as follows: buffer 29.4 μL; ddH 2 O 11.5 μL; VP-F 2 μL; VP-R 2 μL; VP-P 0.6 μL; DNA template of VP 2 μL and activator 2.5 μL, with a total volume of 50 μL.

[0112] The concentrations of the forward primer, reverse primer, and probe are 10 μM.

[0113] Add the above solution into the freeze-dried powder tube, gently pipette and shake it to mix evenly, centrifuge it, and invert the tube several times to make the liquid in the tube mix evenly. It is used for fluorescence RAA detection. The conditions for recombinase-mediated amplification detection are: each cycle of the reaction is set to 30 s, the temperature is kept constant at 39 °C, a total of 40 cycles are set, and the total reaction time is 20 min.

[0114] The results are as Figure 1 shown. 1 is the positive reference, 2 is AHPND, 3 is TSV, 4 is EHP, 5 is HLV, and 6 is WSSV. It can be seen that the five samples except the positive sample did not show peaks after fluorescence RAA amplification. This result indicates that the established method has good specificity.

[0115] 2. Specificity experiment of white spot syndrome virus

[0116] Use the DNA of AHPND, TSV, EHP, HLV, and VP as templates respectively, and perform RAA amplification with the primers shown in SEQ ID NO.3 and SEQ ID NO.4 and the WSSV-P probe to detect the specificity of the white spot syndrome virus primers. The RAA system for white spot syndrome virus is as follows: buffer 29.4 μL; ddH 2 O 11.5 μL; WSSV-F 2 μL; WSSV-R 2 μL; WSSV-P 0.6 μL; DNA template of WSSV 2 μL and activator 2.5 μL, with a total volume of 50 μL.

[0117] The concentrations of the forward primer, reverse primer, and probe are 10 μM.

[0118] Add the above solution into a freeze-dried powder tube, gently pipette and shake to mix evenly, centrifuge, and invert the tube several times to make the liquid in the tube mix evenly for fluorescence RAA detection. The conditions for recombinase-mediated amplification detection are as follows: each cycle of the reaction is set to 30 s, the temperature is kept constant at 39 °C, a total of 40 cycles are set, and the total reaction time is 20 min.

[0119] The results are as Figure 2 shown. 1 is the positive reference, 2 is AHPND, 3 is TSV, 4 is EHP, 5 is HLV, 6 is VP. It can be seen that the five samples except the positive sample did not show peaks after fluorescence RAA amplification, indicating that the established method has good specificity.

[0120] 3. Specificity experiment of Enterocytozoon hepatopenaei

[0121] Use the DNA of AHPND, TSV, HLV, VP, and WSSV as templates respectively for RAA amplification to detect the specificity of the Enterocytozoon hepatopenaei primers. The RAA system for Enterocytozoon hepatopenaei is as follows: buffer 29.4 μL; ddH 2 O 11.5 μL; EHP-F 2 μL; EHP-R 2 μL; EHP-P 0.6 μL; DNA template of EHP 2 μL; and activator 2.5 μL, with a total volume of 50 μL.

[0122] The concentrations of the forward primer, reverse primer, and probe are 10 μM.

[0123] Add the above solution into a freeze-dried powder tube, gently pipette and shake to mix evenly, centrifuge, and invert the tube several times to make the liquid in the tube mix evenly for fluorescence RAA detection. The conditions for recombinase-mediated amplification detection are as follows: each cycle of the reaction is set to 30 s, the temperature is kept constant at 39 °C, a total of 40 cycles are set, and the total reaction time is 20 min.

[0124] The results are as Figure 3 shown. 1 is the positive reference, 2 is AHPND, 3 is TSV, 4 is HLV, 5 is VP, 6 is WSSV. It can be seen that the five samples except the positive sample did not show peaks after fluorescence RAA amplification, indicating that the established method has good specificity.

[0125] Example 4 Feasibility verification of the multiplex detection technology developed by the present invention

[0126] After mixing the nucleic acids of three pathogens, VP, WSSV, and EHP, the nucleic acids of AHPND, TSV, and HLV were added simultaneously as templates, and the multiplex RAA system described in Example 2 was used for the amplification reaction to verify the feasibility of simultaneously detecting three pathogens and to verify the specificity of multiplex detection.

[0127] The results are as Figure 4 shown. 1 is VP, 2 is WSSV, 3 is EHP, 4 is AHPND, 5 is TSV, and 6 is HLV. It can be seen that the system can simultaneously amplify the corresponding RAA products of VP, WSSV, and EHP, indicating that the established method has good specificity.

[0128] Example 5 Sensitivity experiment of the multiplex detection technology developed by the present invention

[0129] 1. Sensitivity detection of Vibrio parahaemolyticus

[0130] To explore the lowest detection limit of fluorescence RAA for Vibrio parahaemolyticus, reactions were carried out using Vibrio parahaemolyticus genomic DNA diluted with deionized water. The concentration of genomic DNA was measured and converted into copy numbers.

[0131] The Vibrio parahaemolyticus DNA was diluted with deionized water to 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, and 10 1 copies / μL for a total of 6 concentrations for the sensitivity experiment.

[0132] The detection system and detection conditions were the same as those for verifying the feasibility of multiplex detection of the technology developed by the present invention in Example 4.

[0133] As Figure 5 shown, curves 1 - 6 represent DNA samples of 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, and 10 1 copies / μL in sequence, and 7 is the negative control.

[0134] The results showed that the lowest detection limit of this method can reach 10 2 copies / μL of genomic DNA, with excellent sensitivity and higher diagnostic value for low-density infections.

[0135] 2. Sensitivity Detection of White Spot Syndrome Virus

[0136] To explore the lowest detection limit of fluorescence RAA for white spot syndrome virus, reactions were carried out using genomic DNA of white spot syndrome virus diluted with deionized water. The concentration of genomic DNA was measured and converted into copy number.

[0137] Dilute the white spot syndrome virus DNA to 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1 copies / μL for a total of 6 concentrations to conduct sensitivity experiments.

[0138] The detection system and detection conditions are the same as those for the feasibility verification of the multiplex detection technology developed in Example 4 of the present invention.

[0139] As Figure 6 shown, curves 1 - 6 represent DNA samples of 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1 copies / μL in sequence, and 7 is the negative reference.

[0140] The results show that the lowest detection limit of this method can reach 10 2 copies / μL of genomic DNA, with excellent sensitivity and higher diagnostic value for low-density infections.

[0141] 3. Sensitivity Detection of Enterocytozoon hepatopenaei

[0142] To explore the lowest detection limit of fluorescence RAA for Enterocytozoon hepatopenaei, reactions were carried out using genomic DNA of Enterocytozoon hepatopenaei diluted with deionized water. The concentration of genomic DNA was measured and converted into copy number.

[0143] Dilute the Enterocytozoon hepatopenaei DNA to 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 102 copies / μL and 10 1 copies / μL, with a total of 6 concentrations for the sensitivity experiment.

[0144] The detection system and detection conditions are the same as those in Example 4 for the feasibility verification of the multiplex detection technology developed by the present invention.

[0145] As Figure 7 shown, curves 1 - 6 represent 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1 copies / μL of DNA samples in sequence, and 7 is the negative reference.

[0146] The results show that the lowest detection limit of this method can reach 10 2 copies / μL of genomic DNA, with excellent sensitivity and higher diagnostic value for low - density infections.

[0147] Copy number - concentration conversion formula:

[0148] .

[0149] Example 6 Detection of field samples by fluorescence - mediated RAA

[0150] 100 tissue samples of Litopenaeus vannamei infected with Vibrio parahaemolyticus, white spot syndrome virus, and Enterocytozoon hepatonaei were collected, and fluorescence quantitative PCR amplification and RAA amplification were performed. The instrument used was the fluorescence quantitative PCR instrument LC96. The fluorescence quantitative PCR reaction system and reaction conditions were as follows: The total reaction system was 20 μL, including 10 μL of PCR mix; 5 μL of probe primer; and 5 μL of DNA template. The reaction conditions were first 2 - minute contamination digestion at 37°C; then 1 - minute pre - denaturation at 95°C; and finally, with a cycle of 95°C for 5 s and 60°C for 30 s, for a total of 45 cycles.

[0151] Based on the detection results of the fluorescence - mediated RAA method and the fluorescence quantitative PCR method, the following Table 1 was statistically obtained:

[0152] Table 1 Results of detecting the above 100 samples by fluorescence quantitative PCR and fluorescence - mediated RAA

[0153] Detection method Fluorescent quantitative PCR VP positive Fluorescent quantitative PCR WSSV positive Fluorescent quantitative PCR EHP positive Fluorescent quantitative PCR negative Fluorescent RAA VP positive 42 1 6 2 Fluorescent RAA WSSV positive 1 10 2 0 Fluorescent RAA EHP positive 6 2 28 0 Fluorescent RAA negative 0 0 0 18

[0154] In summary, the detection results of the two types of methods are highly consistent, and there is no statistical difference in the detection rates. There are only 2 samples with inconsistent detection results between the two methods. It can be seen that due to the stronger sensitivity of the fluorescence RAA method, samples with lower concentrations can be detected.

[0155] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A primer-probe combination for recombinase-mediated amplification detection of three pathogens: Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatocellular carcinoma, characterized in that: The primer-probe combination comprises: (1) Specific recombinase-mediated amplification primers and probes for detecting Vibrio parahaemolyticus: Forward Primer: 5'-CTTCATGTTGATGACACTGCCAGATGCGACGAA-3'; Reverse Primer: 5'-TTAGCGTCTCGAACAAGGCGTGAGTATCAAAC-3'; Probe: 5'-AGTACTCAACACAAGAAGAGATCGACAAAA-iROXdT-T-idSp-G-iBHQ2dT-GCGAAAGTGCTTGAG-C3-spacer-3'; Among them, iROXdT is a dT nucleotide labeled with ROX fluorescence, idSp refers to base deletion, iBHQ2dT is a dT nucleotide labeled with a BHQ2 quencher group, and C3-spacer refers to 3' hydroxyl blocking; (2) Specific recombinase-mediated amplification primers and probes for detecting white spot syndrome virus: Forward Primer: 5'-CATCGAAACCCACACAGGCAATATCGAGACA-3'; Reverse Primer: 5'-GATCCGCATCTTCTTCCTTCATCTGTGCATC -3'; Probe: 5'-AAACCTCCGCATTCCTGTGACTGCTGAGGT-iHEXdT-G-idSp-A-iBHQ1dT-CAGGCTACTTCAAGA-C3-spacer-3'; Among them, iHEXdT is a dT nucleotide labeled with HEX fluorescence, idSp refers to base deletion, iBHQ1dT is a dT nucleotide labeled with a BHQ1 quencher group, and C3-spacer refers to 3' hydroxyl blocking; (3) Specific recombinase-mediated amplification primers and probes for detecting shrimp hepatocellular carcinoma: Forward Primer: 5'-AGACACCGCTGTAGTTCTAGCAGTAAACTATGCC-3'; Reverse Primer: 5'-CCGCGTTGAGTTAAATTAAGCAGCACAATCCAC-3'; Probe: 5'-ACAATGCTGGGTGTTGCGAGAGCGATGCTTGG-i6FAMdT-idSp-iBHQ1dT-GGGAGAAATCTTAGT-C3-spacer-3'; Among them, i6FAMdT is a dT nucleotide labeled with FAM fluorescence, idSp refers to base deletion, iBHQ1dT is a dT nucleotide labeled with a BHQ1 quencher group, and C3-spacer refers to 3' hydroxyl closure.

2. Use of the primer-probe combination according to claim 1 in the preparation of a reagent or a kit for detecting three pathogens, namely, Vibrio parahaemolyticus, White Spot Syndrome Virus and Enterocytosis of Shrimp by recombinase-mediated amplification.

3. A kit for detecting three pathogens, namely, Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatocellular carcinoma, by recombinase-mediated amplification, characterized in that: The kit comprises the primer-probe combination according to claim 1.

4. The kit according to claim 3, characterized in that The kit also includes a recombinase-mediated amplification reagent, a buffer, deionized water and an activator.

5. The kit according to claim 4, characterized in that The recombinase-mediated amplification reagent comprises recombinase, DNA polymerase, single-stranded DNA binding protein, dNTP and exonuclease; the buffer is a PEG solution with a volume percentage of 20%; and the activator is magnesium acetate with a molar concentration of 280 mM.

Citation Information

Patent Citations

  • Primer probe group, kit and detection method for multiple detection of enteropathogenic bacteria based on fluorescent RMA method

    CN112760395A

  • Primer and probe sequences for detecting vibrio and enterocytozoon hepatopenaei caused by acute hepatopancreatic necrosis disease of prawns and application of primer and probe sequences

    CN115710605A

  • Primer probe combination and kit for prawn white spot syndrome virus detection

    CN115786593A

  • White spot syndrome virus rapid detection method and kit based on ERA technology

    CN115948613A

  • Rapid and sensitive high-throughput detection method for multiple aquatic pathogens

    CN118853833A