A molecular marker related to the plant height of alfalfa and its application

Abstract

A molecular marker related to the plant height of alfalfa and its application. The present invention belongs to the technical field of molecular biology, and specifically relates to a molecular marker related to the plant height of alfalfa and its application. The technical problem solved by the present invention is that the breeding of new alfalfa varieties with traditional ideal plant height is based on single-plant selection according to the measurement of the plant height of breeding offspring. This method is time-consuming and laborious, and the accuracy is not high. The technical solution of the present invention is a molecular marker related to the plant height of alfalfa, and the specific information is as follows: chromosome: chr6; position: 69854503; SNP typing: C / A. The present invention also designs a primer combination for this molecular marker, which can directly distinguish and detect the A or C base of the SNP mutation site.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker related to the plant height of alfalfa and its application. Background Art

[0002] Alfalfa is an important leguminous forage grass, known as the "king of forage grasses". Plant height is one of the key agronomic traits for measuring the growth status and yield potential of alfalfa, directly affecting the biomass accumulation and hay yield of forage grass.

[0003] The traditional breeding of new alfalfa varieties with ideal plant height is based on individual plant selection according to the measurement of plant height of breeding offspring. This method is time-consuming and laborious, and the accuracy is not high. Using the base differences existing in target genes to develop specific molecular markers for assisted selection is the best method to improve the selection efficiency of ideal plant height. Kompetitive Allele-Specific PCR (KASP) molecular marker is a new SNP genotyping method based on allele-specific amplification (ARMS) and highly sensitive fluorescence detection. Its principle is to design two forward primers and a common reverse primer for the allele SNP locus. Each forward primer has a specific sequence and can be combined with different fluorescent labels. The forward primers with sequences combined with different fluorescences and the common reverse primer are used for PCR amplification of the DNA of the sample to be tested, and its allelic variation can be reflected by different fluorescent signals (He CL, et al. SNP genotyping: the KASP assay. Methods Mol Biol, 2014, 1145: 75-86).

[0004] Therefore, developing KASP markers closely linked to the plant height of alfalfa for early breeding selection is crucial for reducing the breeding workload and accelerating the high-yield breeding of alfalfa, and at the same time, the economic benefits are obvious. Summary of the Invention

[0005] The technical problem solved by the present invention is that the traditional breeding of new alfalfa varieties with ideal plant height is based on individual plant selection according to the measurement of plant height of breeding offspring. This method is time-consuming and laborious, and the accuracy is not high.

[0006] The technical solution of the present invention is a molecular marker related to the plant height of alfalfa, and the specific information is as follows: chromosome: chr6; position: 69854503; SNP genotyping: C / A.

[0007] Furthermore, the nucleotide sequence of the molecular marker is as shown in SEQ ID No.1 or SEQ ID No.2.

[0008] The present invention also provides a primer combination for amplifying the molecular marker, and its nucleotide sequence is as shown in SEQ ID No.3-5.

[0009] The present invention also provides a molecular marker detection kit, including the primers shown in SEQ ID No.3-5.

[0010] The present invention also provides a molecular marker chip, including the primers shown in SEQ ID No.3-5.

[0011] The present invention also provides the application of the molecular marker, the primer combination for amplifying the molecular marker, the kit and / or the molecular marker chip in any one of the following:

[0012] a. Predicting the plant height of alfalfa;

[0013] b. Identifying and screening alfalfa with different plant heights;

[0014] c. Molecular marker-assisted breeding of alfalfa;

[0015] d. Breeding of alfalfa;

[0016] e. Preparing products for alfalfa breeding.

[0017] The present invention also provides a method for screening alfalfa materials with different plant heights or predicting the plant height of alfalfa, including the following steps: extracting the genomic DNA of the alfalfa material to be tested, amplifying the molecular marker using the primers described in SEQ ID No.3-5, sequencing the amplification product, and performing typing and screening.

[0018] Specifically, the amplification program is as follows: 94°C for 15 min; 95°C for 20 sec, 65-56°C for 60 sec, 10 cycles, and the annealing and extension temperature decreases by 0.8°C for each cycle; 94°C for 20 sec, 57°C for 60 sec, 10 cycles.

[0019] Particularly, the criteria for typing and screening are as follows: if the typing result is AA, it is a tall plant material; if the typing result is CC or AC, it is a short plant material.

[0020] Advantages of the present invention: Through a large amount of material and data analysis, the present invention obtained a locus (Chr6_69854503) significantly associated with the crude plant height of alfalfa, with an LOD value of 8.26 and a phenotypic contribution rate of 11.99% that can be explained. And a primer combination was designed for this locus. The KASP primer combination developed by the present invention can specifically distinguish and detect the A or C base of the SNP mutation site, has good application value, can realize the pre-selection of alfalfa plant height and molecular-assisted breeding, and has important theoretical and practical significance for improving the selection efficiency. The molecular marker of the present invention has good application value, can realize the pre-selection of alfalfa plant height traits and molecular-assisted breeding, and has important theoretical and practical significance for accelerating the genetic improvement process of breeding materials with appropriate plant height and improving the selection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 、GWAS found that the locus Chr6_69854503 was significantly associated with plant height.

[0022] Figure 2 、KASP marker genotyping results, red represents the CC genotype, purple represents the AC genotype, and blue represents the AA genotype.

[0023] Figure 3 、Comparison of plant height among materials with different genotypes. DETAILED DESCRIPTION OF THE INVENTION

[0024] To further elaborate on the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the following combines the drawings and preferred embodiments to detail the specific implementation manners, structures, features, and their effects according to the present invention as follows.

[0025] Example 1 Obtaining of Molecular Marker

[0026] This experimental population consisted of 150 alfalfa germplasm materials, including core germplasm, germplasm from different regions with different phenotypes. Considering the differences among different individual plants within the same alfalfa variety, branches were cut from the germplasm resource nursery in 2021 and cuttings were carried out in the greenhouse. After successful rooting of the cuttings, these germplasm materials were transplanted to experimental fields in Langfang, Hebei and Changping, Beijing. In these experimental fields, the experimental population was established using a randomized block design, with three replicates, and each replicate contained 10 cutting single plants. To ensure sufficient growth space, the interval between replicates was 150 cm, and the row spacing and plant spacing were set at 150 cm and 60 cm respectively. During the growth period, no fertilization and irrigation measures were taken, and only manual weeding was carried out. To help the plants survive the winter, winter water was irrigated.

[0027] At the early flowering stage, the plant height of each alfalfa germplasm was measured using the artificial counting method. The plant height values of each material under different replicates and different environments were obtained, and the average value was calculated. This was used for subsequent GWAS analysis.

[0028] 100 mg of young alfalfa leaves were selected, frozen immediately in liquid nitrogen, and then total plant DNA was extracted using the CWBIO Plant Genomic DNA Extraction Kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were detected using a micro-spectrophotometer (Nano Photometer NP80, Germany), and then sequencing was performed on the BGI DNBSEQ next-generation sequencing platform (BGI, Shenzhen, China).

[0029] Approximately 36 GB of raw data was obtained for each material. The raw sequencing data was processed by Trimmomatic (version 0.39) (Bolger et al., 2014) software to remove adapters and filter out low-quality base sequences. Subsequently, the cleaned sequencing data was aligned to the haplotype reference genome of Medicago sativa 'Zhongmu No. 1' using BWA-MEM. SAMtools (version 1.13) was used to filter out multiple alignments and low-quality sequences, and the filtered BAM file was sorted. The Mark Duplicates function in the Picard toolkit (version 2.23.0) was used to mark PCR duplicates. Finally, the processed BAM file was used for variant detection with GATK Haplotype Caller (version 4.2.3.062). In the SNP filtering strategy, the following parameters were set as screening criteria: Qual By Depth (QD) less than 2.0, Fisher Strand (FS) greater than 60.0, MQ Rank Sum Test less than -12.5, Read PosRank Sum less than -8.0, Strand Odds Ratio (SOR) greater than 3.0, and Mapping Qualities (MQ) less than 40.0. Subsequently, the screening conditions for a subset of Medicago sativa SNP markers were defined, including: (1) using VCFtools (version 0.1.16) to remove SNP markers with a missing rate greater than 20% and a Minor Allele Frequency (MAF) less than 0.05% to create a basic SNP set containing only biallelic SNP markers; (2) performing LD-based filtering on this basic SNP set using Plink (version 1.90b6.21), setting the window size for LD filtering to 100 SNPs, the window step to 50 SNPs, and the r2 threshold to 0.2 to obtain a core SNP marker set. The missing genotypes in the SNP marker set after LD filtering were imputed using Beagle software with default parameters. Similarly, VCFtools was used to filter Indel markers, retaining only biallelic markers with a missing rate less than 20% and a MAF greater than 0.05%.

[0030] GWAS analysis was performed using 1,303,375 high-quality SNP markers. To ensure the accuracy and reliability of the analysis, multiple software and statistical models were employed: TASSEL 5.0 (GLM and MLM) (Bradbury P J et al., 2007), BLINK (v1.01) (Huang et al., 2019). The Q-Q plot (quantile-quantile plot) was used to measure the reliability of the model. By comparing the Q-Q plots generated by different models, we found that the GLM model in TASSEL 5.0 performed relatively well. Therefore, the GLM model of TASSEL 5.0 was selected to display the final results. Principal component analysis was performed on the SNP data, and the first three principal component variables were used as covariates to correct the population structure. The Manhattan plot was visualized using the R package CMplot (Yin et al., 2021). Association SNP linkage disequilibrium (LD) analysis was calculated using LDBlockShow (Dong et al., 2021) and the data was visualized. A locus significantly associated with the plant height of Medicago sativa (Chr6_69854503) was found near 69.85 Mb on chromosome 6, with an LOD value of 8.26 and a phenotypic contribution rate of 11.99% that could be explained ( Figure 1 ).

[0031] Example 2 Development of KASP markers for the Chr6_69854503 locus

[0032] The Chr6_69854503 locus is near 69.85 Mb on chromosome 6. Specific information: chromosome: chr6; position: 69854503; SNP genotyping: C / A.

[0033] Approximately 200 bp sequences upstream and downstream of the Chr6_69854503 locus were obtained from the reference genome "Zhongmu No. 1":

[0034] SEQ ID No.1, where lowercase letters represent the SNP locus;

[0035] TTCAGATATTTCCTTCATCCAGGCTGAATGATCACAAGTGTCTTCTTTAATAATCAATTCTAAATATAGGATATAAGAACTTACTGTTTTATTTCTTACTGACCTAGGTGATAGATTTTTCTTTATCGGAACTGATCCTACTAATAGATGAGAGATTTCCTTTATTTGGAAAGGTTGCCCTTTTCTCGTCACAGTATGGTTGcATATCCAAATCAGTCACACTCAGATGGTACGTCACTTGTTCTAACATGTTTCTCGACATGATATATTCTTGAAGGTTCCTGATGTCAACTTCATTGGTGCATTAAATGTAGGCCTTAAATCCATTTGTATCTTTAGGTTGAGAGCTCATGTTTTCAATTCTTCTTTGACGTTTTTGATAGATATCTTCAAAGATATGCATGTTTCTATCAAAGTTCTTTGTATCAACATGTATGTGCGAGATTT。

[0036] SEQ ID No.2, where lowercase letters represent SNP sites;

[0037] TTCAGATATTTCCTTCATCCAGGCTGAATGATCACAAGTGTCTTCTTTAATAATCAATTCTAAATATAGGATATAAGAACTTACTGTTTTATTTCTTACTGACCTAGGTGATAGATTTTTCTTTATCGGAACTGATCCTACTAATAGATGAGAGATTTCCTTTATTTGGAAAGGTTGCCCTTTTCTCGTCACAGTATGGTTGaATATCCAAATCAGTCACACTCAGATGGTACGTCACTTGTTCTAACATGTTTCTCGACATGATATATTCTTGAAGGTTCCTGATGTCAACTTCATTGGTGCATTAAATGTAGGCCTTAAATCCATTTGTATCTTTAGGTTGAGAGCTCATGTTTTCAATTCTTCTTTGACGTTTTTGATAGATATCTTCAAAGATATGCATGTTTCTATCAAAGTTCTTTGTATCAACATGTATGTGCGAGATTT。

[0038] The KASP primers were designed for the Chr6_69854503 locus and its flanking sequences (SEQ ID No.1 and SEQ ID No.2) using Bacthprimer 3 software. Each set of KASP markers consists of 2 specific primers and 1 common primer, with fluorescent linker sequences attached to the 5' ends of the specific primers (GAAGGTGACCAAGTTCATGCT is the FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT is the HEX fluorescent linker sequence).

[0039] The KASP marker primers are as follows:

[0040] Specific primer 1 (SEQ ID No.3): GAAGGTGACCAAGTTCATGCT CCTTTTCTCGTCACAGTATGGTTGC;

[0041] Specific primer 2 (SEQ ID No.4): GAAGGTCGGAGTCAACGGATT CCTTTTCTCGTCACAGTATGGTTGA;

[0042] Common primer (SEQ ID No.5): CGTACCATCTGAGTGTGACTGATTTGG.

[0043] Example 3 Use of Molecular Markers

[0044] Another 102 alfalfa materials were taken, planted, sampled, and DNA was extracted using the method in Example 1, and then analyzed on the Array Tape system of Douglas Scientific Company. The Array Tape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for signal scanning, and INTELLICS for data analysis.

[0045] Use NEXAR to assemble the PCR system, and the PCR reaction system is shown in Table 1.

[0046] Table 1 KASP reaction system

[0047] Use SOELLEX for PCR amplification, and the Touch down PCR amplification conditions are as follows: 94°C for 15 min; 95°C for 20 sec, 65 - 56°C for 60 sec, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C for each cycle; 94°C for 20 sec, 57°C for 60 sec, 30 cycles.

[0048] After the PCR reaction was completed, the fluorescence signal of the reaction system was scanned with ARAYA; then, data analysis and genotype typing were performed with INTELLICS. The schematic diagram of marker typing is as shown in Figure 2 . Among them, the red ones are AA allele genotypes, the purple ones are A / C allele genotypes, and the blue ones are CC allele genotypes. The allele types of 102 materials at this locus are shown in Table 2. At the same time, the plant heights of each material were also counted. The plant height of the germplasm with AA allele genotype (77.07 cm) was significantly higher than that of the germplasm with CC allele genotype (60.66 cm) ( Figure 3 ).

[0049] Table 2 Allele types of 102 germplasm materials at this locus

[0050]

[0051] The above description is only a preferred embodiment of the present invention and does not impose any form of limitation on the present invention. Although the present invention has been disclosed as above with a preferred embodiment, it is not intended to limit the present invention. Any person skilled in the art can make some changes or modifications to equivalent embodiments by using the above-disclosed technical content within the scope of the technical solution of the present invention. However, as long as it does not depart from the content of the technical solution of the present invention, any brief modification, equivalent change, and modification made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. Use of a primer combination, a kit, and / or a molecular marker chip in any one of the following, characterized in that: a. Predicting the plant height of alfalfa; b. Identifying and screening alfalfa with different plant heights; c. Molecular marker-assisted breeding of alfalfa with different plant heights; d. Breeding of alfalfa with different plant heights; e. Preparing products for breeding alfalfa with different plant heights; In the above applications, the plant height is determined according to the genotyping results of the SNP molecular markers shown in nucleotide sequences SEQ ID No.1 and SEQ ID No.

2. If the genotyping result is AA, it is a tall plant material; if the genotyping result is CC or AC, it is a short plant material; The nucleotide sequence of the primer combination is as shown in SEQ ID No.3 - 5, and this primer combination is used to amplify the SNP molecular markers shown in nucleotide sequences SEQ ID No.1 and SEQ ID No.2; The kit contains the primer combination with the nucleotide sequence as shown in SEQ ID No.3 - 5; The primer combination with the nucleotide sequence as shown in SEQ ID No.3 - 5 is loaded on the molecular marker chip.

2. A method for screening alfalfa materials with different plant heights or predicting the plant height of alfalfa, characterized in that: It includes the following steps: Extract the genomic DNA of the alfalfa material to be tested, amplify the SNP molecular markers shown in SEQ ID No.1 and SEQ ID No.2 using the primers described in SEQ ID No.3 - 5, sequence the amplification product, and perform genotyping and screening; if the genotyping result is AA, it is a tall plant material; if the genotyping result is CC or AC, it is a short plant material.

3. The method according to claim 2, wherein: The amplification program is as follows: 94°C for 15 min; 95°C for 20 sec, 65 - 56°C for 60 sec, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C for each cycle; 94°C for 20 sec, 57°C for 60 sec, 10 cycles.

Images