Isothermal amplification detection primer combination and micro-fluidic chip for detecting seasonal influenza virus and application of isothermal amplification detection primer combination and micro-fluidic chip

Abstract

The invention discloses an isothermal amplification detection primer combination and a micro-fluidic chip for detecting seasonal influenza virus and application of the isothermal amplification detection primer combination and the micro-fluidic chip. The primer combination is designed based on a loop-mediated isothermal amplification technology, comprises five specific primers aiming at conserved gene sequences of seasonal influenza viruses (H1N1, H3N2 and Victoria), and can be used for rapidly and efficiently amplifying target virus nucleic acid under an isothermal condition. The invention also provides a microfluidic chip integrated with the primer combination, the chip adopts a multi-layer structure design, integrates a plurality of independent reaction units, each unit preloads the LAMP primer group and supports multiple detection, and the microfluidic chip has the characteristics of high throughput, low reagent consumption and rapid detection, and is suitable for industrial production. The process from nucleic acid input to result output can be completed within 30 minutes; the detection sensitivity to seasonal influenza virus reaches 10 < 2 > copies / uL, the specificity is high, no cross reaction exists, and the inter-batch variation coefficient is small.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to an isothermal amplification detection primer combination and a microfluidic chip for detecting seasonal influenza virus and applications thereof. Background Art

[0002] Influenza virus is an important pathogen that causes respiratory diseases. After being infected by influenza virus, patients usually experience symptoms such as high fever, cough, headache, muscle aches and runny nose. There are four types of influenza viruses that are often prevalent in the population, namely influenza A H1N1pdm09 subtype (A / H1N1), influenza A H3N2 subtype (A / H3N2), influenza B Victoria strain (B / Victoria) and influenza B Yamagata strain (B / Yamagata). These four types are called seasonal influenza viruses. Usually these four subtypes are prevalent in the population alternately or simultaneously, but after 2020, the spread of the Yamagata strain has not been monitored globally. Currently, the three main influenza viruses prevalent in the population are A / H1N1, A / H3N2 and B / Victoria. Timely diagnosis of influenza viruses is crucial for patients.

[0003] Detection methods for influenza viruses include nucleic acid detection, serological detection, and virus isolation, culture, and identification. Nucleic acid detection is one of the commonly used detection methods in clinical practice because of its high specificity and strong sensitivity. Realtime PCR (Real-time Quantitative Polymerase Chain Reaction) is currently the most widely used nucleic acid detection technology. LAMP (Loop-mediated isothermal amplification) technology is an emerging nucleic acid amplification method in recent years. Compared with Realtime PCR technology, it has the advantages of constant temperature operation, high specificity, high amplification efficiency, short amplification time, low cost, and low equipment requirements. It has been applied to the detection of pathogens, parasites, viruses, diseases, and genetically modified products, and also has broad prospects in the fields of clinical infectious disease diagnosis, environmental monitoring, and food safety.

[0004] Patent 202110406990.9 discloses a multiple LAMP primer combination for detecting multiple influenza viruses and its application, which can detect influenza A H1N1, influenza A H3N2 and influenza B. By improving the traditional 6-region 2-pair primers into 8-region 4-pair primers, adding F4 and B4 primers, the detection time is shortened, the sensitivity of detection is improved, and no false positives will be caused between primers. However, it uses a colorimetric reaction to judge the positive and negative by the change in the color of the phenol red indicator. This method can only achieve qualitative detection, and the test results are affected and interfered by many factors, resulting in inaccurate results. For example, the color generated by the colorimetric reaction is not stable enough, and it is easy to change due to factors such as light, temperature, the amount of color developer and reaction time, affecting the accuracy of the results. Summary of the invention

[0005] The purpose of the present invention is to provide an isothermal amplification detection primer combination and a microfluidic chip for detecting seasonal influenza virus and their application in view of the deficiencies in the prior art.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] The first aspect is to provide an isothermal amplification detection primer combination for detecting seasonal influenza virus, the primer combination comprising a first primer set, a second primer set and a third primer set;

[0008] The first primer set is used to detect influenza virus A / H1N1, and is composed of the following primers:

[0009] H1-F3: GVAATTCCTCTCTCTGCC;

[0010] H1-B3: GTDCCATTGGAATGTTTGTCA;

[0011] H1-FIP: CATCCCCTTGGAACCGATDTTAGTGGATGGGCTRTATACAGT;

[0012] H1-BIP: ATAAGGGAMCCATTCATATCATGCTTTTAGCAAWGCCCCTTGA;

[0013] H1-LB:ACAGGCCTCATACAAAATCTTCAG;

[0014] The second primer set is used to detect influenza virus A / H3N2, and consists of the following primers:

[0015] H3-F3:GGGBTTACTTCAAAATACGAAG;

[0016] H3-B3:TTGCCAATTTCAGGBTGC;

[0017] H3-FIP: GGAGTGATGCATTCAGACTTACATTTGGGAAAAGCTCAATAATGAG A;

[0018] H3-BIP:ATGGAAGCATTCCCAATGWCAACTTAACGTATCTGGGACAGG;

[0019] H3-LB: GCACCCATTGGCAAATGTAAGTCTG;

[0020] The third primer set is used to detect influenza virus B / Victoria, and consists of the following primers: B-F3: GTGCTTYCCTATAATGCATGA;

[0021] B-B3: CTGTTTGTTDTTTGGGACAG;

[0022] B-FIP: GTGAGTTGACAACCTGACATGTTACAAAAATTAGACAGCTGCCT; B-BIP: CACCAGGAGGACCCTACGAAADGAATCCTTTTCCATTGGTAA;

[0023] B-LB:GCTTGGGCTGTCCCAAAAAAC.

[0024] Furthermore, in the first primer set, the molar ratio of F3, B3, FIP, BIP and LB is 1:1:(5-8):(5-8):4; more preferably, the molar ratio of F3, B3, FIP, BIP and LB is 1:1:8:8:4.

[0025] The second aspect is to provide the use of the above-mentioned isothermal amplification detection primer combination in the preparation of a reagent or a kit or a chip for detecting multiple influenza viruses, wherein the reagent or the kit or the chip is used to detect whether the sample to be tested contains influenza A (H1N1) virus and / or influenza A (H3N2) virus and / or influenza B Victoria virus.

[0026] The third aspect is to provide an isothermal amplification detection microfluidic chip for detecting seasonal influenza virus, wherein the microfluidic chip comprises the isothermal amplification detection primer combination mentioned above.

[0027] Furthermore, the isothermal amplification detection microfluidic chip for detecting seasonal influenza virus also includes a constant temperature amplification premix.

[0028] The fourth aspect is to provide an isothermal amplification detection method, comprising the following steps:

[0029] Step 1, designing and synthesizing the above primer combination, and preparing primer mixtures for three pathogens and an internal standard respectively;

[0030] Step 2: using a needle chip spotter to spot the prepared primer mixture onto the amplification wells of the microfluidic chip, and then drying the microfluidic chip;

[0031] Step 3, preparation of isothermal amplification premix;

[0032] Step 4: Mix the sample to be tested with the isothermal amplification premix and add it into the sample well of the dried microfluidic chip, and seal it for testing.

[0033] Furthermore, the specific process of the drying is: the microfluidic chip is evenly spread and then placed in a vacuum drying oven, and dried at room temperature at a vacuum of ≤100Pa for 10 to 30 minutes, and the ambient humidity is required to be 40 to 60%.

[0034] Furthermore, the isothermal amplification premix includes: 25mM dNTP, 10% BSA, 1M MgSO4, 25μM fluorescent dye, 5M betaine, 200U / μL RNA reverse transcriptase, and 8U / μL Bst DNA polymerase.

[0035] Furthermore, the reaction temperature during detection is 60-65°C, and the reaction time is 30-40min.

[0036] The present invention adopts the above technical solution, and has the following technical effects compared with the prior art:

[0037] The method of the present invention improves the sensitivity of detection by an order of magnitude, reaching 10 2 copies / uL, which improves the sensitivity and accuracy of detection, has high specificity, no cross-reaction, and a small coefficient of variation between batches.

[0038] The present invention integrates sample amplification and fluorescence detection on one chip. The chip adopts a multi-layer structure design and integrates multiple independent reaction units. Each unit is preloaded with a LAMP primer set. The instrument can accurately collect and measure fluorescence intensity, realize automated operation, and reduce human errors. The reactant mixing and mass transfer efficiency in the microchannel are high, and the reaction speed is fast, and the sample detection can be completed in 5min-30min.

[0039] The method of the present invention requires a small amount of sample and reagent, saving costs; multiple target detection and multiple sample detection are achieved on the same chip, 3 target pathogens are detected simultaneously, and the detection of 8 samples is completed simultaneously.

[0040] The present invention can not only realize qualitative detection of samples, but also realize semi-quantitative detection of samples by comparing with known concentration standards; it is equipped with electronic sensors and data processing systems, and the reaction results are presented in the form of curves and Dt values, which is convenient for data recording, analysis and display, and is suitable for on-site rapid screening and diagnosis in hospitals, disease control centers and primary medical institutions. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Schematic diagram of the microfluidic chip used in Example 2;

[0042] Figure 2 The specific results of the influenza A (H1N1)pdm09 primer set are shown;

[0043] Figure 3 The sensitivity results of the influenza A (H1N1)pdm09 primer set are shown;

[0044] Figure 4 The specific results of the A(H3N2) primer set are shown;

[0045] Figure 5 The sensitivity results of the A(H3N2) primer set are shown;

[0046] Figure 6 The specific results of the primer set for the B-Victoria lineage are shown;

[0047] Figure 7 The sensitivity results of the primer set for the B-Victoria lineage are shown;

[0048] Figure 8 The validation results of the clinical specimens of suspected influenza A (H1N1pdm09) subtype in Example 4 are shown;

[0049] Fig. 9 The validation results of the clinical specimens suspected of influenza A (H3N2) subtype in Example 5 are shown;

[0050] Fig.10 The results of the validation of clinical specimens suspected of type B Victoria strain in Example 6 are shown. DETAILED DESCRIPTION

[0051] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments, but is not intended to be limiting of the present invention. It should be noted that the embodiments and features in the embodiments of the present invention may be combined with each other without conflict.

[0052] Example 1

[0053] This embodiment provides an isothermal amplification detection primer combination for detecting seasonal influenza virus. The primer design is as follows: the target gene of each pathogen is imported into the primer design software, and the Tm values ​​of F1c and B1c are similar, the Tm values ​​of F3 / B3 / F2 / B2 are similar, and the Tm values ​​of F1c and B1c are 5°C greater than the Tm value of F3 / B3 / F2 / B2, and the absolute values ​​of 5'dG and 3'dG are less than 4. DNA sequences are selected as candidate primers. The primer sequences of the isothermal amplification detection primer combination finally designed and screened in this embodiment are shown in Table 1 below.

[0054] Table 1

[0055]

[0056] Primer synthesis: The designed multiple sets of primer sequences were entrusted to Beijing Qingke Biological Company for synthesis and standby use.

[0057] In the first primer set, the molar ratio of F3, B3, FIP, BIP, and LB is 1:1:8:8:4; the molar ratio of F3, B3, FIP, BIP, and LB in the second primer set and the third primer set is the same as that in the first primer set.

[0058] The isothermal amplification detection primer combination for detecting seasonal influenza virus in this embodiment can be used to prepare a reagent or a kit for detecting multiple influenza viruses. The reagent or the kit or the chip is used to detect whether the sample to be tested contains influenza virus A (H1N1) and / or influenza virus A (H3N2) and / or influenza virus B (Victoria). The chip is a microfluidic chip, which also includes a constant temperature amplification premix.

[0059] Example 2

[0060] This embodiment provides an isothermal amplification detection method, which specifically includes the following steps:

[0061] Step 1, respectively mixing the primer combinations synthesized in Example 1 to obtain a first primer set mixed solution, a second primer set mixed solution, and a third primer set mixed solution, and also preparing an internal standard mixed solution;

[0062] In the first primer set mixture: the concentration of F3 is 0.67 μM, the concentration of B3 is 0.67 μM, the concentration of FIP is 5.36 μM, the concentration of BIP is 5.36 μM, and the concentration of LB is 2.68 μM;

[0063] In the second primer set mixture: the concentration of F3 is 0.67 μM, the concentration of B3 is 0.67 μM, the concentration of FIP is 5.36 μM, the concentration of BIP is 5.36 μM, and the concentration of LB is 2.68 μM;

[0064] In the third primer set mixture: the concentration of F3 is 0.67 μM, the concentration of B3 is 0.67 μM, the concentration of FIP is 5.36 μM, the concentration of BIP is 5.36 μM, and the concentration of LB is 2.68 μM;

[0065] In the internal standard mixed solution: the concentration of F3 is 0.67 μM, the concentration of B3 is 0.67 μM, the concentration of FIP is 5.36 μM, the concentration of BIP is 5.36 μM, and the concentration of LB is 2.68 μM.

[0066] Among them, the nucleotide sequences of the external primers F3 and B3, the internal primers FIP and BIP used for amplification of the internal standard fragment are as follows:

[0067] External primer F3: CCTTGGACCCAGAGGTTCTT (SEQ ID NO. 16);

[0068] External primer B3: ACGTGCAGCTTGTCACAG (SEQ ID NO. 17);

[0069] Internal primer FIP: AGCCTTCACCTTAGGGTTGCCTGAGTCCTTTGGGGATCTGT (SEQ ID NO. 18);

[0070] Internal primer BIP: AAGTGCTCGGTGCCTTTAGTGACAGCTCACTCAGTGTGGC (SEQ ID NO. 19).

[0071] Step 2: This embodiment uses a chip produced by Shanghai Suchuang Diagnostics Products Co., Ltd. (such as Figure 1 As shown in the figure, A, B, C, D, E, F, G, and H are sample wells, and reaction pools 1 to 32 are amplification wells). According to the target sequence in Table 2 below, the first primer set mixture, the second primer set mixture, the third primer set mixture, and the internal standard mixture are spotted by a needle chip spotter. Each needle is pre-sprayed to balance the pressure difference inside and outside the spotting needle, and then 2 μL of each portion is spotted into the amplification wells of the chip in the form of multiple drops.

[0072] Table 2

[0073] Amplification well number Pathogens 1，5，9，13，17，21，25，29 The first primer set mixture (H1N1pdm09 subtype) 2，6，10，14，18，22，26，30 Second primer set mixture (Influenza A H3N2 subtype) 3，7，11，15，19，23，27，31 The third primer set mixture (type B Victoria line) 4，8，12，16，20，24，28，32 Internal standard mixture

[0074] The microfluidic chip with the primer group is evenly spread and placed in a vacuum drying oven for drying at room temperature at a vacuum of ≤100Pa for 10 to 30 minutes. The ambient humidity is required to be 40 to 60%. Finally, a backing film is attached to the back of the chip and it is placed in a sealing bag and sealed.

[0075] Step 3: Preparation of isothermal amplification premix:

[0076] Each 25 μL premix contains: 1.4 μL of 25 mM dNTP, 0.8 μL of 10% BSA, 0.3 μL of 1 M MgSO4, 0.9 μL of 25 μM fluorescent dye, 0.5 μL of 5 M betaine, 0.2 μL of 200 U / μL reverse transcriptase and 1.0 μL of 8 U / μL Bst DNA polymerase.

[0077] Step 4: Mix 5 μl of the sample to be tested with 25 μl of the constant temperature amplification premix, add the mixture to the A, B, C, D, E, F, G, and H sample wells of the chip, and then seal it for testing; the reaction temperature during the test is 60-65°C, and the reaction time is 30 minutes.

[0078] Example 3

[0079] 1. Results of the validation of the influenza A (H1N1)pdm09 primer set

[0080] 1.1 Specificity and sensitivity of the H1N1pdm09 primer set (e.g. Figure 2 and Figure 3 (shown)

[0081] 1.2 Intra-day and inter-day precision of the A(H1N1)pdm09 primer set (as shown in Table 3 below)

[0082] Table 3

[0083]

[0084] 1.3 Intra-day precision of the H1N1pdm09 primer set for different sample concentrations (as shown in Table 4 below)

[0085] Table 4

[0086]

[0087] 2. Results of the validation of the influenza A (H3N2) primer set

[0088] 2.1 Specificity and sensitivity of the H3N2 primer set (e.g. Figure 4 and Figure 5 (shown)

[0089] 2.2 Intra-day and inter-day precision of the A(H3N2) primer set (as shown in Table 5 below)

[0090] Table 5

[0091]

[0092] 2.3 Intra-day precision of the H3N2 primer set for detection of different sample concentrations (as shown in Table 6 below)

[0093] Table 6

[0094]

[0095] 3. Results of the validation of the primer set for Victoria strain B

[0096] 3.1 Specificity and sensitivity of the primer set for type B Victoria (e.g. Figure 6 and Figure 7 (shown)

[0097] 3.2 Intra-day and inter-day precision of the primer set for type B Victoria (as shown in Table 7 below)

[0098] Table 7

[0099]

[0100] 3.3 Intra-day precision of the primer set for Victoria type B detection at different sample concentrations (as shown in Table 8 below) Table 8

[0101]

[0102] Example 4 Verification of suspected influenza A H1N1pdm09 subtype clinical specimens

[0103] refer to Figure 8 In this embodiment, 100 nasopharyngeal swab specimens suspected of being infected with influenza A (H1N1pdm09) were verified, and Realtime PCR was compared at the same time. The test results showed that for samples with a Cq value less than 35, the detection consistency rate of the two methods was 100%. At the same time, the detection time used by the LAMP chip method was significantly shorter than that of the Realtime PCR method; for samples with a Cq value greater than or equal to 35, the consistency rate of the two methods was 54.5%, the positive detection rate of LAMP was 81.8%, and the positive detection rate of Realtime PCR was 36.4%.

[0104] Example 5 Verification of suspected influenza A H3N2 subtype clinical specimens

[0105] refer to Fig. 9 In this embodiment, 112 nasopharyngeal swab specimens suspected of being infected with influenza A (H3N2) were verified, and Realtime PCR was compared at the same time. The test results showed that for samples with a Cq value less than 35, the detection consistency rate of the two methods was 98.8%. At the same time, the detection time used by the LAMP chip method was significantly shorter than that of the Realtime PCR method; for samples with a Cq value greater than or equal to 35, the consistency rate of the two methods was 96.9%, the positive detection rate of LAMP was 9.38%, and the positive detection rate of Realtime PCR was 6.25%.

[0106] Example 6 Verification of suspected Victoria type B clinical specimens

[0107] refer to Fig.10 In this embodiment, 96 nasopharyngeal swab specimens suspected of being infected with type B Victoria strain were verified, and Realtime PCR was compared at the same time. The test results showed that for samples with Cq values ​​less than 25, the detection consistency rate of the two methods was 100%. At the same time, the detection time used by the LAMP chip method was significantly shorter than that of the Realtime PCR method; for samples with Cq values ​​between 25 and 35, the consistency rate of the two methods was 93.1%, and for samples with Cq values ​​greater than 35, the consistency rate of the two methods was 50.0%. The positive detection rate of LAMP was 58.3%, and the positive detection rate of Realtime PCR was 33.3%.

[0108] Note: The consistency rate represents the ratio of the number of samples with the same test results of LAMP microfluidic chip and qPCR to the total number of samples in the Cq partition; the positive detection rate represents the ratio of the number of positive results detected by LAMP microfluidic chip or qPCR method to the total number of samples in the Cq partition.

[0109] The above description is only a preferred embodiment of the present invention, and does not limit the implementation mode and protection scope of the present invention. For those skilled in the art, it should be aware that all solutions obtained by equivalent substitutions and obvious changes made using the contents of the specification and illustrations of the present invention should be included in the protection scope of the present invention.

Claims

1. An isothermal amplification detection primer combination for detecting seasonal influenza virus, characterized in that: The primer combination includes a first primer set, a second primer set and a third primer set; The first primer set is used to detect influenza virus A / H1N1, and is composed of the following primers: H1-F3: GVAATTCCTCTCTCTGCC; H1-B3: GTDCCATTGGAATGTTTGTCA; H1-FIP: CATCCCCTTGGAACCGATDTTAGTGGATGGGCTRTATACAGT; H1-BIP: ATAAGGGAMCCATTCATATCATGCTTTTAGCAAWGCCCCTTGA; H1-LB: ACAGGCCTCATACAAAATCTTCAG; The second primer set is used to detect influenza virus A / H3N2, and consists of the following primers: H3-F3:GGGBTTACTTCAAAATACGAAG; H3-B3:TTGCCAATTTCAGGBTGC; H3-FIP: GGAGTGATGCATTCAGACTTACATTTGGGAAAAGCTCAATAATGAG A; H3-BIP: ATGGAAGCATTCCCAATGWCAACTTAACGTATCTGGGACAGG; H3-LB: GCACCCATTGGCAAATGTAAGTCTG; The third primer set is used to detect influenza virus B / Victoria, and is composed of the following primers: B-F3: GTGCTTYCCTATAATGCATGA; B-B3: CTGTTTGTTDTTTGGGACAG; B-FIP: GTGAGTTGACAACCTGACATGTTACAAAAATTAGACAGCTGCCT; B-BIP: CACCAGGAGGACCCTACGAAADGAATCCTTTTCCATTGGTAA; B-LB: GCTTGGGCTGTCCCAAAAAAC.

2. The isothermal amplification detection primer combination for detecting seasonal influenza virus according to claim 1, characterized in that: In the first primer set, the molar ratio of F3, B3, FIP, BIP, and LB is 1:1:(5-8):(5-8):

4.

3. Use of the isothermal amplification detection primer combination as claimed in claim 1 or 2 in preparing a reagent or a kit or a chip for detecting multiple influenza viruses, characterized in that: The reagent or the kit or the chip is used to detect whether the sample to be tested contains influenza virus A(H1N1) virus and / or influenza virus A(H3N2) virus and / or influenza virus B(Victoria) strain.

4. An isothermal amplification detection microfluidic chip for detecting seasonal influenza virus, characterized in that: The microfluidic chip comprises the isothermal amplification detection primer combination as claimed in claim 1.

5. The isothermal amplification detection microfluidic chip for detecting seasonal influenza virus according to claim 4, characterized in that: Also includes isothermal amplification master mix.

6. An isothermal amplification detection method, characterized in that: The following steps are involved: Step 1, designing and synthesizing the primer combination as described in claim 1 or 2, and preparing primer mixtures for three pathogens and an internal standard respectively; Step 2: using a needle chip spotter to spot the prepared primer mixture onto the amplification wells of the microfluidic chip, and then drying the microfluidic chip; Step 3, preparation of isothermal amplification premix; Step 4: Mix the sample to be tested with the isothermal amplification premix and add it into the sample well of the dried microfluidic chip, and seal it for testing.

7. The isothermal amplification detection method according to claim 6, characterized in that: The specific process of drying is: the microfluidic chip is evenly laid out and then placed in a vacuum drying oven, and dried at room temperature with a vacuum of ≤100Pa for 10 to 30 minutes, and the ambient humidity is required to be 40 to 60%.

8. The isothermal amplification detection method according to claim 6, characterized in that: The isothermal amplification premix includes: 25mM dNTP, 10% BSA, 1M MgSO4, 25μM fluorescent dye, 5M betaine, 200U / μL RNA reverse transcriptase, and 8U / μL BstDNA polymerase.

9. The isothermal amplification detection method according to claim 6, characterized in that: The reaction temperature during detection is 60-65°C and the reaction time is 30-40min.

Images