Trace gene library building kit and sequencing method
By fragmenting and amplifying the microgenomic DNA using amplification primers and transposase complexes in the microgenomic library kit, the problem of difficulty in quickly and accurately constructing a microgenomic sequencing library in the prior art is solved, and efficient and accurate microgenomic sequencing is achieved.
Patent Information
- Application Number
- CN202311381696.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-23
- Publication Date
- 2025-04-25
AI Technical Summary
The prior art is difficult to quickly and accurately construct a microgenome sequencing library, especially when the number of single-cell or microgenome samples is small, resulting in low sequencing efficiency and quality.
A microgenomic library kit is provided, which contains amplification primers and transposase complexes, which can achieve its enrichment by fragmenting and amplifying trace genomic DNA and directly used to construct ONT sequencing libraries.
This method can quickly and accurately construct a microgenome sequencing library, improve the coverage and uniformity of the ONT sequencing library, and thus improve the sequencing quality.
Smart Images
Figure CN119877110A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of gene detection technology, and in particular to a micro-genomic library construction kit and a sequencing method. Background Art
[0002] Single cells are the basic units of multicellular organisms. The continuous differentiation of mature organisms during development leads to great differences between cells, especially tumor tissues. The high heterogeneity of tumor tissues requires that related research be carried out at the single-cell level.
[0003] Single-cell sequencing refers to the amplification and sequencing of transcriptomes or genomes at the level of individual cells to detect data from multiple omics such as genomics (structural variations-SVs; copy number variations-CNVs; single nucleotide variants-SNVs, etc.), transcriptomics (RNA expression levels; alternative splicing of transcripts), epigenomics (DNA methylation, etc.), and proteomics. The outstanding advantage of single-cell sequencing technology is that it can detect cell specificity and differences between cells from the perspective of cell maps, explore the collaborative operation mode between cells, and study tissue heterogeneity, so as to deeply characterize diseases based on the characteristics at the cellular level.
[0004] ONT (Oxford Nanopore Technologies) sequencing is the third generation of single-molecule real-time electrical signal sequencing technology based on nanopores. It does not require PCR amplification, thus avoiding the errors introduced by PCR amplification. For single-cell genome sequencing, it has the advantages of high throughput, high accuracy, and long read length. Based on these technical features, third-generation sequencing plays an increasingly important role in genetic disease screening, tumor screening, microbial sequencing, and drug target design, especially in genome methylation sequencing.
[0005] The conventional ONT sequencing process mainly includes the steps of nucleic acid extraction, library construction, on-machine sequencing and bioinformatics analysis. Among them, library construction is a key step. The quality of library construction is directly related to the success or failure of sequencing and the accuracy of the results. At the same time, the speed of library construction affects the efficiency of sequencing.
[0006] At present, the common third-generation sequencing library construction method is mostly to extract DNA from tissues or cells and other samples through nucleic acid extraction kits, and then combine fragment end repair, barcode connection, adapter connection and other steps to construct the library. Although this method is relatively mature, the nucleic acid extraction process requires a large number of samples, which will damage the integrity of the genome and cause data loss. The process is cumbersome, the quality control rate is low, and it is time-consuming and labor-intensive. The amount of single-cell or trace genome samples is often small, making it difficult to quickly and accurately construct a trace genome library through the above method.
[0007] How to quickly and accurately construct a micro-genome sequencing library is a difficult point in micro-genome sequencing. Summary of the invention
[0008] In order to quickly and accurately construct a microgenomic library, the present application provides a microgenomic library construction kit, the kit includes amplification primers, the amplification primers include upstream primers and downstream primers, the sequence of the upstream primer includes a combination sequence of the sequence shown in SEQ ID No.1 and a first tag sequence, and the sequence of the downstream primer includes a combination sequence of the sequence shown in SEQ ID No.2 and a second tag sequence.
[0009] After fragmenting and amplifying the trace genomic DNA, the micro-genome library construction kit of the present application can achieve the enrichment of the trace genomic DNA, which can be directly used to construct the ONT sequencing library. While simplifying the ONT library construction process, it improves the coverage and uniformity of the ONT sequencing library, thereby improving the ONT sequencing quality.
[0010] In one embodiment, the amplification primer satisfies at least one of the following conditions (1) to (5);
[0011] (1) The first tag sequence and / or the second tag sequence is composed of random bases, and optionally, the number of the random bases is 6 to 30;
[0012] (2) the first tag sequence is the same as the second first tag sequence;
[0013] (3) the upstream primer includes the sequence shown in SEQ ID No. 3;
[0014] (4) the downstream primer includes the sequence shown in SEQ ID No. 4;
[0015] (5) The working concentration of the amplification primer is 1 μM to 5 μM.
[0016] In one embodiment, the kit further comprises a transposase complex, the transposase complex comprising a transposase and a first adapter, a second adapter, and a donor nucleic acid fragment for assembly with the transposase;
[0017] The sequence of the first adapter includes a sequence identical to a portion of the upstream primer sequence and a sequence that is reverse complementary to the donor nucleic acid fragment;
[0018] The sequence of the second adapter includes a sequence identical to a portion of the downstream primer sequence and a sequence that is reverse complementary to the donor nucleic acid fragment;
[0019] Optionally, the transposase complex satisfies at least one of the following characteristics (1) to (3):
[0020] (1) The first linker of the transposase complex comprises the sequence shown in SEQ ID No.5;
[0021] (2) the second linker of the transposase complex comprises the sequence shown in SEQ ID No.6;
[0022] (3) The donor nucleic acid fragment of the transposase complex includes the sequence shown in SEQ ID No.7.
[0023] In one embodiment, the kit further comprises a transposase buffer reagent, and the transposase buffer reagent satisfies at least one of the following characteristics (1) to (2):
[0024] (1) Transposase buffer reagents include TAPS-KOH, MgCl 2 and at least one of DMF;
[0025] (2) the transposase complex includes a transposase and a first linker element, a second linker element, and a donor nucleic acid element for assembling with the transposase;
[0026] Optionally, each component of the transposase buffer reagent satisfies at least one of the following characteristics (1) to (4):
[0027] (1) The pH value of the transposase buffer reagent is 7-8;
[0028] (2) The concentration of TAPS-KOH in the transposase buffer reagent is 10 mM to 100 mM;
[0029] (3) MgCl in transposase buffer 2 The concentration is 20mM~50Mm;
[0030] (4) The volume fraction of DMF in the transposase buffer reagent is 10% to 50%.
[0031] In one embodiment, the kit further comprises an amplification reagent, wherein the amplification reagent comprises Tris-HCl, KCl, (NH 4 ) 2 SO 4, at least one of DMSO, SDS, NP-40, BSA, Tritom-X100, dNTP and high-fidelity DNA polymerase;
[0032] Each component of the amplification reagent satisfies at least one of the following characteristics (1) to (12):
[0033] (1) The pH value of the amplification reagent is 8-9;
[0034] (2) The concentration of Tris-HCl in the amplification reagent is 20 mM to 50 mM;
[0035] (3) The concentration of KCl in the amplification reagent is 20mM to 50mM;
[0036] (4) In the amplification reagent (NH 4 ) 2 SO 4 The concentration is 20mM~50mM;
[0037] (5) The volume fraction of DMSO in the amplification reagent is 5% to 10%;
[0038] (6) The volume fraction of SDS in the amplification reagent is 0.01% to 0.05%
[0039] (7) The volume fraction of NP-40 in the amplification reagent is 0.01% to 0.1%;
[0040] (8) The concentration of BSA in the amplification reagent is 0.01 mg / mL to 0.2 mg / mL;
[0041] (9) The volume fraction of Triton-X100 in the amplification reagent is 0.1% to 1%;
[0042] (10) The sum of the base concentrations of each dNTP in the amplification reagent is 0.1 mM to 1 mM;
[0043] (11) Amplification reagents include KAPA HiFi hot start high-fidelity DNA polymerase;
[0044] (12) The working concentration of the high-fidelity DNA polymerase in the amplification reagent is 1U to 5U.
[0045] In one embodiment, the cell lysis reagent includes at least one of cell lysis enzyme, Tris-HCl, EDTA, KCl and Triton X-100;
[0046] The components of the cell lysis reagent satisfy at least one of the following characteristics (1) to (7);
[0047] (1) The pH value of the cell lysis reagent is 7-8;
[0048] (2) The concentration of Tris-HCl in the cell lysis reagent is 10 mM to 50 mM;
[0049] (3) The concentration of EDTA in the cell lysis reagent is 1mM to 10mM;
[0050] (4) The concentration of KCl in the cell lysis reagent is 10mM to 40mM;
[0051] (5) The volume fraction of Triton X-100 in the cell lysis reagent is 0.1% to 1%;
[0052] (6) cell lytic enzymes including proteinase K;
[0053] (7) The working concentration of the cell lytic enzyme is 1 μg / mL to 15 μg / mL.
[0054] The present application also provides a method for sequencing a micro genome, using the above kit to fragment and amplify a micro genome sample to construct a micro genome sequencing library.
[0055] In one embodiment, fragmenting and amplifying a trace amount of genomic sample includes:
[0056] Using a transposase complex to fragment a trace amount of genomic sample to obtain fragmented trace amount of genomic DNA;
[0057] Amplification primers are used to amplify the fragmented trace genomic DNA to obtain enriched genomic DNA.
[0058] In one embodiment, the step of constructing a micro-genomic sequencing library further comprises:
[0059] The enriched genomic DNA is end-repaired and adapter-ligated to obtain a micro-genomic sequencing library.
[0060] In one embodiment, the method further comprises: performing ONT sequencing on the micro-genomic sequencing library. BRIEF DESCRIPTION OF THE DRAWINGS
[0061] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0062] Figure 1 This is the fragment distribution diagram of library S1 constructed in Example 2 of the present application;
[0063] Figure 2 This is a fragment distribution diagram of library S2 constructed in Example 2 of the present application;
[0064] Figure 3 This is a fragment distribution diagram of library S3 constructed in Example 2 of the present application;
[0065] Figure 4 This is the fragment distribution diagram of library S4 constructed in Example 3 of the present application;
[0066] Figure 5 This is the fragment distribution diagram of library S5 constructed in Example 3 of the present application;
[0067] Figure 6 This is the fragment distribution diagram of library S6 constructed in Example 3 of the present application;
[0068] Figure 7 The CNV analysis results of library S7 constructed in Example 4 of the present application;
[0069] Figure 8 The CNV analysis results of library S8 constructed in Example 4 of the present application;
[0070] Fig. 9 This is the CNV analysis result of library S9 constructed in Example 4 of the present application. DETAILED DESCRIPTION
[0071] References to embodiments of the present application will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present application. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present application without departing from the scope or spirit of the present application. For example, a feature described or described as part of one embodiment may be used in another embodiment to produce a further embodiment.
[0072] Therefore, it is intended that the present application covers such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present application are disclosed in or are apparent from the following detailed description. It will be appreciated by those of ordinary skill in the art that this discussion is merely a description of exemplary embodiments and is not intended to limit the broader aspects of the present application.
[0073] As used herein, the term "primer" refers to an oligonucleotide, whether naturally present in a purified restriction digest or produced synthetically, which can function as a starting point for synthesis when placed under conditions that induce synthesis of primer extension products complementary to a nucleic acid chain (e.g., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH). The primer is preferably single-stranded for maximum efficiency in amplification, but may alternatively be double-stranded. If double-stranded, the primer is first treated to separate its chains before being used to prepare an extension product. Preferably, the primer is an oligodeoxyribonucleotide. The primer should be long enough to initiate the synthesis of an extension product in the presence of an inducing agent. The precise length of the primer depends on many factors, including temperature, primer source, and the use of the method. For example, in some embodiments, primers range from 10 to 100 or more nucleotides (e.g., 10-300, 15-250, 15-200, 15-150, 15-100, 15-90, 20-80, 20-70, 20-60, 20-50 nucleotides, etc.).
[0074] In order to at least partially solve at least one of the above technical problems, the first aspect of the present application provides a kit for constructing a micro genome sequencing library, comprising amplification primers, the amplification primers comprising an upstream primer and a downstream primer, the sequence of the upstream primer comprising a combined sequence of a sequence shown in SEQ ID No.1 and a first tag sequence, and the sequence of the downstream primer comprising a combined sequence of a sequence shown in SEQ ID No.2 and a second tag sequence;
[0075] Among them, SEQ ID No.1:
[0076] CTCTCAGTACGTCAGCAGTTAACTCCTTGGCTCACAGAACGACATGGCTACG;
[0077] SEQ ID No.2:
[0078] GCATGGCGACCTTATCATGTCTTCCTAAGACCGCTTGG.
[0079] In some embodiments, the first and second tag sequences are composed of random bases, and the tag sequences are inserted into the sequences shown in SEQ ID No.1 or SEQ ID No.2 to form corresponding primers. The position where the tag sequences are inserted in SEQ ID No.1 and / or SEQ ID No.2 is arbitrary without affecting the amplification performance. The number of random bases in the tag sequence depends on the detection requirements, and can generally be 6 to 30, for example, 20-30, and specifically, 24. The tag sequence in the tag primer is used to introduce an index barcode during the amplification process of the pre-amplification product to add an index barcode to each test sample.
[0080] In some specific embodiments, the sequence of the upstream primer includes the sequence shown in SEQ ID No. 3;
[0081] Among them, SEQ ID No.3:
[0082] CTCTCAGTACGTCAGCAGTTNNNNNNNNAACTCCTTGGCTCACAGAACGACATGGCTACG.
[0083] In some specific embodiments, the sequence of the downstream primer includes the sequence shown in SEQ ID No.4;
[0084] Among them, SEQ ID No.4:
[0085] GCATGGCGACCTTATCANNNNNNNNTGTCTTCCTAAGACCGCTTGG.
[0086] In the above sequence, NNNNNNNN represents a tag sequence consisting of several random bases N.
[0087] After the kit of the present application fragments and amplifies a trace amount of genomic DNA, an ONT sequencing library can be directly constructed, which simplifies the sequencing library construction process while improving the coverage and uniformity of the ONT sequencing library, thereby improving the quality of ONT sequencing.
[0088] Specifically, a microgenome refers to a genome with a mass of pg. In some embodiments, a microgenome can come from a single cell or a small number of cells. The single cell can be a single cell of any tissue in an animal or human body, such as a single cell extracted from a tissue, a circulating tumor cell, a circulating fetal cell, etc.
[0089] In some specific embodiments, in order to achieve better amplification effect, the working concentration of the amplification primer is 1 μM to 5 μM; further 1 μM to 4 μM; further 2 μM.
[0090] In some embodiments, in order to achieve the enrichment of trace genomic DNA, the kit also includes an amplification reagent. Optionally, the amplification reagent includes Tris-HCl, KCl, (NH 4 ) 2 SO 4 , DMSO, SDS, NP-40, BSA, Tritom-X100, dNTP and at least one of KAPA HiFi hot start high-fidelity DNA polymerase are used to amplify fragmented trace genomic DNA to obtain enriched trace genome.
[0091] In some specific embodiments, the pH value of the amplification reagent is 8-9; further 8.7-8.9; further 8.8.
[0092] In some specific embodiments, the concentration of Tris-HCl in the amplification reagent is 20 mM to 50 mM; further 20 mM to 40 mM; further 30 mM.
[0093] In some specific embodiments, the concentration of KCl in the amplification reagent is 20 mM to 50 mM; further 20 mM to 40 mM; further 30 mM.
[0094] In some specific embodiments, the amplification reagent (NH 4 ) 2 SO 4 The concentration is 20mM to 50mM; further 20mM to 40mM; further 30mM.
[0095] In some specific embodiments, the volume fraction of DMSO in the amplification reagent is 5% to 10%; further 7% to 9%; further 8%.
[0096] In some specific embodiments, the volume fraction of SDS in the amplification reagent is 0.02% to 0.5%; further 0.02% to 0.4%; further 0.2%.
[0097] In some specific embodiments, the volume fraction of NP-40 in the amplification reagent is 0.01% to 0.1%; further 0.04% to 0.6%; further 0.5%.
[0098] In some specific embodiments, the concentration of BSA in the amplification reagent is 0.01 mg / mL to 0.2 mg / mL; further 0.05 mg / mL to 0.15 mg / mL; further 0.1 mg / mL.
[0099] In some specific embodiments, the volume fraction of Triton-X100 in the amplification reagent is 0.1% to 1%; further 0.04% to 0.06%; further 0.05%.
[0100] In some specific embodiments, the sum of the base concentrations of the dNTPs in the amplification reagent is 0.1 mM to 1 mM; further 0.4 mM to 0.6 mM; further 0.5 mM.
[0101] In some specific embodiments, the amplification reagent includes KAPA HiFi hot-start high-fidelity DNA polymerase, which is used in combination with amplification primers to amplify and enrich the fragmented micro-genome.
[0102] In some specific embodiments, the working concentration of the high-fidelity DNA polymerase in the amplification reagent is 1U-5U, further 2U-4U, and further 3U.
[0103] In some embodiments, in order to achieve fragmentation of trace genomic DNA, the kit also includes a transposase complex, which is used to fragment the trace genome and simultaneously introduce sequences complementary to the amplification primers on the fragmentation products to facilitate subsequent enrichment of the fragmented genomic DNA.
[0104] In some embodiments, in order to achieve the transposition function, the kit further comprises a transposase complex to achieve the fragmentation of a trace amount of genome and the introduction of sequences for amplification at both ends of the fragmentation product in one step.
[0105] In some embodiments, the transposase complex includes a transposase and a first adapter, a second adapter, and a donor nucleic acid fragment assembled with the transposase, wherein the sequence of the first adapter includes a sequence identical to a portion of the upstream primer sequence and a sequence that is reverse complementary to the donor nucleic acid fragment; the sequence of the second adapter includes a sequence identical to a portion of the downstream primer sequence and a sequence that is reverse complementary to the donor nucleic acid fragment.
[0106] In some specific embodiments, the first linker of the transposase complex includes the sequence shown in SEQ ID No. 5, including a sequence that is complementary to the donor nucleic acid fragment to achieve assembly of the transposase complex; and also includes a sequence identical to the partial sequence of the upstream primer, which is used to provide an amplification template during the amplification process of the amplification primer.
[0107] Among them, SEQ ID No.5:
[0108] AGAACGACATGGCTACGAGATGTGTATAAGAGACAG.
[0109] In some specific embodiments, the second linker of the transposase complex includes the sequence shown in SEQ ID No. 6, including a sequence that is complementary to the donor nucleic acid fragment to achieve assembly of the transposase complex; and also includes a sequence identical to the partial sequence of the downstream primer, which is used to provide an amplification template during the amplification process of the amplification primer.
[0110] Among them, SEQ ID No.6:
[0111] TCCTAAGACCGCTTGGAGATGTGTATAAGAGACAG.
[0112] In some specific embodiments, the donor nucleic acid fragment of the transposase complex comprises the sequence shown in SEQ ID No.7.
[0113] Among them, SEQ ID No.7:
[0114] CTGTCTCTTATACACATCT.
[0115] In some embodiments, the kit further comprises a transposase buffer reagent, wherein the transposase buffer reagent comprises TAPS-KOH, MgCl 2 and DMF, for mixing with the components of the transposase complex to achieve the assembly of the transposase complex.
[0116] In some specific embodiments, the pH value of the transposase buffer reagent is 7-8; further 7.2-7.8; further 7.5.
[0117] In some specific embodiments, the concentration of TAPS (tris(hydroxymethyl)aminopropanesulfonic acid)-KOH in the transposase buffer reagent is 10 mM to 100 mM; further 10 mM to 80 mM; further 10 mM to 60 mM; further 50 mM.
[0118] In some embodiments, the transposase buffer contains MgCl 2 The concentration is 20mM to 50mM; further 10mM to 40mM; further 30mM.
[0119] In some specific embodiments, the volume fraction of DMF (N,N-dimethylformamide) in the transposase buffer reagent is 10% to 50%; further 10% to 40%; further 25%.
[0120] In some embodiments, in order to obtain a trace amount of genomic samples in cells, especially a trace amount of genomic samples in single cells, the kit includes a cell lysis reagent, which contains at least one of a cell lysis enzyme, Tris-HCl, EDTA, KCl and Triton X-100 to release genomic DNA in the cells.
[0121] In some specific embodiments, the pH value of the cell lysis reagent is 7 to 8, further 7.3 to 7.8, and further 7.8.
[0122] In some specific embodiments, the concentration of Tris-HCl in the cell lysis reagent is 10 mM to 50 mM, further 20 mM to 40 mM, and further 30 mM.
[0123] In some specific embodiments, the concentration of EDTA in the cell lysis reagent is 1 mM to 10 mM, further 1 mM to 5 mM, and further 2 mM.
[0124] In some specific embodiments, the concentration of KCl in the cell lysis reagent is 10 mM to 40 mM, further 10 mM to 30 mM, and further 20 mM.
[0125] In some specific embodiments, the volume fraction of Triton X-100 in the cell lysis reagent is 0.1%-1%, further 0.1%-0.3%, and further 0.2%.
[0126] In some specific embodiments, the cell lysis enzyme includes proteinase K, which is a powerful proteinase with high specific activity. It is active in a wide pH range (4-12.5) and at high temperatures (50°C-70°C). In genomic DNA extraction, it is used to enzymatically hydrolyze histones bound to nucleic acids, freeing the DNA in the solution to facilitate subsequent pre-amplification reactions.
[0127] In some specific embodiments, the working concentration of the cell lytic enzyme is 1 μg / mL to 15 μg / mL, further 5 μg / mL to 13 μg / mL, and further 10 μg / mL.
[0128] In some embodiments, in order to add ONT-specific adapters to both ends of the amplified product, the kit also includes an end repair reagent to facilitate end repair of the amplified product, and then used to construct an ONT sequencing library. The ONT-specific adapter is a special adapter provided by the Nanopore sequencing kit, such as a motor protein.
[0129] In some specific embodiments, the end repair reagent can use conventional end repair reagents in the art to perform end repair treatment on the amplified product and add adenine (A) fragments to the ends of the DNA fragments.
[0130] In some embodiments, the kit further comprises an adapter ligation reagent to connect ONT-specific adapters to both ends of the end-repair product, wherein the adapter ligation reagent can be purchased through commercial channels.
[0131] In summary, the present application is based on the basic principles and methods of gene transposition, releases trace genomic DNA by single cell lysis, and then quickly completes genomic DNA enrichment by fragmenting the trace genomic DNA through transposase complex and amplifying the trace genomic DNA with amplification primers, purifies the enriched product and performs end repair, and finally connects to the ONT platform-specific adapter to quickly complete the construction of a sequencing library for the genomic DNA of a single or several cells. Compared with the traditional ONT library construction method, it does not require nucleic acid extraction from a large number of cells, and the operation is simple, and the library is uniform and stable.
[0132] The present application also provides a method for sequencing a micro genome, comprising: using the above-mentioned kit, especially the amplification primers in the kit, to amplify the fragmented micro genome sample. Specifically, the amplification primers are used to amplify the micro genome sample and introduce the tag sequence at the same time, so as to achieve the enrichment of the micro genome DNA.
[0133] Compared with the traditional micro-genome library construction method, the sequencing library construction method of the present application can realize a rapid library construction process, and complete part of the ONT library construction work while realizing the micro-genomic DNA through one-time amplification after the micro-genomic DNA is fragmented. It has the characteristics of extremely simplified library construction process, good library construction quality, and relatively low cost, and at the same time improves the coverage and uniformity of micro-genome sequencing data.
[0134] In some specific embodiments, constructing a sequencing library of a trace amount of genomic DNA sample comprises:
[0135] The trace genomic DNA sample is subjected to fragmentation treatment using the above transposition reagent to obtain a trace genomic DNA sample connected with an ONT adapter;
[0136] The micro-amount genomic DNA sample connected with the ONT adapter is amplified to obtain a micro-amount genomic sequencing library.
[0137] In some embodiments, in order to connect complete adapters and tags at both ends of the amplified product, after amplifying the trace genomic DNA sample, a step of using an end repair reagent to repair the ends of the trace genomic DNA sample connected to the ONT adapter is also included.
[0138] Specifically, end repair refers to adding an adenine (A) tail to the 3' end of the amplified product. The purpose of end repair is to repair damaged or incomplete DNA ends into 5' phosphorylated blunt-end DNA for blunt-end DNA ligation with the ONT adapter.
[0139] In some embodiments, in order to improve the end repair efficiency, the amplified product is purified before the end repair is performed on the amplified product. The purification of the amplified product can be performed by conventional DNA purification methods in the art.
[0140] The implementation scheme of the present application will be described in detail below with reference to examples.
[0141] The nucleic acid composition used in the examples of this application was synthesized by Shanghai Bio-Tech Co., Ltd. Other reagents used in the examples of this application were obtained through conventional commercial channels.
[0142] Example 1
[0143] 1. Single cell isolation
[0144] Obtain cell line samples or tissue samples, prepare them into cell suspensions, and then use micromanipulation, flow cytometry, etc. to prepare the cell suspensions into single cells and dispense them into 0.2 ml PCR tubes, with a solution volume of 2.5 μL.
[0145] 2. Cell lysis reaction
[0146] (1) Prepare cell lysis buffer 2: 30 mM Tris-Cl pH 7.8, 2 mM EDTA, 20 mM KCl, 0.2% Triton X-100.
[0147] (2) Add 2.5 μL of cell lysis buffer and 0.2 μL of proteinase K to every 2.5 μL of single cell sample, centrifuge briefly, and place in a PCR instrument for reaction. Reaction procedure: 70°C for 10 min; 95°C for 4 min; store at 25°C.
[0148] 3. Prepare the transposition complex.
[0149] (1) The synthetic sequence of the transposition complex is shown in Table 1.
[0150] Table 1
[0151] name sequence Adaptor1 AGAACGACATGGCTACGAGATGTGTATAAGAGACAG Adaptor2 TCCTAAGACCGCTTGGAGATGTGTATAAGAGACAG ME CTGTCTCTTATACACATCT
[0152] (2) Place 10 μL of 50 uM Adaptor1 / ME primer working solution (Ad1) and 10 μL of 50 uM Adaptor2 / ME primer working solution (Ad2) in a PCR instrument, and run the program as shown in Table 2.
[0153] Table 2
[0154]
[0155] (3) After the reaction is completed, Ad1 and Ad2 are mixed in equal proportions (10 μL + 10 μL) to form a mixed linker.
[0156] 4. Transposome Preparation
[0157] (1) Preparation of the transposome assembly reaction system, as shown in Table 3.
[0158] Table 3
[0159] Components 1× Volume μL Ad1 and Ad2 mixed adapter mixture (50uM) 1 Transposase (10uM) 5
[0160] (2) Mix the reaction system by pipetting and incubate at room temperature for 1 h. After the reaction is completed, store it on ice or at -20°C until use.
[0161] 5. Rapid library construction
[0162] (1) Prepare 2× transposition buffer: 50 mM TAPS-KOH, 30 mM MgCl2, 25% DMF, pH 7.5.
[0163] (2) Prepare 2× amplification reaction solution: 30 mM Tris-HCl, 30 mM KCl, 30 mM (NH4)2SO4, 8% DMSO, 0.02% SDS, 0.05% NP-40, 0.1 mg / ml BSA, 0.2% Tritom-X100, 0.5 mM dNTP, 2 U KAPA HiFi DNA Polymerase, pH 8.8.
[0164] (3) Fragmentation reaction: Prepare the fragmentation reaction system according to Table 4 below.
[0165] Table 4
[0166] Reagents Reaction volume / μL Transposition Buffer 10 Cleavage products 5 Transposition complex 5 total 20
[0167] After the preparation is completed, centrifuge it instantly and place it in a PCR instrument for reaction. The reaction procedure is: 55℃ for 10min; store at 4℃.
[0168] (4) Amplification Reaction The amplification reaction system was prepared according to Table 5 below.
[0169] Table 5
[0170]
[0171]
[0172] After the amplification reaction system is prepared, centrifuge it instantly and place it in a PCR instrument for reaction. The reaction procedure is shown in Table 6.
[0173] Table 6
[0174]
[0175] (5) Purify the amplified product using magnetic beads and conduct quality inspection.
[0176] Purified magnetic beads (VAHTS DNA Clean Beads (Vazyme, #N411)) were added at a ratio of 1:1. 50 μL of purified magnetic beads were added for every 50 μL of reaction product. The mixture was mixed by pipetting and adsorbed at room temperature for 5 minutes.
[0177] Wash twice with 200 μL of 80% ethanol and let dry for 2 min.
[0178] Add 21 μL of water and mix thoroughly, let stand at room temperature for 2 min, and then use a fluorescence spectrophotometer (ThermoFisher, Qubit TM 4.0) Conduct concentration detection.
[0179] (6) End repair
[0180] The ligation reaction system was prepared using the NEBNext Ultra II End Repair / dA Tailing Kit (NEB, #E7546L), as shown in Table 7 below.
[0181] Table 7
[0182]
[0183]
[0184] The reaction system was mixed by pipetting, centrifuged briefly, and then placed in a PCR instrument to run the program shown in Table 8.
[0185] Table 8
[0186] cycle temperature time 1 20℃ 5min 1 65℃ 5min 1 4℃ ∞
[0187] After the reaction, GCS Reagent (M) DNA Clean Beads (Genologue, #B002-5) were added at a ratio of 1:1. 60 μL of purified magnetic beads were added for every 60 μL of reaction product. The mixture was mixed by pipetting and adsorbed at room temperature for 5 min, and the supernatant was discarded.
[0188] Add 100 μL of 80% ethanol and wash twice, and dry for 2 min.
[0189] Add 66 μL ddH2O and mix thoroughly by pipetting. Incubate at room temperature for 2 min to elute.
[0190] (7)Adapter connection
[0191] The ligation reaction system was prepared using the NEBNext Quick Ligation Module Kit (NEB, #E6056L), as shown in Table 9 below.
[0192] Table 9
[0193] Element Reactor Previous step product 65 NEBNext Rapid Ligation Reaction Buffer (5X) 20 Adapter Mix II (AMII) 5 Fast T4 DNA Ligase 10 total 100
[0194] (8) Purify the amplified product using magnetic beads and conduct quality inspection.
[0195] GCS Reagent (M) DNA Clean Beads (Genologue, #B002-5) was added at a ratio of 2:1. 50 μL of purified magnetic beads were added for every 100 μL of reaction product. The mixture was mixed by pipetting and adsorbed at room temperature for 5 minutes.
[0196] Wash twice with 200 μL of SFB (Short Fragment Buffer) and dry for 30 seconds.
[0197] Add 15 μL EB and mix thoroughly, then stand at room temperature for 10 min to elute.
[0198] The purity of the obtained product was determined using an ultra-micro spectrophotometer (ThermoFisher, NanoDrop One).
[0199] Fluorescence spectrophotometer (ThermoFisher, Qubit TM 4.0) The concentration of the above library was measured and the length of the library fragments was analyzed using a fully automatic nucleic acid electrophoresis analysis system (Bioptic, Qsep100).
[0200] 6. Sequencing
[0201] After the two samples passed the quality control, they were sequenced in strict accordance with the operating requirements of the Oxford nanopore MinlON sequencing platform. The sequencing depth was expected to be about 1x. The sequencing data were compared and analyzed to obtain basic information of the whole genome DNA.
[0202] Example 2
[0203] 1. Single cell isolation
[0204] Three groups of cell lines were obtained, namely S1, S2, and S3, and the method was the same as that in Example 1.
[0205] 2. Cell lysis reaction
[0206] (1) Prepare cell lysis buffer 1: 30 mM Tris-Cl pH 7.8, 2 mM EDTA, 20 mM KCl.
[0207] (2) Prepare cell lysis solution 2: 30 mM Tris-Cl pH 7.8, 2 mM EDTA, 20 mM KCl, 0.2% Triton X-100.
[0208] (3) Prepare cell lysis solution 3: 30 mM Tris-Cl pH 7.8, 2 mM EDTA, 20 mM KCl, 0.2% Triton X-100, 0.1% Tween 20.
[0209] (4) Add 2.5 μL of cell lysis solution 1 to S1, 2.5 μL of cell lysis solution 2 to S2, and 2.5 μL of cell lysis solution 3 to S3, and add 0.2 μL of proteinase K to each of them. After instant centrifugation, place in a PCR instrument for reaction. Reaction procedure: 70℃ for 10 min; 95℃ for 4 min; store at 25℃.
[0210] 3. Prepare the transposition complex.
[0211] The method is the same as in Example 1.
[0212] 4. Transposome Preparation
[0213] The method is the same as in Example 1.
[0214] 5. Rapid library construction
[0215] The method is the same as in Example 1.
[0216] The library concentration was quality checked using Qubit4.0, and the yield is shown in Table 10 below.
[0217] Table 10
[0218] Group S1 S2 S3 Library concentration 12.4 15.7 13.6
[0219] The fragment length was analyzed using a fully automatic nucleic acid electrophoresis analysis system (Bioptic, Qsep100). Figure 1 to Figure 3 shown.
[0220] From Table 1, the yield and Figure 1 to Figure 3 From the distribution of Chinese libraries, it can be seen that the S2 library has the highest concentration and the most uniform distribution. This shows that after the cells are treated with cell lysis buffer 2, the quality of the constructed library is significantly better than that of S1 and S3.
[0221] Example 3
[0222] 1. Single cell isolation
[0223] Three groups of cell lines were obtained, namely S4, S5, and S6, and the method was the same as that in Example 1.
[0224] 2. Cell lysis reaction
[0225] The method is the same as in Example 1.
[0226] 3. Prepare the transposition complex.
[0227] The method is the same as in Example 1.
[0228] 4. Transposome Preparation
[0229] The method is the same as in Example 1.
[0230] 5. Rapid library construction
[0231] The library construction method was the same as in Example 1, and the amplified sequences were shown in Table 11 below. In the sequences in Table 11, "X" represents a random base N.
[0232] Table 11
[0233]
[0234] The library concentration was quality checked using Qubit4.0, and the yield is shown in Table 12 below.
[0235] Table 12
[0236] Group S4 S5 S6 Library concentration 15.2 12.1 11.0
[0237] The fragment length was analyzed using a fully automated nucleic acid electrophoresis analysis system (Bioptic, Qsep100). Figures 4 to 6 shown.
[0238] from Figures 4 to 6 From the fragment distribution of the Chinese library, there is no significant difference among S4, S5 and S6, but the S4 library has the highest yield, that is, the M1-1 and M2-1 primer pairs have the highest amplification efficiency. This shows that amplification primers containing 20 random base length tag sequences are more conducive to improving amplification efficiency.
[0239] Example 4
[0240] 1. Single cell isolation
[0241] Three groups of cell lines were obtained, namely S7, S8, and S9, and the method was the same as that in Example 1.
[0242] 2. Cell lysis reaction
[0243] S7 method is the same as in Example 1.
[0244] 3. Prepare the transposition complex.
[0245] S7 method is the same as in Example 1.
[0246] 4. Transposome Preparation
[0247] S7 method is the same as in Example 1.
[0248] 5. Rapid library construction
[0249] The S7 database construction method is the same as that in Example 1.
[0250] Both S8 and S9 passed Single Cell WGA Kit (Clontech, #R300672) was used for micro-genomic amplification, the S8 amplification product was used to construct a library using the Rapid Barcoding Kit 96 (NEB, #SQK-RBK110.96) transposase library construction method, and the S9 library was constructed using the Ligation Sequencing Kit (NEB, #SQK-LSK109).
[0251] 6. Sequencing
[0252] After the three quality controls were qualified, sequencing was carried out strictly in accordance with the operating requirements of the Oxford nanopore MinlON sequencing platform. The sequencing depth was expected to be about 1x. The sequencing data was compared with the reference genome sequence, and the sequencing alignment rate, coverage and SD value were calculated. The data were analyzed using the human cell chromosome detection data analysis system.
[0253] 3. Experimental results
[0254] (1) The basic data of sequencing the three libraries are shown in Table 13 below.
[0255] Table 13
[0256] Sample No. Clean reads Comparison rate Average sequencing depth Coverage SD value S7 6348432 97.83 1.21 12.33 1.02 S8 5934913 97.35 1.19 11.25 1.21 S9 6128465 97.45 1.20 12.13 1.13
[0257] (2) As can be seen from Table 13, the amount of sequencing data of the three libraries is roughly the same, and there is no significant difference in the alignment rate and average sequencing depth; in terms of coverage, library S7 has a higher coverage; Figure 7 to Figure 9 From the chromosome detection results, we can see that the sequencing results of S7 show that the distribution of chromosomes is the most concentrated.
[0258] (3) The results show that the micro-genome sequencing effect of the rapid single-cell library construction method of the ONT platform provided in this application is higher in coverage and uniformity than the traditional Rapid Barcoding Kit 96 (NEB, #SQK-RBK110.96) transposase library construction method and the Ligation Sequencing Kit (NEB, #SQK-LSK109) direct library construction method, and it greatly saves time and makes the detection process faster.
[0259] The technical features of the above embodiments may be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0260] The above embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims.
Claims
1. A micro-genomic library construction kit, characterized in that: The kit includes amplification primers, which include an upstream primer and a downstream primer. The sequence of the upstream primer includes a combined sequence of a sequence shown in SEQ ID No. 1 and a first tag sequence, and the sequence of the downstream primer includes a combined sequence of a sequence shown in SEQ ID No. 2 and a second tag sequence.
2. The kit according to claim 1, characterized in that The amplification primer satisfies at least one of the following conditions (1) to (5); (1) The first tag sequence and / or the second tag sequence consists of random bases; Optionally, the number of random bases is 6 to 30; (2) the first tag sequence is the same as the second first tag sequence; (3) the upstream primer comprises the sequence shown in SEQ ID No. 3; (4) the downstream primer comprises the sequence shown in SEQ ID No. 4; (5) The working concentration of the amplification primer is 1 μM to 5 μM.
3. The kit according to claim 1 or 2, characterized in that The kit further comprises a transposase complex, which comprises a transposase and a first adapter, a second adapter and a donor nucleic acid fragment for assembling with the transposase; The sequence of the first adapter includes a sequence identical to a portion of the upstream primer sequence and a sequence that is reverse complementary to the donor nucleic acid fragment; The sequence of the second adapter includes a sequence identical to the sequence of the downstream primer portion and a sequence that is reverse complementary to the donor nucleic acid fragment; Optionally, the transposase complex satisfies at least one of the following characteristics (1) to (3): (1) The first linker of the transposase complex comprises the sequence shown in SEQ ID No.5; (2) the second linker of the transposase complex comprises the sequence shown in SEQ ID No.6; (3) The donor nucleic acid fragment of the transposase complex includes the sequence shown in SEQ ID No.
7.
4. The kit according to claim 3, characterized in that The kit further comprises a transposase buffer reagent, wherein the transposase buffer reagent comprises at least one of TAPS-KOH, MgCl2 and DMF; Optionally, the transposase buffer reagent satisfies at least one of the following characteristics (1) to (4): (1) The pH value of the transposase buffer reagent is 7 to 8; (2) The concentration of TAPS-KOH in the transposase buffer reagent is 10 mM to 100 mM; (3) The concentration of MgCl2 in the transposase buffer reagent is 20mM to 50mM; (4) The volume fraction of DMF in the transposase buffer reagent is 10% to 50%.
5. The kit according to claim 3, characterized in that The kit further comprises an amplification reagent, wherein the amplification reagent comprises at least one of a label primer, Tris-HCl, KCl, (NH4)2SO4, DMSO, SDS, NP-40, BSA, Triton-X100, dNTP and a high-fidelity DNA polymerase; Optionally, the amplification reagent satisfies at least one of the following characteristics (1) to (12): (1) The pH value of the amplification reagent is 8 to 9; (2) The concentration of Tris-HCl in the amplification reagent is 20 mM to 50 mM; (3) The concentration of KCl in the amplification reagent is 20 mM to 50 mM; (4) The concentration of (NH4)2SO4 in the amplification reagent is 20mM to 50mM; (5) The volume fraction of DMSO in the amplification reagent is 5% to 10%; (6) The volume fraction of SDS in the amplification reagent is 0.01% to 0.05% (7) The volume fraction of NP-40 in the amplification reagent is 0.01% to 0.1%; (8) The concentration of BSA in the amplification reagent is 0.01 mg / mL to 0.2 mg / mL; (9) The volume fraction of Triton-X100 in the amplification reagent is 0.1% to 1%; (10) The sum of the base concentrations of the dNTPs in the amplification reagent is 0.1 mM to 1 mM; (11) The amplification reagent includes KAPA HiFi hot start high-fidelity DNA polymerase; (12) The working concentration of the high-fidelity DNA polymerase in the amplification reagent is 1U to 5U.
6. The kit according to claim 3, characterized in that The kit further comprises a cell lysis reagent, wherein the cell lysis reagent comprises at least one of a cell lysis enzyme, Tris-HCl, EDTA, KCl and Triton X-100; Optionally, the components of the cell lysis reagent satisfy at least one of the following characteristics (1) to (7); (1) The pH value of the cell lysis reagent is 7 to 8; (2) The concentration of Tris-HCl in the cell lysis reagent is 10 mM to 50 mM; (3) The concentration of EDTA in the cell lysis reagent is 1 mM to 10 mM; (4) The concentration of KCl in the cell lysis reagent is 20 mM to 40 mM; (5) The volume fraction of Triton X-100 in the cell lysis reagent is 0.1% to 1%; (6) The cell lytic enzyme includes proteinase K; (7) The working concentration of the cell lytic enzyme is 1 μg / mL to 15 μg / mL.
7. A method for micro-genome sequencing, characterized in that: The steps include: The kit according to any one of claims 1 to 6 is used to fragment and amplify a microgenomic sample to construct a microgenomic sequencing library.
8. The method according to claim 7, characterized in that The method further comprises: performing ONT sequencing on the micro-genomic sequencing library.
9. The method according to claim 7, characterized in that: The steps of fragmenting and amplifying the micro-genomic sample to construct a micro-genomic sequencing library include: Using transposase to fragment the trace genomic sample to obtain fragmented trace genomic DNA; Amplification primers are used to amplify the fragmented trace genomic DNA to obtain enriched genomic DNA.
10. The method according to claim 9, characterized in that The step of constructing a micro-genome sequencing library also includes: The enriched genomic DNA is end-repaired and adapter-ligated to obtain a micro-genomic sequencing library.