Exosome specificity affinity enrichment nano magnetic bead, preparation method thereof and kit
By designing nucleic acid aptamer modification framework nucleic acid nanomagnetic beads that specifically bind exosome membrane protein CD63, the existing exosome enrichment methods are solved, and efficient and specific exosome enrichment is achieved.
Patent Information
- Application Number
- CN202411862664.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-17
- Publication Date
- 2025-04-25
AI Technical Summary
Existing exosome enrichment methods are time-consuming, costly, poor recovery efficiency, and susceptible to contamination by protein aggregates or other biological particles of similar density or volume in biological matrix, resulting in interference in the proteomic analysis of exosomes.
An exosome-specific affinity enriched nanomagnetic bead was designed, and the nucleic acid aptamer modification framework was used to bind the nucleic acid nanostructure and amino-modified nanomagnetic beads. By specifically binding to the exosome membrane protein CD63, efficient enrichment and avoid contamination are achieved.
It significantly improves the enrichment efficiency and enrichment specificity of exosomes, reduces the contamination of exosomes, and is suitable for exosome enrichment separation in biological matrix samples.
Smart Images
Figure CN119881305A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of functionalized magnetic nanomaterials, and in particular relates to exosome-specific affinity-enriched nanomagnetic beads and a preparation method and a kit thereof. Background Art
[0002] Blood circulating exosomes have great potential in the dynamic monitoring of tumors, but the exosome content in blood samples is low (about 10 per ml). 10 The small size and heterogeneity of particle size and biochemical composition of exosomes make the extraction, detection and traceability of exosomes difficult. Therefore, efficient acquisition of high-purity exosome samples is a key step in achieving its omics analysis and functional research. Although many exosome enrichment methods have been established and developed, the commonly used exosome enrichment and separation methods (such as ultracentrifugation, density gradient centrifugation, polymer precipitation, ultrafiltration, exclusion chromatography, etc.) usually have the disadvantages of long time, high cost, and poor recovery efficiency. In addition, since the above methods only use the physical properties of exosomes (such as density, diameter, etc.), the exosomes obtained are very susceptible to contamination by protein aggregates or other biological particles of similar density or volume in the biological matrix, which in turn interferes with the proteomic analysis of exosomes, thus greatly limiting their application potential. Based on the "antigen-antibody" specific immunoaffinity reaction, by recognizing and specifically binding to specific antigens on the surface of exosomes, the enrichment specificity of exosomes can be effectively improved, thereby avoiding contamination by other biological particles. However, since the antibody reactivity is restricted by many conditions and the antigen-antibody binding requires sufficient action time, the extraction efficiency of this method is usually low and the cost is high, making it unsuitable for large-scale analysis.
[0003] Nucleic acid aptamers are a type of single-stranded DNA or RNA nucleic acid molecules with specific recognition functions. They have affinity and specificity comparable to monoclonal antibodies, while avoiding the disadvantages of antibodies such as easy denaturation and inactivation, and high prices, making them more suitable as affinity sites for exosome enrichment materials. Existing exosome enrichment magnetic beads with nucleic acid aptamers as recognition functional groups usually directly adsorb or bond the aptamers to the surface of the magnetic beads, lacking effective support arms, making it difficult to avoid the interaction between the DNA chain of the nucleic acid aptamer and the surface of the magnetic beads, and thus making it difficult to achieve the best enrichment effect. Summary of the invention
[0004] In order to solve the above problems, the present invention designs an exosome-specific affinity enrichment nanomagnetic bead and a preparation method and a kit thereof.
[0005] The present invention adopts the following technical solution:
[0006] A kind of exosome-specific affinity enrichment nanomagnetic bead, the exosome-specific affinity enrichment nanomagnetic bead comprises a nucleic acid aptamer modified framework nucleic acid nanostructure and an amino-modified nanomagnetic bead; the nucleic acid aptamer modified framework nucleic acid nanostructure comprises five single-stranded DNA molecules, the five single-stranded DNA molecules are C1, C2, C3, C4 and C5, and the C2, C3 and C4 have active reaction groups; the C1, C2, C3 and C4 synthesize a tetrahedral framework nucleic acid nanostructure; the C5 is connected with the tetrahedral framework nucleic acid nanostructure through C1 to form the nucleic acid aptamer modified framework nucleic acid nanostructure; the C5 is a nucleic acid aptamer, and the nucleic acid aptamer can specifically bind to the exosome membrane protein CD63; a plurality of the nucleic acid aptamer modified framework nucleic acid nanostructures are connected through active reaction groups and surrounded by the periphery of the amino-modified nanomagnetic bead to form the exosome-specific affinity enrichment nanomagnetic bead, and the nucleic acid aptamer is distributed on the periphery of the exosome-specific affinity enrichment nanomagnetic bead.
[0007] A method for preparing the above-mentioned exosome-specific affinity enrichment nanomagnetic beads, the preparation method comprising the following steps:
[0008] S1 designs and synthesizes 5 single-stranded DNA molecules;
[0009] S2 placing the five single-stranded DNA molecules in the same container for annealing reaction to synthesize the nucleic acid aptamer modified framework nucleic acid nanostructure;
[0010] S3 synthesizes nanomagnetic beads by a “solvothermal method”, and modifies the surface of the nanomagnetic beads with active reaction groups to obtain the amino-modified nanomagnetic beads;
[0011] S4: the nucleic acid aptamer modified framework nucleic acid nanostructure obtained in step S2 and the amino modified nanomagnetic beads obtained in step S3 are mixed and reacted to synthesize exosome-specific affinity enrichment nanomagnetic beads with the tetrahedral framework nucleic acid nanostructure as the spacer arm.
[0012] Furthermore, the nucleotide sequences of the five single-stranded DNA molecules are:
[0013] C1 is: (5'-3')AACGCCTTAGGCAAAATACACAGATGCCTAGGAGGATGCACAGTAGGTAATG TCGCAATAACGACTAGATCGAACCTGCGGATACATAGGAT
[0014] C2 is: (5'-3')CHO-TGCATCCTCCTAGGCATCTGTGTAAAACTCAGTGGACGAAGTTACTCTATCGGATCGTCGCTTCTTCGCAA
[0015] C3 is: (5'-3')CHO-TTACAGTCTGAGGTAATAATCGCGGCGTAACTTCGTCGTCCACTGAGTTTATCCTATGTATCCGCAGGTTCGAT
[0016] C4 is: (5'-3')CHO-CGCGATTATTACCTCAGACTGTAAACAGTCGTTATTGCGACATTACCTACGATTGCGAAGAAGCGACGATCCGATA
[0017] C5 is: (5'-3')TTTTGCCTAAGGCGTTCACCCCACCTCGCTCCCGTGACACTAATGCTA.
[0018] Furthermore, the 16 bases at the 5' end of C1 and C5 are palindromic sequences, and the stable binding of the nucleic acid aptamer to the tetrahedral framework nucleic acid nanostructure is achieved through complementary pairing of palindromic sequence bases.
[0019] Furthermore, the active reaction group is an aldehyde group, and the aldehyde group is located at the 5' end of C2, C3 and C4.
[0020] Furthermore, step S2 includes: preparing 5 kinds of single-stranded DNA molecules into solutions with a concentration of 100 μmol / L respectively, taking 1 μL of each and adding them into 95 μL of TE buffer to prepare a solution with a final concentration of 1 μmol / L for each single-stranded DNA molecule, heating at 95° C. for 10 minutes, and reacting at 4° C. for 30 minutes to obtain a nucleic acid aptamer-modified framework nucleic acid nanostructure solution.
[0021] Further, the step S3 comprises: weighing 2.8g of ferric chloride hexahydrate and dispersing it in 100mL of ethylene glycol, and ultrasonically treating it for 10min; adding 7.3g of anhydrous sodium acetate and stirring it for 25-30min; then placing it in a high-pressure reactor at 200°C for 10h, washing and drying after cooling to obtain ferroferric oxide nano-magnetic beads; taking 300mg of the ferroferric oxide nano-magnetic beads and dispersing it in a mixed solution of 50mL of anhydrous ethanol and 2mL of ammonia water, heating it to 60°C and stirring it for 10min, and then adding 900μL of 3-(trimethoxysilyl)propyl methacrylate, continue stirring to react for 24 hours, wash and dry to obtain product one; weigh 180 mg of the product one and ultrasonically disperse it in 120 mL of acetonitrile, add 130 μL of glycidyl methacrylate, 150 mg of N,N-methylenebisacrylamide and 7 mg of azobisisobutyronitrile, mix well and place in an oil bath at 90°C and heat to boil for reaction for 1.5 hours, wash and dry to obtain product two; weigh 100 mg of the product two and disperse it in 100 mL of propylenediamine, place in an oil bath at 90°C and react for 3 hours to obtain the amino-modified nanomagnetic beads.
[0022] Furthermore, step S4 includes: taking 20 μL of the aptamer-modified framework nucleic acid nanostructure solution obtained in step S2 and 20 mg of the amino-modified nanomagnetic beads obtained in step S3, adding them together to 200 μL of TE buffer, shaking the reaction at 4°C for 12 hours, and washing with water three times to obtain exosome-specific affinity enrichment nanomagnetic beads.
[0023] A kit for specific adsorption of exosomes, comprising the above-mentioned exosome-specific affinity enrichment nanomagnetic beads and PBS buffer.
[0024] Furthermore, the method of using the kit includes: taking 2 mg of the exosome-specific affinity enrichment nanomagnetic beads and dispersing them in 48 μL of PBS buffer, adding the biological material to be enriched, shaking and incubating at room temperature for 20 minutes, and then performing magnetic separation, discarding the supernatant, and washing with PBS buffer for 3 times to complete the specific adsorption of exosomes.
[0025] Beneficial effects:
[0026] The exosome-specific affinity-enriched nanomagnetic beads prepared by the present invention include a tetrahedral framework nucleic acid nanostructure. The tetrahedral framework nucleic acid nanostructure with a rigid skeleton forms a spacer arm to provide support for the nucleic acid aptamer, and the nucleic acid aptamer and the magnetic beads are spaced, thereby effectively maintaining the specific affinity activity of the nucleic acid aptamer, and the affinity enrichment activity of the nucleic acid aptamer can be maximized. The exosome-specific affinity-enriched nanomagnetic beads prepared by the present invention also significantly improve the enrichment efficiency of exosomes. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0028] Figure 1 This is a schematic diagram of the structure of an exosome-specific affinity-enriched nanomagnetic bead of the present invention;
[0029] Figure 2 Schematic diagram of transmission electron microscopy of exosome-specific affinity enrichment nanomagnetic beads of the present invention;
[0030] Figure 3 Schematic diagram of a scanning electron microscope photograph of exosomes eluted after enrichment by the exosome-specific affinity enrichment nanomagnetic beads of the present invention;
[0031] Figure 4 Schematic diagram of the West-Blot measurement results of characteristic proteins of exosomes enriched by the exosome-specific affinity enrichment nanomagnetic beads of the present invention;
[0032] Figure 5 Schematic diagram of the analysis results of exosome protein components in the serum of colorectal cancer patients and the serum of the healthy control group enriched by the exosome-specific affinity enrichment nanomagnetic beads of the present invention. DETAILED DESCRIPTION
[0033] In order to better understand the technical solution of the present invention, the embodiments of the present invention are described in detail below with reference to the accompanying drawings.
[0034] It should be clear that the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0035] Embodiment 1:
[0036] An exosome-specific affinity enrichment nanomagnetic bead, such as Figure 1As shown, the exosome-specific affinity enrichment nanomagnetic beads include a nucleic acid aptamer-modified framework nucleic acid nanostructure and an amino-modified nanomagnetic bead; the nucleic acid aptamer-modified framework nucleic acid nanostructure includes five single-stranded DNA molecules, which are C1, C2, C3, C4 and C5, respectively, and the C2, C3 and C4 have active reaction groups; the C1, C2, C3 and C4 synthesize a tetrahedral framework nucleic acid nanostructure; the C5 is connected to the tetrahedral framework nucleic acid nanostructure through C1 to form the nucleic acid aptamer-modified framework nucleic acid nanostructure; the C5 is a nucleic acid aptamer, and the nucleic acid aptamer can specifically bind to the exosome membrane protein CD63; a plurality of the nucleic acid aptamer-modified framework nucleic acid nanostructures are connected by active reaction groups and surrounded by the periphery of the amino-modified nanomagnetic beads to form the exosome-specific affinity enrichment nanomagnetic beads, and the nucleic acid aptamers are distributed on the periphery of the exosome-specific affinity enrichment nanomagnetic beads.
[0037] A method for preparing the above-mentioned exosome-specific affinity enrichment nanomagnetic beads, the preparation method comprising the following steps:
[0038] S1 designs and synthesizes 5 single-stranded DNA molecules;
[0039] S2 placing the five single-stranded DNA molecules in the same container for annealing reaction to synthesize the nucleic acid aptamer modified framework nucleic acid nanostructure;
[0040] S3 synthesizes nanomagnetic beads by a “solvothermal method”, and modifies the surface of the nanomagnetic beads with active reaction groups to obtain the amino-modified nanomagnetic beads;
[0041] S4: the nucleic acid aptamer modified framework nucleic acid nanostructure obtained in step S2 and the amino modified nanomagnetic beads obtained in step S3 are mixed and reacted to synthesize exosome-specific affinity enrichment nanomagnetic beads with the tetrahedral framework nucleic acid nanostructure as the spacer arm.
[0042] Furthermore, the nucleotide sequences of the five single-stranded DNA molecules are:
[0043] C1 is: (5'-3')AACGCCTTAGGCAAAATACACAGATGCCTAGGAGGATGCACAGTAGGTAATG TCGCAATAACGACTAGATCGAACCTGCGGATACATAGGAT
[0044] C2 is: (5'-3')CHO-TGCATCCTCCTAGGCATCTGTGTAAAACTCAGTGGACGAAGTTACTCTATCGGATCGTCGCTTCTTCGCAA
[0045] C3 is: (5'-3')CHO-TTACAGTCTGAGGTAATAATCGCGGCGTAACTTCGTCGTCCACTGAGTTTATCCTATGTATCCGCAGGTTCGAT
[0046] C4 is: (5'-3')CHO-CGCGATTATTACCTCAGACTGTAAACAGTCGTTATTGCGACATTACCTACGATTGCGAAGAAGCGACGATCCGATA
[0047] C5 is: (5'-3')TTTTGCCTAAGGCGTTCACCCCACCTCGCTCCCGTGACACTAATGCTA.
[0048] Furthermore, the 16 bases at the 5' end of C1 and C5 are palindromic sequences, and the stable binding of the nucleic acid aptamer to the tetrahedral framework nucleic acid nanostructure is achieved through complementary pairing of palindromic sequence bases.
[0049] Furthermore, the active reaction group is an aldehyde group, and the aldehyde group is located at the 5' end of C2, C3 and C4.
[0050] Furthermore, step S2 includes: preparing 5 kinds of single-stranded DNA molecules into solutions with a concentration of 100 μmol / L respectively, taking 1 μL of each and adding them into 95 μL of TE buffer to prepare a solution with a final concentration of 1 μmol / L for each single-stranded DNA molecule, heating at 95° C. for 10 minutes, and reacting at 4° C. for 30 minutes to obtain a nucleic acid aptamer-modified framework nucleic acid nanostructure solution.
[0051] Further, the step S3 comprises: weighing 2.8g of ferric chloride hexahydrate and dispersing it in 100mL of ethylene glycol, and ultrasonically treating it for 10min; adding 7.3g of anhydrous sodium acetate and stirring it for 25-30min; then placing it in a high-pressure reactor at 200°C for 10h, washing and drying after cooling to obtain ferroferric oxide nano-magnetic beads; taking 300mg of the ferroferric oxide nano-magnetic beads and dispersing it in a mixed solution of 50mL of anhydrous ethanol and 2mL of ammonia water, heating it to 60°C and stirring it for 10min, and then adding 900μL of 3-(trimethoxysilyl)propyl methacrylate, continue stirring to react for 24 hours, wash and dry to obtain product one; weigh 180 mg of the product one and ultrasonically disperse it in 120 mL of acetonitrile, add 130 μL of glycidyl methacrylate, 150 mg of N,N-methylenebisacrylamide and 7 mg of azobisisobutyronitrile, mix well and place in an oil bath at 90°C and heat to boil for reaction for 1.5 hours, wash and dry to obtain product two; weigh 100 mg of the product two and disperse it in 100 mL of propylenediamine, place in an oil bath at 90°C and react for 3 hours to obtain the amino-modified nanomagnetic beads.
[0052] Furthermore, step S4 includes: taking 20 μL of the aptamer-modified framework nucleic acid nanostructure solution obtained in step S2 and 20 mg of the amino-modified nanomagnetic beads obtained in step S3, adding them together to 200 μL of TE buffer, shaking the reaction at 4°C for 12 hours, and washing with water three times to obtain exosome-specific affinity enrichment nanomagnetic beads.
[0053] A kit for specific adsorption of exosomes, comprising the above-mentioned exosome-specific affinity enrichment nanomagnetic beads and PBS buffer.
[0054] Furthermore, the method of using the kit includes: taking 2 mg of the exosome-specific affinity enrichment nanomagnetic beads and dispersing them in 48 μL of PBS buffer, adding the biological material to be enriched, shaking and incubating at room temperature for 20 minutes, and then performing magnetic separation, discarding the supernatant, and washing with PBS buffer for 3 times to complete the specific adsorption of exosomes.
[0055] Example 2
[0056] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0057] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0058] The present invention provides a method for preparing and applying exosome-specific affinity enrichment nanomagnetic beads with framework nucleic acid as spacer arms. The structural schematic diagram of the designed nanomagnetic beads is shown in FIG. Figure 1 As shown, its preparation and application methods are as follows:
[0059] (1) Based on the principle of complementary base pairing, five single-stranded DNA molecules were designed and synthesized. The five single-stranded DNA molecules are C1, C2, C3, C4 and C5, and their nucleotide sequences are as follows:
[0060] C1: (5'-3')AACGCCTTAGGCAAAATACACAGATGCCTAGGAGGATGCACAGTAGGTAATGTC GCAATAACGACTAGATCGAACCTGCGGATACATAGGAT;
[0061] C2: (5'-3')CHO-TGCATCCTCCTAGGCATCTGTGTAAAACTCAGTGGACGACGAAGTTACTCTATCGGATCGTCGCTTCTTCGCAA;
[0062] C3: (5'-3')CHO-TTACAGTCTGAGGTAATAATCGCGGCGTAACTTCGTCGTCCACTGAGTTTATCCTATGTATCCGCAGGTTCGAT;
[0063] C4: (5'-3')CHO-CGCGATTATTACCTCAGACTGTAAACAGTCGTTATTGCGACATTACCTACGATTGCGAAGAAGCGACGATCCGATA;
[0064] C5: (5'-3')TTTTGCCTAAGGCGTTCACCCCACCTCGCTCCCGTGACACTAATGCTA;
[0065] The designed C1, C2, C3 and C4 are used to synthesize tetrahedral framework nucleic acid nanostructures. C5 is a nucleic acid aptamer that can specifically bind to the exosome membrane protein CD63. The 16 bases at the 5' end of C1 and C5 are palindromic sequences, which can achieve stable binding of the nucleic acid aptamer to the tetrahedral framework nucleic acid nanostructure through base complementary pairing. The 5' end of C2, C3 and C4 is modified with an active reactive group aldehyde group (CHO-).
[0066] (2) The five designed single-stranded DNA molecules were placed in the same container for annealing reaction to synthesize the nucleic acid aptamer modified framework nucleic acid nanostructure. The five single-stranded DNA molecules were prepared into a solution with a concentration of 100 μmol / L, and 1 μL of each was added to 95 μL of TE buffer to prepare a solution with a final concentration of 1 μmol / L for each single-stranded DNA molecule. After heating at 95°C for 10 minutes, the solution was placed at 4°C for reaction for 30 minutes to obtain the nucleic acid aptamer modified framework nucleic acid nanostructure solution.
[0067] (3) The nanomagnetic beads were synthesized by the "solvothermal method", and the surface of the nanomagnetic beads was modified with active reactive groups. Weigh 2.8g of ferric chloride hexahydrate and disperse it in 100mL of ethylene glycol. After ultrasonic treatment for 10min, add 7.3g of anhydrous sodium acetate and stir mechanically for 25-30min. After mixing evenly, place it in a high-pressure reactor at 200℃ for 10h. After cooling, wash and dry, obtain ferroferric oxide nanomagnetic beads. Take 300mg of the above-obtained ferroferric oxide nanomagnetic beads and disperse them in a mixed solution of 50mL of anhydrous ethanol and 2mL of ammonia water. After heating and stirring at 60℃ for 10min, add 900μL of 3-(trimethoxysilyl) methyl methacrylate dropwise, continue stirring and reacting for 24h, wash and dry to obtain product 1. Weigh 180 mg of product 1 and disperse it in 120 mL of acetonitrile by ultrasonication, add 130 μL of glycidyl methacrylate, 150 mg of N,N-methylenebisacrylamide and 7 mg of azobisisobutyronitrile, mix well, heat and boil in a 90°C oil bath for 1.5 h, wash and dry to obtain product 2. Weigh 100 mg of product 2 and disperse it in 100 mL of propylenediamine, react in a 90°C oil bath for 3 hours to obtain amino-modified nanomagnetic beads, which are amino-modified magnetic beads Fe3O4@pGMA-NH2.
[0068] (4) The products obtained in step (2) and step (3) are mixed in proportion to react and synthesize exosome-specific affinity enrichment nanomagnetic beads. Take 20 μL of the nucleic acid aptamer-modified framework nucleic acid nanostructure solution obtained in step (2) and 20 mg of the amino-modified nanomagnetic beads (Fe3O4@pGMA-NH2) product obtained in step (3), add them together to 200 μL of TE buffer, shake and react at 4°C for 12 hours, and wash with water 3 times to obtain exosome-specific affinity enrichment nanomagnetic beads. The exosome-specific affinity enrichment nanomagnetic beads are CD63 nucleic acid aptamer-modified nanomagnetic beads Fe3O4@pGMA@DNA TET@CD63 aptamer, which are placed in a refrigerator for use. The synthesized nanomagnetic beads were characterized by transmission electron microscopy, and the results are as follows. Figure 2 shown.
[0069] (5) The exosome-specific affinity enrichment nanomagnetic beads prepared above were used for the enrichment and analysis of serum exosomes from patients with colorectal cancer. Take 2 mg of the obtained exosome-specific affinity enrichment nanomagnetic beads (nanomagnetic beads Fe3O4@pGMA@DNATET@CD63 aptamer) and disperse them in 48 μL of PBS buffer. Add the serum sample to be enriched, incubate at room temperature for 20 minutes, and then separate by magnetic separation. Discard the supernatant and wash 3 times with PBS buffer to achieve specific adsorption of exosomes. The exosomes can be fragmented or eluted for further analysis. The morphology of the exosomes eluted after enrichment was photographed using a scanning electron microscope. The results are shown in Figure 2. Figure 3 As shown in the figure, the exosomes after enrichment and elution showed a typical "tray-shaped" result. The characteristic proteins CD9 and TSG101 of the enriched exosomes were measured by West-Blot. The results are shown in the figure. Figure 4 As shown in the figure, two characteristic protein bands are clear. The above method was used to enrich and analyze serum samples from 20 colorectal cancer patients and 20 healthy people. The results are shown in the figure below. Figure 5 As shown, 84 differentially expressed exosomal proteins were screened, and 40 proteins were upregulated and 44 proteins were downregulated in the colorectal cancer patient group compared with the healthy control group.
[0070] The framework nucleic acid nanostructure in the nanomagnetic beads prepared by the present invention has a rigid skeleton, which can provide support for the nucleic acid aptamer. At the same time, it is spaced from the magnetic beads to maximize the affinity enrichment activity of the nucleic acid aptamer, thereby significantly improving the enrichment efficiency and enrichment specificity of exosomes, and is very suitable for the enrichment and separation of exosomes in biological matrix samples.
[0071] The embodiments of the present invention are described in detail above. Specific examples are used herein to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core idea. At the same time, for those skilled in the art, according to the idea of the present invention, there will be changes in the specific implementation methods and application scope. In summary, the content of this specification should not be understood as limiting the present invention.
Claims
1. An exosome-specific affinity enrichment nanomagnetic bead, characterized in that: The exosome-specific affinity enrichment nanomagnetic beads include a nucleic acid aptamer-modified framework nucleic acid nanostructure and an amino-modified nanomagnetic bead; the nucleic acid aptamer-modified framework nucleic acid nanostructure includes five single-stranded DNA molecules, which are C1, C2, C3, C4 and C5, respectively, and C2, C3 and C4 have active reaction groups; C1, C2, C3 and C4 synthesize a tetrahedral framework nucleic acid nanostructure; C5 is connected to the tetrahedral framework nucleic acid nanostructure through C1 to form the nucleic acid aptamer-modified framework nucleic acid nanostructure; C5 is a nucleic acid aptamer, and the nucleic acid aptamer can specifically bind to the exosome membrane protein CD63; a plurality of the nucleic acid aptamer-modified framework nucleic acid nanostructures are connected through active reaction groups and surrounded by the periphery of the amino-modified nanomagnetic beads to form the exosome-specific affinity enrichment nanomagnetic beads, and the nucleic acid aptamers are distributed on the periphery of the exosome-specific affinity enrichment nanomagnetic beads.
2. A method for preparing exosome-specific affinity enrichment nanomagnetic beads as claimed in claim 1, characterized in that: The preparation method comprises the following steps: S1 designs and synthesizes 5 single-stranded DNA molecules; S2 placing the five single-stranded DNA molecules in the same container for annealing reaction to synthesize the nucleic acid aptamer modified framework nucleic acid nanostructure; S3 uses a "solvothermal method" to synthesize nanomagnetic beads, and modifies the surface of the nanomagnetic beads with active reaction groups to obtain the amino-modified nanomagnetic beads; S4: the nucleic acid aptamer modified framework nucleic acid nanostructure obtained in step S2 and the amino modified nanomagnetic beads obtained in step S3 are mixed and reacted to synthesize exosome-specific affinity enrichment nanomagnetic beads with the tetrahedral framework nucleic acid nanostructure as the spacer arm.
3. The preparation method according to claim 2, characterized in that: The nucleotide sequences of the five single-stranded DNA molecules are: C1 is: (5'-3')AACGCCTTAGGCAAAATACACAGATGCCTAGGAGGATGCACAGTAGGTAATG TCGCAATAACGACTAGATCGAACCTGCGGATACATAGGAT C2 is: (5'-3')CHO-TGCATCCTCCTAGGCATCTGTGTAAAACTCAGTGGACGAAGTTACTCTATCGGATCGTCGCTTCTTCGCAA C3 is: (5'-3')CHO-TTACAGTCTGAGGTAATAATCGCGGCGTAACTTCGTCGTCCACTGAGTTTATCCTATGTATCCGCAGGTTCGAT C4 is: (5'-3')CHO-CGCGATTATTACCTCAGACTGTAAACAGTCGTTATTGCGACATTACCTACGATTGCGAAGAAGCGACGATCCGATA C5 is: (5'-3')TTTTGCCTAAGGCGTTCACCCCACCTCGCTCCCGTGACACTAATGCTA.
4. The preparation method according to claim 3, characterized in that: The 16 bases at the 5' end of C1 and C5 are palindromic sequences, and the stable binding of the nucleic acid aptamer on the tetrahedral framework nucleic acid nanostructure is achieved through complementary pairing of palindromic sequence bases.
5. The preparation method according to claim 4, characterized in that: The active reaction group is an aldehyde group, and the aldehyde group is located at the 5' end of C2, C3 and C4.
6. The preparation method according to claim 5, characterized in that: The step S2 comprises: preparing 5 kinds of single-stranded DNA molecules into solutions with a concentration of 100 μmol / L respectively, taking 1 μL of each and adding them into 95 μL of TE buffer to prepare a solution with a final concentration of each single-stranded DNA molecule of 1 μmol / L, heating at 95° C. for 10 minutes, and reacting at 4° C. for 30 minutes to obtain a nucleic acid aptamer modified framework nucleic acid nanostructure solution.
7. The preparation method according to claim 6, characterized in that: The step S3 comprises: weighing 2.8 g of ferric chloride hexahydrate and dispersing it in 100 mL of ethylene glycol, and ultrasonically treating it for 10 min; adding 7.3 g of anhydrous sodium acetate and stirring it for 25-30 min; then placing it in a high-pressure reactor and reacting it at 200° C. for 10 h, washing and drying it after cooling to obtain ferroferric oxide nano-magnetic beads; taking 300 mg of the ferroferric oxide nano-magnetic beads and dispersing it in a mixed solution of 50 mL of anhydrous ethanol and 2 mL of ammonia water, heating it to 60° C. and stirring it for 10 min, and then dropwise adding 900 μL of 3-(trimethoxymethylsilyl)methyl acrylate; Propyl acrylate, continue stirring to react for 24 hours, wash and dry to obtain product one; weigh 180 mg of the product one and ultrasonically disperse it in 120 mL of acetonitrile, add 130 μL of glycidyl methacrylate, 150 mg of N,N-methylenebisacrylamide and 7 mg of azobisisobutyronitrile, mix well and place in an oil bath at 90°C for heating and boiling reaction for 1.5 hours, wash and dry to obtain product two; weigh 100 mg of the product two and disperse it in 100 mL of propylenediamine, place in an oil bath at 90°C for reaction for 3 hours to obtain the amino-modified nanomagnetic beads.
8. The preparation method according to claim 7, characterized in that: The step S4 comprises: taking 20 μL of the aptamer-modified framework nucleic acid nanostructure solution obtained in step S2 and 20 mg of the amino-modified nanomagnetic beads obtained in step S3, adding them together to 200 μL of TE buffer, shaking the mixture at 4° C. for 12 hours, and washing with water three times to obtain exosome-specific affinity-enriched nanomagnetic beads.
9. A kit for specific adsorption of exosomes, characterized in that: The kit comprises the exosome-specific affinity enrichment nanomagnetic beads according to any one of claims 1 to 8 and a PBS buffer.
10. The kit according to claim 9, characterized in that: The method of using the kit includes: taking 2 mg of the exosome-specific affinity enrichment nanomagnetic beads and dispersing them in 48 μL of PBS buffer, adding the biological material to be enriched, shaking and incubating at room temperature for 20 minutes, and then performing magnetic separation, discarding the supernatant, and washing with PBS buffer for 3 times to complete the specific adsorption of exosomes.