Genetically modified cells

Abstract

The present invention relates to modified animal cells having genetic modifications in one or more genes associated with genome monitoring, cell cycle control and / or cell death control, and methods of making modified animal cells. The animal cells are selected from animal species suitable for human or animal consumption. The animal cells typically have a genetic modification in the RB1, TP53 or RAS gene.

Description

Technical Field

[0001] The present invention relates to immortalized primary non-human animal cells for cultured meat for human or animal consumption and methods of making such cells. Background Art

[0002] In the next 50 years, the world population will increase to nearly 10 billion people. Therefore, by 2050, there will be an additional nearly 2 billion people to feed. Population growth, combined with the increasing demand for meat in many countries, will increase global meat demand by about 73% by 2050. In order to meet this demand, the agricultural industry will have to expand production, possibly doubling in size. Currently, 39% of the planet's habitable land is used to produce feed to raise the livestock needed for the meat industry. It takes 3 years to raise a cow for slaughter, and 6-12 months to raise pigs and poultry. Therefore, large areas of arable land are needed to raise these animals. Currently, 80 billion animals are slaughtered for meat every year, with 1.2 billion animals slaughtered in the UK alone.

[0003] Cultured meat has the potential to address major global issues related to the environmental impacts of livestock farming and meat production, as well as animal welfare, food safety and human health. Cultured meat is meat produced from in vitro cell cultures of animal cells. It is a form of cellular agriculture, an agricultural method explored against the backdrop of increasing consumer demand for protein. Cellular agriculture involves the production of animal-derived foods from cell cultures.

[0004] Cultured meat is produced using tissue engineering techniques that have traditionally been used in regenerative medicine and require cell lines, typically stem cells. Stem cells are undifferentiated cells that have the potential to become many or all of the desired specialized cell types. While pluripotent stem cells are often considered the ideal starting cell, the most prominent example of this stem cell subclass is the embryonic stem cell, whose use in research is controversial due to ethical issues. As a result, induced pluripotent stem cells (iPSCs) have been developed. iPSCs are multipotent blood and skin cells that have been artificially regressed to a pluripotent state, allowing them to differentiate into a wider range of cells. Alternatives to iPSCs involve the use of multipotent adult stem cells that give rise to the muscle cell lineage or unipotent progenitor cells that can differentiate into muscle cells. The favorable properties of stem cells that make them suitable for cultured meat production include immortality, enhanced proliferation capacity, independence from adhesion, serum independence, and easy differentiation into tissues.

[0005] Stem cells used to generate cell lines can be collected from primary sources, i.e., by biopsy on animals under local anesthesia, and can also be established from secondary sources (e.g., cryopreserved cultures). However, somatic cells isolated from tissues / organs (e.g., muscle, fat, and fibroblasts) of agriculturally relevant species (e.g., pigs, cattle, chickens) that are often used for food consumption have a limited lifespan when grown in vitro. Although primary cell lines (myoblasts, myofibroblasts, fibroblasts, adipose-derived stem cells, and epithelial cells) can be isolated from pigs, the ability to propagate these cell lines with efficient doubling times and long-term is not feasible.

[0006] Culture media are essential components of in vitro culture and are responsible for providing macromolecules, nutrients, and growth factors necessary for cell proliferation. Access to growth factors is one of the barriers to an efficient process for preparing cultured meat. Traditionally, access to growth factors involves the use of fetal bovine serum (FBS). FBS is a blood product extracted from fetal cows. In addition to ethical considerations, FBS ensures that cultured meat is not completely animal-free. FBS is also the most expensive ingredient in the process used to prepare cultured meat, costing about $1,000 per liter. In addition, the chemical composition of FBS varies greatly between each animal source, so it cannot be uniformly quantified chemically. FBS is used because it conveniently helps mimic the in vivo muscle development process. The growth factors required for tissue development are mainly provided by the bloodstream of animals, and there is no single fluid other than FBS that can deliver all of these components individually. The current alternative to FBS is to produce each growth factor individually using recombinant protein production technology. In this method, the genes encoding the specific factors are integrated into bacteria that are then fermented. However, this method is particularly expensive due to the increased complexity of the process.

[0007] It has been previously shown that human fibroblasts can be immortalized by introducing the telomerase catalytic subunit (hTERT), a hyperactivated mutant of the H-Ras gene (H-RasG12V), and the large T antigen from simian virus 40 (SV40 LT), which bind and inactivate the cellular proteins p53 (encoded by TP53) and pRB (encoded by RB1) to uncouple the cell cycle (Hahn et al., Nature, Vol. 400, pp. 464-468 ​​(1999)). Others have demonstrated that exogenous introduction of hTERT and hyperactivated H-Ras (or a counterpart, such as N-Ras), in some cases in combination with TP53 inactivation, can immortalize both human fibroblasts and human epithelial cells (Yang et al., Carcinogenesis, Vol. 28, No. 1, January 2007, pp. 174-182; Tooloui et al. Oncogene, Vol. 21, pp. 128-139 (2002)). With respect to cell types relevant to cell agriculture (e.g., muscle progenitor cells), human myoblasts have been immortalized using a combination of exogenous hTERT and mutant cyclin-dependent kinase 4 (CDK4) (Zhu et al., Aging cell, Vol. 6, No. 4, August 2007, pp. 515-523). This work has been extended to agriculturally relevant species, where porcine and bovine fibroblasts have been immortalized by introduction of exogenous TERT, mutant CDK4, and cyclin D1 expression (Donai et al., J Biotechnol. 2014 Apr 20;176: 50-7).

[0008] A common theme among methods for immortalizing cells to make cell lines for cell agriculture is the addition of exogenous TERT. Another commonality is the need to introduce foreign genes (e.g., CDK4, cyclin D1, SV40 LT) into cells to immortalize them. Summary of the invention

[0009] There is a need to establish immortalized cell lines. The present inventors have addressed this need by providing modified animal cells that contain modifications of endogenous genes and do not require expression of exogenous nucleic acid constructs.

[0010] In a first aspect, the invention relates to modified non-human animal cells having a genetic modification in one or more genes associated with genome surveillance, cell cycle control and / or cell death control, and wherein the animal is an animal species suitable for human or animal consumption, optionally for use in agriculture.

[0011] In one embodiment, the modification immortalizes the cell.

[0012] In one embodiment, the animal is selected from pigs, cattle, poultry, sheep, goats, fish, crustaceans or molluscs.

[0013] In one embodiment, the modified cell is a somatic cell.

[0014] In one embodiment, the modified cell is selected from one of the following cell types: myoblasts, fibroblasts, myofibroblasts, adipose-derived stem cells, epithelial cells, mesenchymal stem cells, satellite cells, or hepatocytes.

[0015] In one embodiment, the cell does not express exogenous nucleic acids to manipulate genome surveillance, cell cycle control and / or cell death control pathways.

[0016] In one embodiment, the animal cell has a genetic modification in one or more of the following genes: RB1, TP53 and / or RAS gene.

[0017] In one embodiment, the animal cell has a genetic modification in RB1.

[0018] In one embodiment, the animal cell has a genetic modification in TP53.

[0019] In one embodiment, the animal cell has a genetic modification in the RAS gene.

[0020] In one embodiment, the animal cell has genetic modifications in RB1 and TP53.

[0021] In one embodiment, the animal cell has genetic modifications in the RB1 and RAS genes.

[0022] In one embodiment, the animal cell has genetic modifications in the TP53 and RAS genes.

[0023] In one embodiment, the animal cell has genetic modifications in the RB1, TP53 and RAS genes.

[0024] In one embodiment, the RAS gene is HRAS, NRAS or KRAS.

[0025] In one embodiment, the RAS gene is HRAS.

[0026] In one embodiment, the modification is in the promoter region or coding region of one or more genes, or is a regulatory element that regulates one or more genes.

[0027] In one embodiment, the modification is introduced using targeted genome modification.

[0028] In one embodiment, an endonuclease is used.

[0029] In one embodiment, the endonuclease is selected from TALEN, ZFN or CRISPR / Cas9.

[0030] In one embodiment, wherein the gene is selected from one or both of RB1 and / or TP53, and the modification is a loss-of-function modification.

[0031] In one embodiment, the loss-of-function modification comprises knockout of a gene.

[0032] In one embodiment, the gene is a RAS gene and the modification is a hyperactivation modification, optionally wherein the RAS gene is HRAS, NRAS or KRAS.

[0033] In one embodiment, the hyperactivation modification comprises one or more amino acid substitutions.

[0034] In one embodiment, the one or more amino acid substitutions comprise substitution of glycine at position 12 or 13 or glutamine at position 61 of SEQ ID NO: 46, 47 or 48.

[0035] In one embodiment, the one or more amino acid substitutions comprise substituting glycine at position 12 or 13 of SEQ ID NO: 46, 47 or 48, wherein the one or more amino acids are selected from the list comprising alanine, cysteine, aspartic acid, arginine, serine and valine.

[0036] In one embodiment, the one or more amino acid substitutions comprise substitution of glycine at position 12 or 13 of SEQ ID NO: 46, 47 or 48 with valine.

[0037] In one embodiment, the one or more amino acid substitutions comprise substituting glycine at position 61 of SEQ ID NO: 46, 47 or 48, wherein the one or more amino acids are selected from the list comprising glutamic acid, histidine, lysine, proline and arginine.

[0038] In one embodiment, the one or more amino acid substitutions comprise substitution of glycine at position 12 of SEQ ID NO: 1 with valine.

[0039] In a second aspect, the invention relates to a method for preparing cultured meat or cultured meat products, which comprises culturing the modified animal cells as described herein.

[0040] In one embodiment, the method comprises culturing the modified cells continuously or in batches.

[0041] In one embodiment, the method comprises the step of causing the cells to form a tissue-like structure.

[0042] In one embodiment, the cells are formed into muscle tissue-like structures.

[0043] In another aspect, the present invention relates to a method for producing a modified animal cell as described herein, wherein the method comprises introducing a genetic modification in one or more genes associated with genome surveillance, cell cycle control and / or cell death control, and wherein the animal is an animal suitable for human or animal consumption, optionally for use in agriculture.

[0044] In another aspect, the invention relates to a method for immortalizing animal cells, wherein the method comprises introducing a genetic modification in one or more genes associated with genome surveillance, cell cycle control and / or cell death control, and wherein the animal is an animal suitable for human or animal consumption, optionally for use in agriculture.

[0045] In one embodiment, the genetic modification alters the expression or function of one or more genes associated with genome surveillance, cell cycle control, and / or cell death control.

[0046] In one embodiment, the animal cells are immortalized.

[0047] In one embodiment, the animal is selected from pigs, cattle, poultry, sheep, goats, fish, crustaceans or molluscs.

[0048] In one embodiment, the modified cell is a somatic cell.

[0049] In one embodiment, the modified cell is selected from one of the following cell types: myoblasts, fibroblasts, myofibroblasts, adipose-derived stem cells, epithelial cells, mesenchymal stem cells, satellite cells, or hepatocytes.

[0050] In one embodiment, the cell does not express exogenous nucleic acids to manipulate genome surveillance, cell cycle control, and / or cell death control.

[0051] In one embodiment, the animal cell has a genetic modification in one or more of the following genes: RB1, TP53 and / or RAS gene.

[0052] In one embodiment, the animal cell has a genetic modification in RB1.

[0053] In one embodiment, the animal cell has a genetic modification in TP53.

[0054] In one embodiment, the animal cell has a genetic modification in the RAS gene.

[0055] In one embodiment, the animal cell has genetic modifications in RB1 and TP53.

[0056] In one embodiment, the animal cell has genetic modifications in the RB1 and RAS genes.

[0057] In one embodiment, the animal cell has genetic modifications in the TP53 and RAS genes.

[0058] In one embodiment, the animal cell has genetic modifications in the RB1, TP53 and RAS genes.

[0059] In one embodiment, the RAS gene is HRAS, NRAS or KRAS.

[0060] In one embodiment, the RAS gene is HRAS.

[0061] In one embodiment, the promoter region or the coding region of one or more genes is modified.

[0062] In one embodiment, the modification is introduced using targeted genome modification.

[0063] In one embodiment, an endonuclease is used.

[0064] In one embodiment, the endonuclease is selected from TALEN, ZFN or CRISPR / Cas9.

[0065] In one embodiment, the gene is selected from one or both of RB1 and / or TP53 and the modification is a loss-of-function modification.

[0066] In one embodiment, the loss-of-function modification comprises knockout of a gene.

[0067] In one embodiment, the gene is a RAS gene and the modification is a hyperactivation modification, optionally wherein the RAS gene is HRAS, NRAS or KRAS.

[0068] In one embodiment, the hyperactivation modification comprises one or more amino acid substitutions.

[0069] In one embodiment, the one or more amino acid substitutions comprise substitution of glycine at position 12 or 13 or glutamine at position 61 of SEQ ID NO: 46, 47 or 48.

[0070] In one embodiment, the one or more amino acid substitutions comprise substituting glycine at position 12 or 13 of SEQ ID NO: 46, 47 or 48, wherein the one or more amino acids are selected from the list comprising alanine, cysteine, aspartic acid, arginine, serine and valine.

[0071] In one embodiment, the one or more amino acid substitutions comprise substitution of glycine at position 12 or 13 of SEQ ID NO: 46, 47 or 48 with valine.

[0072] In one embodiment, the one or more amino acid substitutions comprise substituting glycine at position 61 of SEQ ID NO: 46, 47 or 48, wherein the one or more amino acids are selected from the list comprising glutamic acid, histidine, lysine, proline and arginine.

[0073] In one embodiment, the one or more amino acid substitutions comprise substitution of glycine at position 12 of SEQ ID NO: 1 with valine.

[0074] In one embodiment, the one or more amino acid substitutions comprise substitution of glycine at position 12 of SEQ ID NO: 1 with valine.

[0075] In another aspect, the invention relates to cultivating or culturing animal tissue or cultivating or culturing meat products comprising the modified cells as described herein.

[0076] In one embodiment, the culture is a suspension culture.

[0077] In another aspect, the present invention relates to the use of the modified animal cells as described herein for cellular agriculture.

[0078] In another aspect, the present invention relates to a method for preparing an immortalized animal cell line comprising the method as described herein.

[0079] Guide RNA is used in methods of making modified, immortalized cells or immortalized animal cell lines as described herein.

[0080] In another aspect, the present invention relates to a guide RNA comprising any sequence selected from SEQ ID NO. 15, 16, 17, 18.

[0081] In one embodiment, the guide RNA is used in a method of making a modified or immortalized cell as described herein.

[0082] In one embodiment, the modified cell is a modified cell as described herein.

[0083] In another aspect, the invention relates to a kit comprising components of a guide RNA as described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0084] Figures and Tables

[0085] The invention is further described in the following non-limiting figures and tables.

[0086] Figure 1 A is a schematic diagram of key cell cycle regulatory programs, highlighting the contribution of key CRISPR target genes (RB1, TP53, and Ras) to different stages of DNA replication and the regulatory programs for targeted CRISPR-Cas9 gene editing (pRB / E2F, p53, and Ras / MEK / ERK pathways). Figure 1 B is the workflow of CRISPR-Cas9 editing. Single-cell suspensions were incubated with Cas9 and sgRNA ribonucleoprotein complexes followed by nucleofection (Amaxa 4D, Lonza). Successful editing was assessed by amplicon sequencing and trace deconvolution. Extension of replicative capacity was determined by assessing proliferation (cell doublings) and transcriptional changes (qPCR).

[0087] Figure 2 is a table highlighting CRISPR target genes (single, double, and triple editing targets) in 3 isolated primary porcine cell lines IF-p036-A, O, and AD. The lines highlighted in the red box are triple edited cell lines currently being evaluated for their doubling time and immortalization status (relative to unedited controls).

[0088] Figure 3 Are two bar graphs representing the relative efficiency of H-RasG12V, TP53 and RB1 editing in two primary porcine cell lines IF-p036-A and IF-p036-O. Editing % was calculated using ICE analysis (Inference of CRISPR Editing).

[0089] Figure 4 is a bar graph showing efficient multiplex CRISPR editing of primary porcine cell lines. Bars represent the relative efficiency of H-RasG12V, TP53, and RB1 editing in the serum-free cell line IF-p036-AD. Percent editing (%) was calculated using ICE analysis (Inference of CRISPR Editing).

[0090] Figure 5Porcine muscle-derived cell lines edited by CRISPR / cas9 against HrasG12V (- / +), TP53 (- / -), and RB1 (- / -) show growth advantages and reduced dependence on extracellular matrix and growth factors compared to cas9 controls. a) Micrographs of IFp036-A-27-A and IFp036-O-31-A triple-edited CRISPR cell lines and corresponding cas9 controls in P15 cell culture. b) Cumulative number of generations and c) doubling time of parental (IFp036-A / O), CRISPR, and cas9 cell lines. d) Doubling time of IFp036-A-27-A and cas9 cell lines after removal of the extracellular matrix Matrigel, demonstrating retained growth in triple-edited CRISPR lines compared to cas9 controls. e) Doubling times were reduced in IFp036-A-27-A and cas9 cell lines following bFGF removal, however, edited cell lines showed reduced dependency compared to the cas9 control. However, these doubling times were significantly higher than those when cultured with bFGF (inset in d vs. e). Data are presented as mean + / - SD.

[0091] Figure 6 is a graph showing the percentage of porcine cells showing successful editing following nucleofection with RNPs under a range of electroporation and buffer conditions. Successful editing was assessed by amplicon sequencing. The percentage of total editing and gene knockout (KO) was assessed.

[0092] Figure 7 The two figures show, A: the editing percentage of cells when highly efficient sgRNAs identified against RB1, TP53 and H-RAS genes were used in the gene editing process; and B: the gene knockout efficiency (%) in pig cells when performing simultaneous multiple triple gene knockout (KO).

[0093] Figure 8 Figures showing stable gene silencing (KO) of TP53 and RB1 genes and knock-in (KI) of hyperactivated H-Ras in the IVYp036-A cell line. Primary porcine cells were nucleofected with RNPs targeting H-Ras alone or in combination with a single-stranded DNA oligonucleotide donor (ssODN) sequence carrying a G12V substitution. Two independent ssODNs and two different concentrations of Cas9 were evaluated. Sanger sequencing of the targeted loci is shown, followed by trace deconvolution (boxes). Note that for the cell line names in this patent, IVY and IF are interchangeable. Example IVYp036-A = IFp036-A.

[0094] Fig. 9are two graphs showing knock-in of H-RasG12V and KO of TP53 and RB1 in two primary porcine myoblast cell lines (IVYp036-A and -O). * indicates sequencing failure.

[0095] Fig.10 are two graphs showing triple edited myoblasts that display features of immortalization. A: Graph showing fold differences using quantitative RT-PCR demonstrating transcriptional changes in a panel of cell cycle regulatory genes relative to housekeeping genes. B: Graph showing cell proliferation of triple edited cell lines and control cell lines with / without supplementation of basic fibroblast growth factor (FGF2).

[0096] Fig.11 are two graphs showing the knockout (KO) scores of TP53 (red dots) and RB (green dots) and the knockin (KI) scores of HRas (blue dots) in three edited cell pools at days 3, 10, and 17 after CRISPR-mediated gene editing of IF p044 A cell line (left graph) and IF p044 C cell line (right graph). For each gene at the indicated time point, the dots from left to right represent cell pools 1, 2, and 3.

[0097] Fig.12 .Editing efficiency and growth data from a porcine myoblast cell line. Cells were edited using 1 sgRNA targeting P53 (a) and 1 sgRNA targeting RB1 (b) or a combination of both (c). Editing efficiency (knockout) was measured at 2 to 3 time points after editing. For growth assays, cells were seeded into 3 replicate flasks (starting from growth phase 2) and grown adherently on Matrigel-coated flasks (d) or on plastic (e) for 8 generations. Doubling times were compared to a control line (transfected with Cas9 only, no sgRNA; control). As a reference point, P53 is also plotted in panels (d) and (e). - / - / RB1 - / - / HRAS G12V / - 8-passage average doubling time of cell lines.

[0098] Fig.13 Editing efficiency and growth data of porcine adipose-derived stem cell (ADSC) cell lines using one sgRNA targeting P53 (a) and one sgRNA targeting RB1 (b) or a combination of both (c) or with HRAS G12VKnock-in (d) as triple editing edited cells. Editing efficiency was measured at 3 time points after editing (knock-out of P53 and RB1; knock-in of HRAS). For growth assays, cells were seeded into 3 replicate flasks and grown adherently on plastic for 5-8 generations. The cumulative number of generations was compared to the control line (transfected with Cas9 only, no sgRNA; control). The number of generations for porcine ADSC single editing is shown in panel (e), the number of generations for porcine ADSC dual editing is shown in panel (f), and the number of generations for porcine ADSC triple editing is shown in panel (g).

[0099] Fig.14 Editing efficiency and growth data from Angus cattle variant (breed) myoblast cell lines. Cells were edited using 1 of 3 sgRNAs targeting bovine P53 (a), 1 of 3 sgRNAs targeting bovine RB1 (b), or 1 of 3 sgRNAs targeting bovine HRAS (c), or using the combination of bP53 sgRNA1 and bRB1 sgRNA1 (d), or using bP53sgRNA3 / bRB1 sgRNA3 / HRAS sgRNA3 (e) as triple editors. Editing efficiency was measured at 3 time points after editing (knockout of P53 and RB1; knockin of HRAS). For growth assays, cells were seeded into triplicate flasks and grown adherently on Matrigel (f) or plastic (g) for 6 generations where possible. Cumulative number of generations was compared to control lines (transfected with Cas9 only, no sgRNA; control).

[0100] Fig.15 Editing efficiency of an Angus cattle breed adipose-derived stem cell (ADSC) cell line. Cells were edited using a combination of bP53 sgRNA3 and bRB1 sgRNA2. Editing efficiency (knockout) was measured at 2 time points after editing.

[0101] Fig.16 Editing efficiency and growth data from Wagyu variant myoblast cell lines. Cells were edited with 1 sgRNA targeting P53 (a) and 1 sgRNA targeting RB1 (b) or a combination of both (c). Editing efficiency (knockout) was measured at 3 time points after editing. For growth assays, cells were seeded into triplicate flasks and grown adherently on Matrigel-coated flasks or on plastic (d) for 5 generations. Doubling times were compared to a control line (transfected with Cas9 alone, no sgRNA; control).

[0102] Fig.17Editing efficiency of Wagyu variant adipose-derived stem cell (ADSC) cell lines. Cells were edited using one sgRNA targeting P53 (a) and one sgRNA targeting RB1 (b) or a combination of both (c). Editing efficiency (knockout) was measured at three time points after editing.

[0103] Fig.18 Editing efficiency in a chicken myoblast cell line. Cells were edited using either 1 sgRNA targeting P53 (a) or 1 of 3 sgRNAs targeting RB1 (b). Editing efficiency (knockout) was measured at 3 time points after editing.

[0104] Table 1. Cell lines and specific growth conditions.

[0105] Table 2. CRISPR guide RNA sequences.

[0106] Table 3. PCR primers.

[0107] Table 4. Total editing and proportion of knockout (KO) across a range of nucleofection conditions. Editing was assessed using the ICE tool to infer CRISPR editing from Sanger sequencing traces (Conant et al., 2022). The R2 coefficient shows the goodness of fit of the ICE model and therefore its reliability for predicting editing outcomes across datasets.

[0108] Table 5. Targeted genes and sequences of guide RNAs used with the S. pyogenes Cas9 protein.

[0109] Table 6. Template sequences of porcine and bovine HRAS with the G12V mutation created by addition of ssODN homology template (IDT Technologies).

[0110] Table 7. Sequences of nucleic acids. These porcine sequences comprise target sequences according to the invention and illustrate the genetic modification.

[0111] Table 8. H-RAS, N-RAS and K-RAS amino acid sequences (porcine). DETAILED DESCRIPTION DETAILED DESCRIPTION OF THE INVENTION

[0113] Now will further describe the various aspects of the present invention. In the following paragraphs, the different aspects are described. Unless there is a clear indication to the contrary, each aspect so defined can be combined with any other one or more aspects.

[0114] Generally, the terms and techniques related to cell and tissue culture, pathology, oncology, molecular biology, immunology, microbiology, genetics, protein and nucleic acid chemistry, and hybridization described herein are those well known and commonly used in the art. Unless otherwise indicated, the methods and techniques of the present disclosure are generally performed according to conventional methods well known in the art and as described in various general and more specific references cited and discussed in this specification. See, for example, Green and Sambrook et al., Molecular Cloning: A Laboratory Manual, Fourth Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012).

[0115] Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. Nomenclatures relating to, and laboratory procedures and techniques of, cell biology and cell culture, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques are used for any cell culture, genetic targeting, chemical synthesis, chemical analysis, and delivery.

[0116] Somatic cells isolated from tissues / organs (e.g., muscle, fat, fibroblasts) of animal species that are commonly consumed for food (e.g., pigs, cattle, chickens) for human or animal consumption have a finite lifespan when grown in vitro (outside the original animal). By manipulating key regulatory genetic pathways in these cells, we have been able to immortalize a range of agriculturally relevant cell types (e.g., muscle, fat, fibroblasts), which allows us to use these cells in cellular agriculture (where cells must proliferate for supraphysiological time periods or indefinitely). We have achieved this by modulating key molecular pathways involved in genome surveillance, cell cycle, and cell death control (e.g., TP53, H-Ras, and / or pRB pathways). We have shown that this can be accomplished by modulating endogenous genes. We have shown that alterations in the regulation / expression of endogenous genes (e.g., TP53, RB1, and / or H-Ras) are necessary and sufficient for immortalization of a range of agriculturally relevant cell types for human or animal consumption.

[0117] Modified cells and methods

[0118] In a first aspect, the present invention relates to isolated modified non-human animal cells, cell populations or cell cultures having genetic modifications in one or more genes associated with genome surveillance, cell cycle control and / or cell death control. In a preferred embodiment, the animal is an animal species suitable for human or animal consumption, such as, but not limited to, an agriculturally relevant animal species.

[0119] As used herein, the words "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" are intended to include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), naturally occurring, mutated, synthetic DNA or RNA molecules, and analogs of DNA or RNA generated using nucleotide analogs. It can be single-stranded or double-stranded. Such nucleic acids or polynucleotides include, but are not limited to, coding sequences of structural genes, antisense sequences, and non-coding regulatory sequences that do not encode mRNA or protein products. These terms also cover genes. The terms "gene", "allele" or "gene sequence" are widely used to refer to DNA nucleic acids associated with biological functions. Therefore, a gene can include introns and exons in a genomic sequence, or can only include coding sequences as in cDNA, and / or can include a combination of cDNA and regulatory sequences. Therefore, according to various aspects of the present invention, genomic DNA, cDNA or coding DNA can be used. In one aspect, the nucleic acid is cDNA or coding DNA. The terms "peptide", "polypeptide" and "protein" are used interchangeably herein and refer to amino acids in the form of a polymer of any length linked together by peptide bonds. The term "allele" refers to any of one or more alternative forms of a gene at a specific locus. Heterozygous alleles are two different alleles at the same locus. Homozygous alleles are two identical alleles at a specific locus. Wild-type (wt) alleles are naturally occurring alleles that have no modification at the locus of interest.

[0120] According to the present invention, one or more endogenous genes associated with genome monitoring, cell cycle control and / or cell death control are targeted to introduce genetic modifications. Suitable target genes in these pathways are listed below and include RB1, TP53 and / or RAS gene family members, such as HRAS, NRAS or KRAS. PTEN can also be targeted. Non-limiting example nucleic acid sequences from pigs and modifications therein are provided in the Examples and Table 5.

[0121] According to various aspects of the present invention, the modification may be in the promoter region or in the coding region of the targeted gene or genes. Thus, the cell is genetically manipulated / modified. Preferably, the mutation is not naturally occurring.

[0122] The inventors have demonstrated that manipulation of endogenous one or more genes in target non-human animal cells can achieve immortalization of cells without expressing exogenous nucleic acids / proteins, so that they can be used in cell agriculture. In one embodiment, the modified cell does not express an exogenous nucleic acid construct, i.e., an exogenous nucleic acid construct. In particular, in another embodiment, the modified cell does not express an exogenous nucleic acid construct, i.e., an exogenous nucleic acid construct, to manipulate the expression or activity of components of genome surveillance, cell cycle control and / or cell death control pathways. In particular, in another embodiment, the modified cell does not express an exogenous telomerase catalytic subunit (TERT). In particular, in another embodiment, the modified cell does not express an exogenous simian virus 40 (SV40) early region gene, exogenous TERT, exogenous mutant CDK4 and / or exogenous cyclin D1. Similarly, the methods of the present invention do not include transfecting cells with plasmids or constructs expressing exogenous simian virus 40 (SV40) early region genes, exogenous TERT, exogenous mutant CDK4, and / or exogenous cyclin D1.

[0123] In one embodiment of aspects of the present invention, the modified cell is a primary cell. In another embodiment of aspects of the present invention, the modified cell is a somatic cell. Any somatic cell suitable for use in cell agriculture is within the scope of the present invention, and the cell agriculture is the production of animal-derived food from cell culture. For example, the cell can be a fat or muscle cell. For example, the cell can be selected from one or more of the following cell types: myoblasts, fibroblasts, myofibroblasts, adipose-derived stem cells, epithelial cells, mesenchymal stem cells, satellite cells or hepatocytes.

[0124] The terms "animal" and "non-human animal" with respect to animals and cells derived therefrom are used interchangeably herein and refer only to cells of non-human animals. The cells used in the present invention may be of any other animal origin. However, the cells are not human cells. Cells suitable for use in cellular agriculture are preferably non-human animal cells that provide any dietary protein, fat and / or carbohydrate source.

[0125] The cell is a cell of a non-human animal suitable for human or animal consumption. These include animals, such as non-human mammals, birds, fish, crustaceans, molluscs, reptiles, amphibians or insects. Exemplary non-human mammals include those in the following genera: Bovine, Camelidae, Canidae, Caprae, Cervidae, Felidae, Equine, Lagomorpha, Marmosetae, Oves, Rodentia or Suidae. The cell can be a cell of any livestock or poultry. The cell can be a cell of pig, bovine (e.g., cattle (cattle)), sheep, goat, bird (avine) or fish. The cell can be a cell of shrimp, prawn, crab, crayfish and / or lobster. In one embodiment, the animal is a pig or bovine (e.g., cattle (cattle)).

[0126] The animals used in various aspects of the present invention can be animal species used in agriculture. The animal species used are animals raised for humans. Such animals are listed above. In preferred embodiments, they include pigs, bovines (e.g., cattle), poultry (e.g., chickens, turkeys, ducks, geese), sheep, goats, fish, crustaceans or molluscs.

[0127] The genetic modification is in one or more genes related to genome surveillance, cell cycle control and / or cell death control. The cell cycle of a cell is a series of growth and development steps that a cell undergoes from the formation of a new daughter cell through the division of a mother cell to the division to generate two new daughter cells. The cell cycle is formed by a number of different phases, each phase having a number of steps that must be completed before entering the next phase of the cell cycle. The phases of the cell cycle are G1 phase, S phase, G2 phase and mitosis (M), such as Figure 1 As shown. In order to prevent uncontrolled cell division, there are cell cycle checkpoints between cell cycle phases, which ensure that the relevant steps of a particular cell cycle phase have been completed. If certain steps have not been completed or the protein controlling the cell cycle checkpoint receives a signal to stop the cell cycle from progressing, the cell will not enter the next phase of the cell cycle. In an embodiment, the present invention provides a method by which the protein responsible for the cell cycle checkpoint is modified so that the cell can continue to enter the next phase of the cell cycle, thereby reducing the doubling time of the modified cell.

[0128] The doubling time of a cell line is the average time it takes for a population of cells to double in size due to cell cycle progression and subsequent division. Therefore, removing cell cycle checkpoint inhibition of the cell cycle reduces the time it takes for one cell to undergo mitosis and form two new daughter cells. When applied to the entire population of cells of the cell line, this modification reduces the doubling time of the cell line and means that the cells expand rapidly and are more suitable for use in cellular agriculture.

[0129] Immortalized cell lines are cells that have been manipulated to proliferate indefinitely and can therefore be cultured for extended periods of time.

[0130] The modified cells of various aspects of the invention are capable of proliferating longer than wild-type cells, and therefore can be cultured for long periods of time (longer than wild-type), e.g., at least 60 doublings. They have the ability to proliferate a large number of doublings in culture. In one embodiment, the modified cells are immortalized and are capable of indefinite proliferation.

[0131] In one embodiment, the one or more genes are selected from one or more of RB1, TP53 and / or RAS gene family members (e.g., HRAS). In further related embodiments, the one or more genes are RB1. In another embodiment, the one or more genes are TP53. In another embodiment, the one or more genes are RAS genes, such as HRAS. In another embodiment, the one or more genes are RB1 and TP53. In another embodiment, the one or more genes are RB1 and RAS genes, such as HRAS. In another embodiment, the one or more genes are TP53 and RAS, such as HRAS. In another embodiment, the one or more genes are RB1 and TP53 and RAS genes, such as HRAS.

[0132] The term TP53 refers to the gene for the protein TP53.

[0133] In one embodiment of various aspects of the invention, the RAS gene is HRAS, NRAS or KRAS.

[0134] The term "genetic modification" refers to a modification that changes the expression of a targeted gene or the functional activity of a gene product, i.e., a gene associated with genome monitoring, cell cycle control, and / or cell death control. The genetic modification can result in loss of function, such as by producing a knockout. In another embodiment, the modification can be a hyperactivation modification that increases the activity of the expressed protein. In order to produce a loss of function / knockout, a mutation can be introduced into the coding sequence, which causes the expressed protein to lose function (e.g., amino acid substitution, deletion, or addition / insertion) or produces premature termination codons / prevents the expression of functional proteins. In order to produce a hyperactivation modification, a mutation can be introduced into the coding sequence, which causes an amino acid substitution, deletion, or addition in the protein sequence, which causes the protein to be hyperactivated.

[0135] Alternatively, the promoter sequence of a gene can be targeted to down-regulate or up-regulate expression.

[0136] In one embodiment, the modification in RB1 is a loss-of-function mutation.In one embodiment, the modification in TP53 is a loss-of-function mutation.

[0137] In another embodiment of the invention, the gene is selected from one or both of RB1 and / or TP53, and the modification is a loss-of-function modification. In a related embodiment, the loss-of-function modification comprises knockout of a gene.

[0138] Examples of loss-of-function mutations are described herein. However, any mutation that results in a dominant loss of function as described herein is encompassed within the scope of the present invention. As used herein, "dominant" also encompasses "semi-dominant" or "partially dominant". Thus, the mutant allele can be fully dominant, partially dominant or semi-dominant. Preferably, the mutant allele is fully dominant. Loss-of-function mutations include knockout modifications or any other modifications that cause amino acid substitutions or changes, wherein the substitutions or changes result in the resulting protein lacking a specific function or causing a reduction in the activity of the protein or preventing the expression of the protein.

[0139] Knockout modifications or mutations can at least partially eliminate specific endogenous nucleic acid sequences from the genomic DNA of the cell encoding the protein of interest. By eliminating the corresponding nucleic acid sequence, the protein can no longer be synthesized by the cellular machinery.

[0140] In another embodiment of the present invention, the gene is RAS, and the modification is a hyperactivation modification. The RAS gene may be selected from any one of HRAS, NRAS or KRAS. In a related embodiment of the present invention, the hyperactivation modification comprises one or more amino acid replacements in the protein. In another related embodiment, the one or more amino acid replacements include replacement of glycine at position 12 of SEQ ID NO:46, 47 or 48. In one embodiment, the one or more amino acid replacements include replacement of glycine at position 12 of SEQ ID NO:46, 47 or 48, wherein the one or more amino acids are selected from a list comprising alanine, cysteine, aspartic acid, arginine, serine and valine. In one embodiment, the one or more amino acid replacements include replacement of glycine at position 12 of SEQ ID NO:46, 47 or 48, wherein the one or more amino acids are selected from a list consisting of alanine, cysteine, aspartic acid, arginine, serine and valine. In one embodiment, the one or more amino acid replacements include replacement of glycine at position 12 of SEQ ID NO:46, 47 or 48 with valine. In one embodiment, the one or more amino acid substitutions include substitution of glycine at position 13 of SEQ ID NO:46, 47 or 48. In one embodiment, the one or more amino acid substitutions include substitution of glycine at position 13 of SEQ ID NO:46, 47 or 48, wherein the one or more amino acids are selected from a list comprising alanine, cysteine, aspartic acid, arginine, serine and valine. In one embodiment, the one or more amino acid substitutions include substitution of glycine at position 13 of SEQ ID NO:46, 47 or 48, wherein the one or more amino acids are selected from a list consisting of alanine, cysteine, aspartic acid, arginine, serine and valine. In one embodiment, the one or more amino acid substitutions include substitution of glycine at position 13 of SEQ ID NO:46, 47 or 48 with valine. In one embodiment, the one or more amino acid substitutions include substitution of glutamine at position 61 of SEQ ID NO:46, 47 or 48. In one embodiment, the one or more amino acid substitutions comprise substitution of a glycine at position 61 of SEQ ID NO: 46, 47 or 48, wherein the one or more amino acids are selected from a list comprising glutamic acid, histidine, lysine, proline and arginine. In one embodiment, the one or more amino acid substitutions comprise substitution of a glycine at position 61 of SEQ ID NO: 46, 47 or 48, wherein the one or more amino acids are selected from a list consisting of glutamic acid, histidine, lysine, proline and arginine.In yet another related embodiment, the one or more amino acid substitutions comprise substitution of the glycine at position 12 of SEQ ID NO: 1 with valine.

[0141] A hyperactivation modification or mutation is a mutation or modification of the genomic DNA encoding a specific target protein, so that the resulting protein has increased activity when synthesized by the cellular machinery. Increased activity refers to any activity that is higher than the normal activity of the protein when the protein is activated or the inhibition of the protein is removed. The activity of the protein can be measured in any manner that is readily understood by the technician. One such measurement is the turnover rate of the protein. Another method is to measure the production rate of the reaction catalyzed by the protein. Hyperactivation mutations do not necessarily increase protein activity to a level higher than normal activity. Hyperactivation mutations can also remove any constitutive inhibition and / or inhibition of the protein caused by binding to a second protein and / or protein complex, so that a protein that is not normally constitutively active is constitutively active.

[0142] Amino acid substitution is achieved by changes in the nucleic acid sequence, which results in the production of different amino acids at a given site. The modification may affect the functional properties and / or activity of the encoded polypeptide, or may not affect the functional properties of the encoded polypeptide (conservative substitution). Conservative substitutions are well known in the art. For example, the codon for the amino acid alanine (a hydrophobic amino acid) may be replaced by a codon encoding another less hydrophobic residue (e.g., glycine) or a more hydrophobic residue (e.g., valine, leucine, or isoleucine). Similarly, changes that result in the replacement of a negatively charged residue with another (e.g., replacement of glutamic acid with aspartic acid) or replacement of a positively charged residue with another (e.g., replacement of arginine with lysine) may also be expected to produce functionally equivalent products. Nucleotide changes that result in changes in the N-terminal and C-terminal portions of the polypeptide molecule will also not be expected to change the activity of the polypeptide. Each of the proposed modifications is within the routine skill of the art, as is the retention of the biological activity of the encoded product. Non-conservative substitutions result in an encoded protein that does not retain the same functional properties and / or activity of the unmodified protein.

[0143] Suitable sequences from genes in pigs (Sus scrofa domesticus) are described in Table 5. Thus, the modified cell may be a pig cell and the targeted gene is selected from RB1, TP53 and / or HRAS. For example, exon 8 of RB1 may be targeted (SEQ ID NO.4). The modified exon may be as shown in SEQ ID No.5 and / or 6. The wild-type sequence of HRAS is shown in SEQ ID No.1. The modified cell may comprise a modification in HRAS, which is shown in SEQ ID No.2 and / or 3. The mutation in HRAS may comprise Gly>Val (aa12) [GGA>GTA] and optionally a PAM blocking mutation Gly>Val (aa15) [GGG>GtG]. The wild-type sequence of exon 5 of TP53 is shown in SEQ ID No.10. The modified cell may comprise a modification in HRAS, which is shown in SEQ ID No.11 and / or 12. Alternative genes for HRAS are NRAS and KRAS.

[0144] The sequences in Table 5 are from pigs. However, the present invention is not limited to modified pig cells. The skilled person will know that for the manipulation of other animal cells from animal species suitable for human or animal consumption (e.g., suitable for human consumption, e.g., suitable for animal consumption) (e.g., used in agriculture, e.g., as listed herein), equivalent orthologs (i.e., endogenous RB1, TP53 and / or HRAS genes specific to the targeted non-human animal species) will be genetically modified. Suitable gene sequences can be identified from public databases. The skilled person will also be able to identify suitable sequences using standard methods in the art to identify homologs and orthologs, e.g., based on sequence identity to pig sequences.

[0145] Sequence identity is usually defined with reference to the algorithm GAP (Wisconsin GCG software package, Accelerys Inc, San Diego, USA). GAP uses the Needleman and Wunsch algorithm to align two complete sequences, maximizing the number of matches and minimizing the number of gaps. Default parameters are usually used, with a gap creation penalty equal to 12 and a gap extension penalty equal to 4. The use of GAP may be preferred, but other algorithms such as BLAST, or the Smith-Watherman algorithm, or the TBLASTN program may be used, which usually use default parameters. In particular, the psi-Blast algorithm may be used. Sequence identity may be defined using the Bioedit, ClustalW algorithm. Alignment may be performed using Snapgene and based on the MUSCLE (Multiple Sequence Comparison by Log-Expectation) algorithm.

[0146] In one embodiment, the modification is introduced using targeted genomic modification and / or rare-cutting endonucleases (e.g., TALENs, ZFNs, or CRISPR / Cas9). However, other alternative endonucleases will be known to those skilled in the art.

[0147] Genome editing technologies have emerged as an alternative to conventional mutagenesis methods (such as physical and chemical mutagenesis) or methods using transgene expression in animal cells to prepare mutant animal cells with improved phenotypes that are important in cell research and cell agriculture. These technologies employ sequence-specific nucleases (SSNs), including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided nuclease Cas9 (CRISPR / Cas9), which generate targeted DNA double-strand breaks (DSBs), which are then repaired primarily by error-prone nonhomologous end joining (NHEJ) or high-fidelity homologous recombination (HR).

[0148] As explained in detail below, targeted genome modification based on such editing techniques can be used to introduce mutations according to various aspects of the present invention into animal cells.

[0149] On the other hand, the invention also relates to methods for modifying the expression or function of one or more genes in non-human animals, wherein the genes are associated with genome monitoring, cell cycle control and / or cell death control. In preferred embodiments, the animal is an animal suitable for human or animal consumption, such as for use in agriculture. In embodiments, the method comprises introducing a mutation into one or more genes in an animal cell.

[0150] On the other hand, the present invention relates to a method for preparing a modified non-human animal cell as described herein, wherein the method comprises introducing a genetic modification in one or more genes associated with genome monitoring, cell cycle control and / or cell death control. In a preferred embodiment, the animal is an animal used in agriculture. Suitable genes are as described above. Embodiments defining various combinations (e.g., manipulation of all three genes, modifications performed and cell types) are specifically listed elsewhere herein and are applied to this aspect. The method is performed in vitro or ex vivo.

[0151] On the other hand, the present invention relates to a method for immortalizing animal cells, wherein the method includes introducing genetic modifications in one or more genes associated with genome monitoring, cell cycle control and / or cell death control, and wherein the animal is suitable for human or animal consumption, such as animals used in agriculture. Suitable genes, animals and cells are as described above. Embodiments defining various combinations (such as the manipulation of all three genes, the modifications performed and cell types) are specifically listed elsewhere herein and applied to this aspect. The method may include further steps of culturing cells and proliferating cells in a suitable culture medium. The method may include further steps of establishing a cell line. For example, muscle cells can grow into muscle tissue in culture, and the muscle tissue is attached to a supporting structure, such as a two-dimensional or three-dimensional scaffold or supporting structure. The immortalized animal cells obtained by the method are also within the scope of the present invention. The method is carried out in vitro or ex vivo.

[0152] In yet another aspect, the invention provides modified animal cells having genetic modifications in one or more genes selected from RB1, TP53 and / or genes in the RAS family (e.g., H-RAS). Embodiments defining various combinations (e.g., manipulation of all three genes, modifications performed, and cell types) are specifically listed elsewhere herein and apply to this aspect.

[0153] In all aspects of the invention, the animal is not a human. Animals that can be used are listed herein, particularly agriculturally relevant animals.

[0154] Targeted genome modification of animal cells using gene editing

[0155] Targeted genome modification or targeted genome editing is a genome engineering technology that uses targeted DNA double-strand breaks (DSBs) to facilitate genome editing through homologous recombination (HR)-mediated recombination events. To achieve efficient genome editing by introducing site-specific DNA DSBs, four major classes of customizable DNA-binding proteins can be used: meganucleases derived from microbial mobile genetic elements, ZF nucleases based on eukaryotic transcription factors, rare-cutting endonucleases / sequence-specific endonucleases (SSNs) such as TALENs, transcription activator-like effectors (TALEs) from Xanthomonas bacteria, and RNA-guided DNA endonucleases Cas9 from the type II bacterial adaptive immune system CRISPR (clustered regularly interspaced short palindromic repeats). Meganucleases, ZFs, and TALE proteins all recognize specific DNA sequences through protein-DNA interactions. While meganucleases integrate their nuclease and DNA-binding domains, ZF and TALE proteins consist of separate modules of 3 or 1 nucleotide (nt) targeting DNA, respectively. ZFs and TALEs can be assembled in desired combinations and attached to the nuclease domain of Fok1 to direct nucleolytic activity to specific genomic loci.

[0156] After delivery into host cells via the bacterial type III secretion system, TAL effectors enter the nucleus, bind to effector-specific sequences in the host gene promoter and activate transcription. Their targeting specificity is determined by a central domain of 33-35 amino acid repeats in tandem. This is followed by a single truncated repeat of 20 amino acids. Most naturally occurring TAL effectors examined have 12 to 27 complete repeats.

[0157] These repeats differ only in two adjacent amino acids, their repeat variable diresidues (RVDs). The RVD determines which single nucleotide the TAL effector will recognize: one RVD corresponds to one nucleotide, with each of the four most common RVDs preferentially associating with one of the four bases. The naturally occurring recognition sites are all preceded by a T required for TAL effector activity. TAL effectors can be fused to the catalytic domain of Fokl nuclease to generate TAL effector nucleases (TALENs), which generate targeted DNA double-strand breaks (DSBs) in vivo for genome editing. The use of this technology in genome editing has been described in detail in the art, for example in U.S. Pat. No. 8,440,431, U.S. Pat. No. 8,440,432, and U.S. Pat. No. 8,450,471. Custom plasmids can be used with the Golden Gate cloning method to assemble multiple DNA fragments. The Golden Gate method uses a type IIS restriction endonuclease that cuts outside of its recognition site to generate a unique 4 bp overhang. Because proper assembly eliminates the enzyme recognition site, cloning is accelerated by digestion and ligating in the same reaction mixture. The assembly of custom TALEN or TAL effector constructs involves two steps: (i) assembly of repeat modules into intermediate arrays of 1–10 repeats and (ii) joining of the intermediate arrays into the backbone to make the final construct.

[0158] Another genome editing method that can be used according to various aspects of the present invention is CRISPR. The application of this technology in genome editing has been described in detail in the art, for example in U.S. Patent 8,697,359. In short, CRISPR is a microbial nuclease system involved in defending against phage and plasmid invasion. The CRISPR locus in the microbial host contains a combination of CRISPR-associated (Cas) genes and specific non-coding RNA elements capable of programming CRISPR-mediated nucleic acid cleavage. Three types (I-III) of CRISPR systems have been identified in a wide range of bacterial hosts. A key feature of each CRISPR locus is the presence of an array of repeat sequences (direct repeat sequences) spaced apart by short segments of non-repetitive sequences (spacers). The non-coding CRISPR array is transcribed and cut into short crRNAs containing separate spacer sequences within the direct repeat sequence, which guide the Cas nuclease to the target site (protospacer).

[0159] "crRNA" or CRISPR RNA refers to an RNA sequence containing a protospacer element and additional nucleotides that are complementary to tracrRNA. "tracrRNA" (trans-activating RNA) refers to an RNA sequence that hybridizes with crRNA and binds to a CRISPR enzyme (e.g., Cas9), thereby activating the nuclease complex to introduce a double-stranded break at a specific site within the genomic sequence of at least one nucleic acid or promoter sequence of one or more genes. "Protospacer element" refers to the portion of a crRNA (or sgRNA) that is complementary to a genomic DNA target sequence, typically about 20 nucleotides in length. This may also be referred to as a spacer or targeting sequence.

[0160] "sgRNA" (single guide RNA) refers to the combination of tracrRNA and crRNA in a single RNA molecule, preferably also including a linker loop (connecting tracrRNA and crRNA into a single molecule). "sgRNA" may also be referred to as "gRNA", and in this context, these terms are interchangeable. sgRNA or gRNA provides targeting specificity and scaffolding / binding ability for Cas nuclease. gRNA may refer to a dual RNA molecule comprising a crRNA molecule and a tracrRNA molecule.

[0161] Type II CRISPR is one of the best characterized systems and targets DNA double-strand breaks in four sequential steps. First, two non-coding RNAs, the pre-crRNA array and the tracrRNA, are transcribed from the CRISPR locus. Second, the tracrRNA hybridizes to the repeat region of the precrRNA, and the tracrRNA mediates the processing of the pre-crRNA into mature crRNAs containing separate spacer sequences. Third, the mature crRNA:tracrRNA complex guides Cas9 to the target DNA through Watson-Crick base pairing between the spacer on the crRNA and the protospacer on the target DNA next to the adjacent motif (PAM), which is an additional requirement for target identification. Finally, Cas9 mediates the cleavage of the target DNA to generate a double-strand break point within the protospacer. Therefore, Cas9 is the iconic protein of the type II CRISPRCas system and is a large monomeric DNA nuclease that is guided to the DNA target sequence adjacent to the PAM sequence motif by a complex of two non-coding RNAs: CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). The Cas9 protein contains two nuclease domains homologous to RuvC and HNH nucleases. The HNH nuclease domain cleaves the complementary DNA strand, while the RuvC-like domain cleaves the non-complementary strand and, as a result, introduces a blunt cut in the target DNA. Heterologous expression of Cas9 together with a guide RNA (gRNA), also called a single guide RNA (sgRNA), can introduce site-specific double-strand breaks (DSBs) into genomic DNA of living cells from various organisms. For applications in eukaryotes, a codon-optimized version of Cas9 (originally from the bacterium Streptococcus pyogenes) has been used.

[0162] Synthetic CRISPR systems usually consist of two components (gRNA and a non-specific CRISPR-associated endonuclease) and can be used to generate knockout cells or animals by co-expressing a gRNA that is specific to the gene to be targeted and is able to associate with the endonuclease Cas9. It is worth noting that the gRNA is an artificial molecule that contains one domain that interacts with Cas or any other CRISPR effector protein or its variant or catalytically active fragment and another domain that interacts with the target nucleic acid of interest and thus represents a synthetic fusion of crRNA and tracrRNA. The genomic target can be any 20-nucleotide DNA sequence, provided that the target is present directly upstream of the PAM sequence. The PAM sequence is of outstanding importance for target binding, and the exact sequence depends on the species of Cas9.

[0163] The PAM sequence of Cas9 from Streptococcus pyogenes has been described as "NGG" or "NAG" (standard IUPAC nucleotide code) (Jinek et al., "A programmable dualRNAguided DNA endonuclease in adaptivebacterial immunity", Science 2012, 337: 816821). The PAM sequence of Cas9 from Staphylococcus aureus is "NNGRRT" or "NNGRR(N)". Additional variant CRISPR / Cas9 systems are known. Thus, Neisseria meningitidis Cas9 cuts at the PAM sequence NNNNGATT. Streptococcus thermophilus Cas9 cuts at the PAM sequence NNAGAAW. Recently, an additional PAM motif NNNNRYAC has been described for a CRISPR system against Campylobacter (WO 2016 / 021973). For the Cpf1 nuclease, it is described that the Cpf1-crRNA complex can effectively recognize and cut the target DNA after a short T-rich PAM in the absence of tracrRNA, which is different from the common G-rich PAM recognized by the Cas9 system. In addition, by using modified CRISPR polypeptides, specific single-strand breaks can be obtained. The combined use of Cas nickases with various recombinant gRNAs can also induce highly specific DNA double-strand breaks by double DNA nicking. In addition, by using two gRNAs, the specificity of DNA binding and thus DNA cutting can be optimized. Additional CRISPR effectors (such as the CasX and CasY effectors originally described for bacteria) are simultaneously available and represent additional effectors that can be used for genome engineering purposes (Burstein et al., "New CRISPRCas systems from uncultivated microbes", Nature, 2017, 542, 237241).

[0164] Once expressed, the Cas9 protein and gRNA form a ribonucleoprotein complex through interactions between the gRNA "scaffold" domain and a surface-exposed, positively charged groove on Cas9. Cas9 undergoes a conformational change upon gRNA binding that transforms the molecule from an inactive, non-DNA-binding conformation to an active, DNA-binding conformation. Importantly, the "spacer" sequence of the gRNA remains free to interact with the target DNA. The Cas9-gRNA complex will bind any genomic sequence bearing a PAM, but the degree to which the gRNA spacer matches the target DNA determines whether Cas9 will cut. Once the Cas9-gRNA complex binds a putative DNA target, a "seed" sequence at the 3' end of the gRNA targeting sequence begins to anneal to the target DNA. If the seed sequence and target DNA sequence match, the gRNA will continue to anneal to the target DNA in the 3' to 5' direction (relative to the polarity of the gRNA).

[0165] CRISPR / Cas9 and likewise CRISPR / Cpf1 as well as other CRISPR systems are highly specific when the gRNA is properly designed, but specificity in particular remains a major concern, especially for clinical uses of CRISPR-based technologies. The specificity of the CRISPR system depends largely on the specificity of the gRNA targeting sequence for the genomic target compared to the rest of the genome. sgRNA is a synthetic RNA chimera created by fusing crRNA to tracrRNA. The sgRNA guide sequence located at its 5' end confers DNA target specificity. Therefore, by modifying the guide sequence, sgRNAs with different target specificities can be created. The standard length of the guide sequence is 20bp.

[0166] Therefore, as used herein, the term "guide RNA" refers to a synthetic fusion of two RNA molecules, crRNA (CRISPR RNA) and tracrRNA, the crRNA comprising a variable targeting domain. In one embodiment, the guide RNA comprises a variable targeting domain having a 12 to 30 nucleotide sequence and an RNA fragment that can interact with a Cas endonuclease.

[0167] sgRNA suitable for the method of the present invention is described as follows. As used herein, the term "guide polynucleotide" refers to a polynucleotide sequence that can form a complex with a Cas endonuclease and enable the Cas endonuclease to recognize and optionally cut a DNA target site. The guide polynucleotide can be a single molecule or a double molecule. The guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence). Optionally, the guide polynucleotide can include at least one nucleotide, a phosphodiester bond, or a connection modification, such as, but not limited to, a locked nucleic acid (LNA), 5 methyl dC, 2,6-diaminopurine, 2'-Fluoro A, 2'-Fluoro U, 2'-O-methyl RNA, a phosphorothioate bond, a connection bond to a cholesterol molecule, a connection bond to a polyethylene glycol molecule, a connection bond to a spacer 18 (hexaethylene glycol chain) molecule, or a 5' to 3' covalent bond, resulting in cyclization. Guide polynucleotides containing only ribonucleic acids are also contemplated.

[0168] The terms "target site", "target sequence", "target DNA", "target locus", "genomic target site", "genomic target sequence" and "genomic target locus" are used interchangeably herein and refer to a polynucleotide sequence in the genome of a cell (including chloroplast and mitochondrial DNA) at which a double-strand break in the genome of the cell is induced by a Cas endonuclease. The target site can be an endogenous site in the genome, or alternatively, the target site can be heterologous to the plant and thus not naturally present in the genome, or the target site can be found at a heterologous genomic location (compared to where it occurs naturally). As used herein, the terms "endogenous target sequence" and "native target sequence" are used interchangeably herein and refer to a target sequence that is endogenous or native to the genome and at the endogenous or native location of the target sequence in the genome.

[0169] The length of the target site can vary, and includes, for example, target sites of at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides in length. It is further possible that the target site can be palindromic, i.e., the sequence on one strand is identical to the sequence in the opposite direction of the complementary strand. The nick / cleavage site can be within the target sequence, or the nick / cleavage site can be outside the target sequence. In another variant, the cut can occur at nucleotide positions directly opposite each other to produce a blunt end cut, or in other cases, the cuts can be staggered to produce single-stranded overhangs, also known as "sticky ends," which can be 5' overhangs or 3' overhangs.

[0170] In one embodiment, the Cas endonuclease gene is a Cas9 endonuclease, such as, but not limited to, the Cas9 genes listed in WO2007 / 025097, which is incorporated herein by reference. In another embodiment, the Cas endonuclease gene is an animal-optimized Cas9 endonuclease.

[0171] In one embodiment, the Cas endonuclease gene is an animal codon-optimized Streptococcus pyogenes Cas9 gene, which can recognize any genomic sequence of the form N(12-30)NGG that can in principle be targeted.

[0172] In one embodiment, the Cas endonuclease is directly introduced into the cell by any method known in the art, such as, but not limited to, transient introduction methods, transfection, and / or topical administration.

[0173] The Cas9 expression plasmid used in the method of the present invention can be constructed as described in the art.

[0174] In one embodiment, targeted genome modification according to various aspects of the present invention includes the use of rare cutting endonucleases, such as TALEN, ZFN or CRISPR / Cas; For example, the use of CRISPR / Cas9. Rare cutting endonucleases / sequence-specific endonucleases are natural or engineered proteins with endonuclease activity and are target-specific. These bind to nucleic acid target sequences with recognition sequences that are typically 12-40bp in length. In one embodiment, the SSN is selected from TALEN. In another embodiment, the SSN is selected from CRISPR / Cas9. This is described in more detail below.

[0175] In one embodiment, the step of introducing mutations comprises contacting an animal cell population with a DNA binding protein targeting one or more endogenous RB1 and / or TP53 and / or RAS gene sequences, for example selected from the exemplary sequences listed herein. In one embodiment, the method comprises contacting a cell population with one or more rare-cutting endonucleases (e.g., ZFN, TALEN, or CRISPR / Cas9) targeting one or more endogenous RB1 and / or TP53 and / or RAS gene sequences.

[0176] The method may further comprise the steps of selecting cells from the population in which the RB1 and / or TP53 and / or RAS gene sequences have been modified and regenerating the selected animal cells.

[0177] In an embodiment, the method includes the use of CRISPR / Cas9. In this embodiment, the method therefore includes introducing and co-expressing Cas9 and sgRNA targeting one or more of the RB1 and / or TP53 and / or RAS gene sequences in animal cells, and screening for induced targeted mutations in one or more of the RB1 and / or TP53 and / or RAS nucleic acid genes. The method may also include culturing animal cells and selecting or selecting animal cells with altered cell cycle control phenotypes (e.g., with reduced cell cycle checkpoints or increased cell cycle progression).

[0178] Cas9 and sgRNA can be contained in a single or two expression vectors. The target sequence is one or more of the RB1 and / or TP53 and / or RAS nucleic acid sequences as shown herein.

[0179] In one embodiment, screening for CRISPR-induced targeted mutations in one or more RB1 and / or TP53 and / or RAS genes comprises obtaining a DNA sample from transformed animal cells, and performing DNA amplification and optionally restriction enzyme digestion to detect mutations in one or more RB1 and / or TP53 and / or RAS genes.

[0180] In one embodiment, the restriction enzyme is a mismatch-sensitive T7 endonuclease.T7E1 is an enzyme specific for heteroduplex DNA caused by genome editing.

[0181] The PCR fragments amplified from the transformed animal cells are then evaluated using an assay based on gel electrophoresis assays. In a further step, the presence of the mutation can be confirmed by sequencing one or more RB1 and / or TP53 and / or RAS genes. Genomic DNA (i.e., wt and mutants) can be prepared from each sample, and DNA fragments containing each target site are amplified by PCR. Since the target locus includes a restriction enzyme site, the PCR product is digested with a restriction enzyme. The restriction enzyme site is destroyed by CRISPR- or TALEN-induced mutations through NHEJ or HR, so the mutant amplicon is resistant to restriction endonuclease digestion and results in an uncut band. Alternatively, the PCR product is digested by T7E1 (cleaved DNA produced by the T7E1 enzyme, which is specific for heteroduplex DNA caused by genome editing) and visualized by agarose gel electrophoresis. In a further step, they are sequenced.

[0182] In one embodiment, the method uses a sgRNA (and template, synthetic single-stranded DNA oligonucleotide (ssDNA oligonucleotide) or donor DNA) construct described in detail below to introduce a targeted SNP or mutation, in particular to introduce one of the substitutions described herein into the GRF gene and / or promoter. After sgRNA-mediated shearing (snip) in double-stranded DNA, the introduction of the template DNA strand can be used to generate a specific targeted mutation (i.e., SNP) in the gene using homology-directed repair. Synthetic single-stranded DNA oligonucleotides (ssDNA oligonucleotides) or DNA plasmid donor templates can be used for precise genome modification using homology-directed repair (HDR) pathways. Homologous recombination is the exchange of DNA sequence information by using sequence homology. Homologous directed repair (HDR) is a process of homologous recombination in which a DNA template is used to provide the homology necessary for precise repair of double-strand breaks (DSBs). CRISPR guide RNA programs the Cas9 nuclease to cut genomic DNA at a specific location. Once a double-strand break (DSB) occurs, mammalian cells use endogenous mechanisms to repair the DSB. In the presence of donor DNA (ssDNA oligonucleotide or plasmid donor), HDR can be used to precisely repair DSBs, resulting in the desired genomic alteration (insertion, removal or substitution).

[0183] Single-stranded DNA donor oligonucleotides are delivered into cells to insert or alter short sequences of DNA (SNPs, amino acid substitutions, epitope tags, etc.) in endogenous genomic target regions.

[0184] A "donor sequence" is a nucleic acid sequence containing all the necessary elements to introduce a specific replacement into a target sequence, preferably using homology-directed repair (HDR). In one embodiment, the donor sequence comprises a repair template sequence for introducing at least one SNP. Preferably, the repair template sequence is flanked by at least one sequence identical to the target sequence, preferably by a left arm and a right arm, more preferably by about 100 bp per arm. More preferably, one or more arms are further flanked by two gRNA target sequences comprising a PAM motif so that the donor sequence can be released by Cas9 / gRNA. Donor DNA has been used to enhance homology-directed genome editing (e.g., Richardson et al., Enhancing homology-directed genomeediting by catalytically active and inactive CRISPR-Cas9 using asymmetricdonor DNA, Nature Biotechnology, 2016 Mar; 34 (3): 339-44).

[0185] The above method uses animal cell transformation to introduce expression vectors containing sequence-specific nucleases into animal cells to target GBP1 nucleic acid sequences. The term "introduction" or "transformation" as mentioned herein encompasses the transfer of exogenous polynucleotides into host cells, regardless of the method used for transfer.

[0186] Advantageously, any of several transformation methods can be used to introduce the target gene into suitable cells. The transformation methods described for animal cells can be used for transient or stable transformation. Transformation methods include the use of liposomes, electroporation, chemicals that increase free DNA uptake, direct injection of DNA into animal cells, particle bombardment as described in the examples, transformation using viruses or microinjection. The method can be selected from the calcium / polyethylene glycol method for protoplasts, electroporation of protoplasts, microinjection into animal material, DNA or RNA coated particle bombardment, infection with (non-integrating) viruses, etc.

[0187] After DNA transfer and regeneration, putative transformed animal cells may also be evaluated, for example using Southern analysis, for the presence of the gene of interest, copy number and / or genomic organization. Alternatively or additionally, Northern and / or Western analysis may be used to monitor expression levels of the newly introduced DNA, both of which techniques are well known to those of ordinary skill in the art.

[0188] Sequence-specific nucleases are preferably introduced into animal cells as part of an expression vector. The vector may contain one or more replication systems that allow it to replicate in a host cell. Self-replicating vectors include plasmids, cosmids, and viral vectors. Alternatively, the vector may be an integration vector that allows integration into the chromosomal DNA sequence of a host cell. The vector desirably also has a unique restriction site for inserting a DNA sequence. If the vector does not have a unique restriction site, it may be modified to introduce or eliminate restriction sites to make it more suitable for further manipulation. Vectors suitable for expressing nucleic acids are known to those skilled in the art, and a non-limiting example is pcDNA3.1. The nucleic acid is inserted into the vector so that it is operably connected to a suitable animal-active promoter. Suitable animal-active promoters used with nucleic acids include, but are not limited to PGK, CMV, EF1a, CAG, SV40, and Ubc.

[0189] In an embodiment of the present invention, the promoter region or the coding region of one or more genes is modified.

[0190] Cultured meat products and methods

[0191] As explained previously, the modified cells and methods for preparing immortalized animal cells / processes can be used in cellular agriculture, ie, the production of food of animal origin from cell cultures.

[0192] Therefore, in another aspect, the present invention provides a method for preparing cultured meat / cultured meat products / food products, the cultured meat / cultured meat products / food products comprising culturing cells modified according to any previous embodiment of the present invention. In a related embodiment, the method comprises continuous or batch culturing of modified cells.

[0193] The term "cultivated meat" is used herein to describe meat grown from in vitro animal cell cultures, which is different from meat from slaughtered animals. Other terms that can be used in the art to describe meat grown from in vitro animal cell cultures include cultured meat, cell-grown meat, clean meat, laboratory-grown meat, test tube meat, in vitro meat, test tube steak, synthetic meat, cell-cultured meat, cell-grown meat, tissue-engineered meat, engineered meat, artificial meat, and manmade meat. The phrases "cell-based meat", "slaughter-free cell-based meat", "in vitro prepared meat", "in vitro cell-based meat", "cultured meat", "slaughter-free cultured meat", "cultured meat prepared in vitro", "in vitro meat", "in vitro cultured meat" and other similar such phrases are used interchangeably herein and refer to meat generated in vitro, starting from cells in culture, and the method does not involve animal slaughter in order to obtain meat directly from the animal for dietary consumption. The modified cells of the present invention may be suitable for human and / or non-human consumption. In some embodiments, cell-based meat is suitable for consumption by animals (e.g., domesticated animals). Thus, the cellular biomass herein supports the growth of "pet food" (e.g., dog food, cat food, etc.).

[0194] Batch culture refers to the cultivation of cells in a closed system, whereby the cultivation of cells is carried out within a defined time period or until a defined standard is met. Once the standard or time is met, the cultivation is stopped, the cells are harvested and the system is emptied and cleaned in preparation for a new cultivation. Nutrients and / or culture additives can be added at the beginning of the cultivation or during the cultivation. Continuous culture refers to the cultivation of cells in a system, whereby the cells are continuously removed after a period of growth, or are removed at a specific time point, while the cell colony remains in the system and can continue to grow and divide. The process is repeated with a set time period or indefinitely. Nutrients and / or culture additives are added regularly or continuously so that the cells present in the system always have optimal conditions for growth and division.

[0195] In another embodiment, the invention provides a cultured animal tissue comprising a modified cell according to any of the preceding embodiments of the invention.

[0196] In another aspect, the present invention provides the use of a modified animal cell according to any of the preceding embodiments for use in cellular agriculture.

[0197] In another aspect, the present invention provides a method for preparing an immortalized cell line, the method comprising a method according to any of the preceding aspects of the invention. The cell line may be used in cellular agriculture.

[0198] On the other hand, the present invention provides a method for preparing a cultured meat product, the method comprising culturing one or more modified animal non-human cells or cell lines according to any of the preceding embodiments and optionally forming the cells into a tissue-like structure. In a related embodiment, the method comprises forming the cells into a muscle tissue-like structure. On the other hand, the present invention provides a cultured meat product for human or non-human consumption, comprising a modified cell or cell line of the present invention. In one embodiment, the animal for consumption is selected from pigs, cattle, poultry, sheep, goats, equines, fish, crustaceans or molluscs.

[0199] In a specific embodiment, a cultured meat product refers to a product in which the cells according to the present invention form a product that is acceptable and / or suitable and / or suitable for human consumption. The product may be a structure that simulates or is intended to simulate the tissue of an animal species for human consumption. The cultured meat product may have a tissue-like structure. The tissue may be selected from one or more of the following: muscle, fat, heart, liver, kidney and / or any tissue for human consumption.

[0200] A tissue-like structure according to the present invention is a structure that resembles a specific tissue of an animal in terms of texture, flavor, mouthfeel, visual structure, visual texture and color. The tissue-like structure is not necessarily capable of performing the bodily function that the tissue would perform in vivo. Tissue-like structures are intended to mean tissue-like structures that appear similar or identical to tissue obtained from an animal to a consumer of a cultured meat product.

[0201] The cultured meat product comprises the modified cells according to the invention, but may additionally comprise other components, such as colorants, flavorings and / or flavor enhancing compositions and dietary supplements (such as vitamins and / or minerals).

[0202] Also provided is a packaged cultured meat product comprising or derived from the cells or cell lines of the invention.

[0203] Guide RNA and kits

[0204] In one aspect of the invention, a guide RNA is provided for use in a method of preparing a modified, immortalized cell or immortalized animal cell line as described herein.

[0205] In another aspect, the invention provides a guide RNA comprising any guide RNA selected from SEQ ID NO. 15, 16, 17, 18. In another embodiment, the invention provides a guide RNA according to any previous embodiment of the invention, for use in a method of preparing a modified cell according to any previous embodiment of the invention. In a related embodiment, the invention provides a guide RNA according to a previous embodiment of the invention, wherein the modified cell is a modified cell according to any previous embodiment of the invention.

[0206] In another embodiment, the present invention provides a kit comprising components of a guide RNA as described above.

[0207] As explained above, in some embodiments, the methods of the present invention use gene editing using a specific endonuclease targeting the sequence of one or more genes in the target animal cell. Also as explained, Cas9 and gRNA can be contained in a single or two expression vectors. sgRNA targets one or more gene nucleic acid sequences.

[0208] Therefore, in another aspect of the present invention, a nucleic acid construct is provided comprising a nucleic acid sequence encoding at least one DNA binding domain, which can bind to the one or more genes. The one or more genes comprise any sequence selected from SEQ ID NO. 1, 4, 7, 10 or a functional variant, homologue or orthologue thereof, as explained herein.

[0209] In one embodiment, the nucleic acid sequence encodes at least one protospacer element.

[0210] In one embodiment, the construct further comprises a nucleic acid sequence encoding a CRISPR RNA (crRNA) sequence, wherein the crRNA sequence comprises a protospacer element sequence and additional nucleotides. In one embodiment, the construct further comprises a nucleic acid sequence encoding a trans-activating RNA (tracrRNA).

[0211] In another embodiment, the construct encodes at least one single guide RNA (sgRNA), wherein the sgRNA comprises a tracrRNA sequence and a crRNA sequence, wherein the sgRNA comprises or consists of any sequence selected from SEQ ID 15, 16, 17, 18 listed herein, depending on the species being targeted. The PAM sequence is also shown in the section entitled Sequence Listing. The sgRNA can be used to manipulate animal cells. In another aspect of the present invention, a nucleic acid construct comprising a DNA donor nucleic acid is provided, wherein the DNA donor nucleic acid is operably linked to a regulatory sequence. The regulatory sequence may be one or more of the following: an intron, a promoter, and / or a terminator.

[0212] Cas9 and sgRNA can be combined or in separate expression vectors (or nucleic acid constructs, such terms are used interchangeably). Similarly, Cas9, sgRNA and donor DNA sequences can be combined or in separate expression vectors. In other words, in one embodiment, the isolated animal cells are transfected with a single nucleic acid construct comprising sgRNA and Cas9 or sgRNA, Cas9 and donor DNA sequences as described in detail above. In an alternative embodiment, the isolated animal cells are transfected with two or three nucleic acid constructs: a first nucleic acid construct comprising at least one sgRNA as defined above, a second nucleic acid construct comprising Cas9 or its functional variant or homolog, and an optional third nucleic acid construct comprising a donor DNA sequence as defined above. The second and / or third nucleic acid constructs can be transfected before, after or simultaneously with the first and / or second nucleic acid constructs. The advantage of a separate second construct comprising a Cas protein is that a nucleic acid construct encoding at least one sgRNA can be paired with any type of Cas protein, as described herein, and is therefore not limited to a single Cas function (such as the case where both Cas and sgRNA are encoded on the same nucleic acid construct).

[0213] In one embodiment, the construct as described above is operably linked to a promoter, such as a constitutive promoter.

[0214] In another embodiment, the nucleic acid construct further comprises a nucleic acid sequence encoding a CRISPR enzyme. Preferably, the CRISPR enzyme is a Cas protein. More preferably, the Cas protein is Cas9 or a functional variant thereof.

[0215] In an alternative embodiment, the nucleic acid construct encodes a TAL effector. Preferably, the nucleic acid construct further comprises a sequence encoding an endonuclease or a DNA cleavage domain thereof. More preferably, the endonuclease is Fok1.

[0216] In another aspect of the invention, a single guide (sg) RNA molecule is provided, wherein the sgRNA comprises a crRNA sequence and a tracrRNA sequence. In one embodiment, the sgRNA molecule may comprise at least one chemical modification, for example, which enhances its stability and / or binding affinity to the target sequence or the crRNA sequence and the tracrRNA sequence. For example, the crRNA may comprise a phosphorothioate backbone modification, such as 2'-fluoro (2'-F), 2'-0-methyl (2'-0-Me), and S-constrained ethyl (cET) substitutions.

[0217] In another embodiment, the nucleic acid construct may further comprise at least one nucleic acid sequence encoding an endoribonuclease cleavage site. Preferably, the endoribonuclease is Csy4 (also referred to as Cas6f). In the case where the nucleic acid construct comprises multiple sgRNA nucleic acid sequences, the construct may comprise the same number of endoribonuclease cleavage sites. In another embodiment, the cleavage site is 5' of the sgRNA nucleic acid sequence. Therefore, each sgRNA nucleic acid sequence is flanked by an endoribonuclease cleavage site. The term "variant" refers to a nucleotide sequence in which the nucleotides are substantially identical to one of the above sequences. The variant may be achieved by modification (e.g., insertion, substitution or deletion of one or more nucleotides). In a preferred embodiment, the variant has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity with any of the sequences described above. In one embodiment, the sequence identity is at least 90%. In another embodiment, the sequence identity is 100%.Sequence identity can be determined by any sequence alignment program known in the art.

[0218] The present invention also relates to a nucleic acid construct comprising a nucleic acid sequence operably linked to a suitable animal promoter. The suitable animal promoter can be a constitutive promoter or a strong promoter, or can be a tissue-specific promoter. In one embodiment, the suitable animal promoter is selected from but not limited to PGK, CMV, EF1a, CAG, SV40 and Ubc.

[0219] The nucleic acid construct of the present invention may further comprise a nucleic acid sequence encoding a CRISPR enzyme. In a specific embodiment, Cas9 is a codon-optimized Cas9. In another embodiment, the CRISPR enzyme is a protein from Class 2 candidate protein families, such as C2c1, C2C2, and / or C2c3. In one embodiment, the Cas protein is from Streptococcus pyogenes. In alternative embodiments, the Cas protein may be from any of Staphylococcus aureus, Neisseria meningitidis, or Streptococcus thermophilus.

[0220] The term "functional variant" as used herein with reference to Cas9 refers to a variant Cas9 gene sequence or a portion of the gene sequence that retains the biological function of the intact non-variant sequence, such as acting as a DNA endonuclease, or recognizing or / and binding DNA. Functional variants also include variants of the target gene that have sequence changes that do not affect function, such as non-conservative residues. Also contemplated are substantially identical variants, i.e., having only some sequence changes compared to the wild-type sequence as shown herein, such as in non-conservative residues, and are biologically active.

[0221] In another embodiment, the Cas9 protein has been modified to improve activity. For example, in one embodiment, the Cas9 protein may include a D10A amino acid substitution, which nicks only the DNA strand that is complementary to the gRNA and recognized by the gRNA. In an alternative embodiment, the Cas9 protein may alternatively or additionally include an H840A amino acid substitution, which nicks only the DNA strand that does not interact with the sRNA. In this embodiment, Cas9 can be used with a pair (i.e., two) of sgRNA molecules (or a construct expressing such a pair), and thus can cut the target region on the opposite DNA strand, with the possibility of improving specificity by 100-1500 times. In another embodiment, the Cas9 protein may include a D1135E substitution. The Cas9 protein may also be a VQR variant. Alternatively, the Cas protein may include a mutation in the nuclease domain (both HNH and RuvC-like), and is therefore catalytically inactive. Instead of cutting the target strand, the catalytically inactive Cas protein can be used to prevent the transcription elongation process, resulting in the loss of function of the protein that is not fully translated when co-expressed with the sgRNA molecule. An example of a catalytically inactive protein is dead Cas9 (dCas9) caused by point mutations in the RuvC and / or HNH nuclease domains.

[0222] In another embodiment, the Cas protein (e.g., Cas9) can be further fused to a repression effector (e.g., histone-modifying / DNA methylase or cytidine deaminase) to achieve site-directed mutagenesis. In the latter, the cytidine deaminase does not induce dsDNA breaks, but mediates the conversion of cytidine to uridine, thereby achieving C to T (or G to A) substitutions. These methods are particularly valuable for targeting glutamine and proline residues in gliadin to destroy toxic epitopes while preserving gliadin functionality.

[0223] In another embodiment, the nucleic acid construct comprises an endoribonuclease. Preferably, the endoribonuclease is Csy4 (also referred to as Cas6f), more preferably codon-optimized csy4. In one embodiment, when the nucleic acid construct comprises a Cas protein, the nucleic acid construct may comprise a sequence for expressing an endoribonuclease, such as a Csy4 expressed as a fusion of a 5' end P2A (used as a self-cleaving peptide) and a Cas protein (e.g., Cas9).

[0224] In one embodiment, the Cas protein, endoribonuclease and / or endoribonuclease-Cas fusion sequence can be operably linked to a suitable animal promoter. Suitable animal promoters are as described above, but in one embodiment, can be PGK, CMV, EF1a, CAG, SV40 and Ubc.

[0225] Suitable methods for preparing CRISPR nucleic acids and vector systems are known and disclosed, for example, in Ran et al. 2013, Nat Protoc 8, 2281–2308 (2013).

[0226] In another aspect of the present invention, an isolated animal cell is provided, which is transfected with at least one nucleic acid construct as described herein. In one embodiment, an isolated animal cell is transfected with at least one nucleic acid construct as described herein and a second nucleic acid construct, wherein the second nucleic acid construct comprises a nucleic acid sequence encoding a Cas protein (preferably a Cas9 protein) or a functional variant thereof. Preferably, the second nucleic acid construct is transfected before, after, or simultaneously with the first nucleic acid construct described herein.

[0227] In an alternative aspect of the invention, the nucleic acid construct comprises at least one nucleic acid sequence encoding a TAL effector.

[0228] Preferably, the nucleic acid encoding the sgRNA and / or the nucleic acid encoding the Cas protein is integrated in a stable form.

[0229] Also included within the scope of the present invention is the use of the above-mentioned nucleic acid construct (CRISPR construct) or sgRNA molecule in any of the above-mentioned methods. For example, the use of the above-mentioned CRISPR construct or sgRNA molecule to regulate the activity of one or more genes described herein is provided. In particular, as described herein, the CRISPR construct can be used to generate a loss-of-function or hyperactivated allele.

[0230] Unless otherwise defined herein, scientific and technical terms related to the present disclosure shall have the meanings commonly understood by those of ordinary skill in the art. Although the above disclosure provides a general description of the subject matter covered within the scope of the present invention, including methods for making and using the present disclosure and their best modes, the following examples are provided to further enable those skilled in the art to practice the present disclosure. However, it will be understood by those skilled in the art that the details of these embodiments should not be construed as limitations on the present invention, and the scope of the present invention should be understood from the claims attached to the present disclosure and their equivalents. In view of the present disclosure, it will be clear to those skilled in the art that various other aspects and embodiments of the present disclosure.

[0231] All documents mentioned in this specification are incorporated herein by reference in their entirety, including references to gene accession numbers, scientific publications and references to patent publications.

[0232] As used herein, "and / or" will be taken as specific disclosure of each of the two specified features or components, with or without the other. For example, "A and / or B" will be taken as specific disclosure of each of (i) A, (ii) B, and (iii) A and B, just as if each were individually listed herein. Unless the context dictates otherwise, the descriptions and definitions of the features above are not limited to any particular aspect or embodiment of the invention, and apply equally to all aspects and embodiments described.

[0233] Example

[0234] Example 1: Editing of isolated primary cells

[0235] method

[0236] Establishment of porcine cell lines

[0237] Skeletal muscle biopsies were excised from Sus scrofa domesticus (Landrace) dams using standard veterinary procedures and in accordance with ethical body guidelines.

[0238] Biopsies were dissociated in culture medium and filtered to produce single cell solutions. Cells were then cultured on appropriate surfaces, substrates and defined culture conditions depending on their phenotype. Plate coatings for each line are shown in Table 1. All cell lines were maintained at 37°C with 5% CO2.

[0239]

[0240] Table 1: Cell lines and specific growth conditions.

[0241] Note that throughout this document the terms IVY or IF are used interchangeably at the beginning of the cell line name.

[0242] Genome Editing in Primary Cells

[0243] CRISPR single guide RNAs (phosphorothioate-modified sgRNAs, Table 2) were designed for H-RAS, RB1, and TP53 genes. Single-stranded oligonucleotide donors were designed along with the H-RAS guide RNA to generate a heterozygous knock-in (KI) mutation of H-RasG12V (5'-ATGGTCTGGCCACGCTGAATGCTGCTTCCTCCACTGCAGTCCTGTGCTGTGGCCTCCTGAGGAGCGATGACGGAGTATAAGCTGGTGGTGGTGGGCGCTGTAGGTGTGGTGAAGAGTGCCCTGACCATCCAGCTTATCCAGAACCACTTTGTGGATGAGTACGACCCCACCATAGAGGTGAGCCTCCAGCCCGCATCCCG-3' SEQ ID NO. 19).

[0244]

[0245] Table 2: CRISPR guide RNA sequences.

[0246] Isolated primary cell lines (IIVY-p036-A, O, AD and IFp044-A and C) were electroporated (Amax 4D Nucleofector, Lonza) with ribonucleoprotein (RNP) complexes consisting of TrueCutTM SpCas9 protein V2 (Invitrogen A36498) and guide RNA (sgRNA, Synthego) according to the manufacturer's instructions (Lonza). IF-p036-A is a myoblast cell line, IF-p036-O is a fibroblast or myofibroblast cell line, and IF-p036-AD is a fibroblast or myofibroblast cell line. IFp044-A and IFp044-C are adipose-derived stem cell lines (Table 1). Electroporated cells were replated and expanded in 24-well tissue culture plates for 3 days. Cells were harvested (day 3 post electroporation), a portion of the cells were re-plated to grow for an additional 7 and 13 days (days 10 and 16 post electroporation), and the remaining cell pellets were used for DNA extraction. Cell pellets were removed at days 3, 10, and 17 post electroporation, and genomic DNA was extracted (Qiagen, DNeasy Blood and Tissue Kit, 69506). The extracted DNA (isolated at days 3, 10, and 17) was used as a template to amplify the region surrounding and including the target guide RNA / Cas9 editing site using PCR [with internal regions of H-Ras, TP53, and RB1]. The relevant exons of each gene were amplified by PCR (Q5 High-Fidelity DNA Polymerase, NEB Cat. No. M0491S, Table 3). The amplicons were Sanger sequenced and analyzed using the Synthego ICE web tool to calculate the editing percentage. The DNA amplification products were gel purified and submitted for Sanger sequencing. ICE analysis (Inference of CRISPR Editing) was used to analyze sequencing data and define the efficiency of gene editing achieved for H-Ras, TP53, and RB1. DNA off-targets associated with H-Ras were also checked by PCR. The top 3 predicted putative off-target sites of sg289 were amplified and sequenced. No off-target editing was observed. Control lines were generated by electroporation using SpCas9 only (no sgRNA). All cell lines were confirmed to be negative for mycoplasma by the (Mycoplasma Test) assay.

[0247]

[0248] Table 3: PCR primers

[0249] Lentivirus production and transduction

[0250] Lentiviral vectors were prepared as described previously (Dull et al. 1998). Briefly, 4 × 10 cells / 10 cm dish were cultured in DMEM-F12 / 10% FBS (Gibco). 6 HEK293T cells were plated at a density of 10 cells / mL. At 24 h after seeding, cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) and packaging mix (10.7 μg lentiviral transfer plasmid, 4.2 μg pMDL, 2.1 μg pCMV-Rev, and 3 μg pVSV-G) according to the manufacturer's instructions. The medium was changed 24 h after transfection, and the virus-containing supernatant was harvested 48 and 72 h after transfection. The harvested supernatant was pre-cleared by centrifugation at 470 g for 5 min and passed through a 0.45 μm filter and then stored at -80 °C until use.

[0251] Infect cells by overlaying 1:10 to 1:4 dilutions of viral supernatant (mixed with appropriate media) for 48 hours, then replace media. Measure successful infection by fluorescence microscopy, flow cytometry, or resistance to relevant antibiotics.

[0252] Microscopy

[0253] Image captured with CoolLED pE-300lite on Nikon Eclipse TS100.

[0254] Cell counting

[0255] Count cells using a hemocytometer with trypan blue exclusion dye or using a cell counting machine K2, Celigo, or NC3000. Calculate the doubling time using the doubling time web tool (https: / / www.doubling-time.com / compute.php).

[0256] result

[0257] Simultaneous multiplex gene silencing is highly effective in myoblast-derived porcine cells

[0258] To understand the extent to which porcine cells could be immortalized without the addition of exogenous genes and without overexpressing TERT, we first sought to optimize the parameters necessary for gene silencing using CRISPR-Cas9 editing. Porcine myoblast-derived immortalized cells (vi-pMyoHet) were nucleofected with a control sgRNA targeting the PTEN gene across a range of nucleofection conditions, and the presence of successful edits was measured using amplicon sequencing ( Figure 6 and Table 4).

[0259]

[0260] Table 4: Total editing and proportion of knockout (KO) across a range of nucleofection conditions. Editing was assessed using the ICE tool to infer CRISPR editing from Sanger sequencing traces (Conant et al., 2022). The R2 coefficient shows the goodness of fit of the ICE model and therefore its reliability for predicting editing outcomes across datasets.

[0261] Three sgRNAs were designed for the RB1, TP53, and H-RAS genes and evaluated for their ability to cause gene KO in a secondary myoblast-derived line, vi-pMyoHom. A highly active sgRNA for each gene was identified ( Figure 7 A), 86%, 92%, and 93% KO, respectively. Multiplexing these sgRNAs to simultaneously target all 3 genes yielded gene KO frequencies ranging from 86% to 96% KO ( Figure 7 B). Thus, these data demonstrate that it is possible to effectively and simultaneously target three genes important for cell cycle regulation in myoblast-derived porcine cells.

[0262] Primary porcine-derived myoblast cell lines are sensitive to loss of H-Ras GTPase, whereas loss of TP53 and RB1 confers Survival advantage

[0263] Those skilled in the art understand that the Ras family of small GTPases regulate cell division by converting cellular GTP to GDP and engaging the Raf / MEK / ERK pathway. There is redundancy between the three Ras subfamily members (H-Ras, N-Ras, and K-Ras), with K-Ras- / -H-Ras- / - double mutant mice showing a normal developmental phenotype due to compensation by K-Ras. In addition, gain-of-function changes, such as substitution of valine at position 12 in SEQ ID NO.46 for glycine, render the protein constitutively active, demonstrating a strong mitotic signal to drive cell division. Alternative substitutions to the glycine at position 12 that produce the same favorable gain-of-function are alanine, cysteine, aspartic acid, arginine, or serine. The same advantageous gain of function is also produced by substitution of position 13 of SEQ ID NO:46, 47 or 48 with any of alanine, cysteine, aspartic acid, arginine, serine or valine and / or substitution of position 61 of SEQ ID NO:46, 47 or 48 with any of glutamic acid, histidine, lysine, proline and arginine.

[0264] To explore the effects of H-Ras loss and H-RasG12V gain of function on primary porcine myoblasts, RNPs targeting the H-Ras gene were nucleofected with and without a donor template containing the G12V variant. Acute biallelic disruption of the H-Ras gene resulted in a significant selective disadvantage of the cells compared to unedited sister cells ( Figure 8 ). After 11 days in culture, H-Ras- / - cells were substantially outcompeted by H-Ras+ / + cells, resulting in a 10-fold depletion of H-Ras- / - cells. This negative selection for H-Ras loss suggests that compensation by other subfamily members is less pronounced in primary porcine myoblasts. However, introduction of the H-RasG12V variant confirmed a distinct trend toward stable cells containing H-Ras loss cells. It is presumed that, since sequencing was performed on a subset of cells, a portion of the surviving cells indeed encoded a heterozygous H-RasG12V / - genotype ( Figure 8 ). Knock-in (KI) of G12V substitution into two separate myoblast-derived porcine lines showed a similar trend ( Fig. 9 After 10 days in culture, inactivation of TP53 and RB1 showed enrichment, suggesting that loss of both proteins confers a survival advantage to primary porcine myoblasts ( Fig. 9 ).

[0265] Generation of primary myoblast- and adipocyte-derived porcine cells with different genetic perturbations Cell line group .

[0266] To understand the impact of perturbations on immortalization of primary porcine cell types, two myoblast-derived (IVYp036-A and IVYp036-O) lines and one adipose-derived (IVYp036-AD) line were subjected to various combinations of CRISPR-Cas9 editing. All 3 lines were either single-gene edited (H-RasG12V), double-gene edited (H-RasG12V / TP53 or H-RasG12V / RB1), or triple-gene edited (H-RasG12V / TP53 / RB1), and the editing was then assessed over time in culture ( Figure 3 and 4 ).

[0267] Figure 3 and 4 The relative efficiency of cellular editing of RAS, TP53, and RB1 in 3 primary porcine cell lines (IVYp036-A-27-A, IVYp036-O-31-A, and IVYp036-AD) is shown. Each cell line was sampled at days 3, 10, and 16 to determine the percentage of cells with the desired modification. The percentage of successfully edited cells was calculated using Inference of CRISPR Editing (ICE). Both edited cell lines exhibited unusually high levels of editing.

[0268] like Figure 3 and 4 As shown, all cell types showed robust editing of all 3 genes. A trend was observed across myoblasts and across all gene combinations, whereby both TP53 and RB1 were selected for loss over time. Notably, H-RasG12V was not significantly enriched over time across both myoblast lines.

[0269] Figure 4 The relative efficiency of cellular editing of RAS, TP53, and RB1 in a third cell line (IFp036-AD) is shown, and it is demonstrated that this cell line also exhibits abnormally high levels of editing.

[0270] Fig.11 The relative efficiency of RAS, TP53, and RB1 in two additional cell lines (IF p044 A and C) is shown and indicates that these cell lines also exhibit high levels of editing.

[0271] Triple-edited (H-RasG12V / TP53 / RB1) primary porcine lines display molecular and physical hallmarks of immortalization

[0272] To explore whether triple editing (H-RasG12V / TP53 / RB1) confers an immortal phenotype to primary porcine cells, the transcriptional profiles of cell cycle regulators and the dependence on proliferative growth factors were assessed.

[0273] Inactivation of TP53 signaling through genetic deficiency of TP53 leads to a significant decrease in p21 mRNA levels ( Fig.11 p21 cyclin-dependent kinase (CDK) is a direct target of TP53 and a potent negative regulator of the cell cycle, at least in part by inhibiting CDK4, 6 / cyclin-D, CDK2 / cyclin-E, and cyclin B. Activation of the p53-p21 signaling cascade can lead to cell cycle arrest or apoptosis. Triple-edited CRISPR lines displayed robust de-repression of cyclin B and modest de-repression of CDK2 and CDK4, consistent with relaxation of cell cycle regulatory control. Importantly, transcriptional changes in triple-edited myoblasts closely resembled those of immortalized myoblast controls (vi-pMyoHet).

[0274] Compared with control Cas9-nucleofected lines, triple-edited lines showed increased proliferation ( Fig.10B), which is consistent with the relaxation of cell cycle constraints. In addition, the triple-edited line was able to proliferate robustly in the absence of basic fibroblast growth factor (FGF2) supplementation, while the non-immortalized line failed to proliferate. Together, these data demonstrate the successful immortalization of primary porcine cells using CRISPR-Cas9 targeting the H-RasG12V, TP53, and RB1 pathways.

[0275] discuss

[0276] To date, all methods for immortalizing cell types relevant to cell agriculture have employed the addition of exogenous genes (e.g., CDK4) and overexpression of exogenous telomerase TERT. Here, the inventors did not introduce foreign genes into the cell line, nor did they utilize overexpression of TERT. The inventors have shown that primary porcine muscle and adipose-derived cells can be efficiently gene-edited using CRISPR-Cas9, and that editing of the H-Ras, p53, and pRB pathways drives immortalization.

[0277] In contrast to its neutral effect in mice, inactivation of H-Ras has a deleterious effect on myoblast proliferation, allowing overgrowth of wild-type cells ( Figure 8 This suggests that the normal compensatory mechanisms seen in mice (N-Ras and K-Ras) do not function in the same way in primary porcine myoblasts. Notably, inactivation of both the Tp53 and RB1 pathways conferred a competitive advantage to the cells compared to controls ( Figure 3 and 4 Without wishing to be bound by theory, this is at least in part due to perturbations in cell cycle regulation constraints imposed by these pathways ( Fig.10 A). Finally, it was noted that immortalization via triple gene editing increased proliferation and reduced dependence on exogenous growth factors (FGF2) added to the culture medium ( Fig.10 B). Together, these data outline a robust strategy for immortalization of diverse cell types from agriculturally relevant species and show that these edited cell lines will form the basis of an economically viable, large-scale production pipeline for the generation of porcine-based meat products.

[0278] Example 2: Doubling times of parental (IFp036-A / O), CRISPR triple-edited, and cas9 cell lines

[0279] method

[0280] Count cells using a hemocytometer with trypan blue exclusion dye, or count cells using K2, Celigo, or NC3000. Calculate doubling time using the Doubling Time web tool (https: / / www.doubling-time.com / compute.php).

[0281] result

[0282] Immortalization was characterized using triple-edited cell lines IF-p036-A-27-A and IFp036-O-31-A compared to the unedited parental control (expressed as Cas9 only). Triple-edited cells showed a growth advantage compared to Cas9 alone ( Figure 5 c) A decrease in doubling time of the triple edited cell line compared to the Cas9 control cell line. A decrease in doubling time indicates that the modifications made to the cells have caused the cells to progress more rapidly through the cell cycle and therefore display an immortalized phenotype.

[0283] The reduction in doubling time was more pronounced in the IFp036-O fibroblast / myofibroblast cell line compared to the IFp036-A myoblast cell line. However, in both cell lines, there was a significant decrease in doubling time between the original cell line and the triple-edited cell line, as well as between the cas9 control cell line and the triple-edited cell line.

[0284] Example 3: Removal of Matrigel and its effect on doubling time

[0285] method

[0286] Doubling time was assessed using the same method as above.

[0287] result

[0288] Matrigel is a commercially available matrix containing extracellular matrix proteins used to aid in the adhesion and differentiation of cells in vitro. Adhesion of cells to the extracellular matrix is ​​often used to maintain cells of primary origin in a quiescent state and promote longer doubling times. Furthermore, reliance on cell adhesion for cell survival is not advantageous for cultured meat production, where it is advantageous to culture non-adherent cells that more easily form cultured meat tissue. Figure 5 d shows that when cells were cultured in the absence of Matrigel, the triple edited cells showed a greatly reduced doubling time compared to the cas9 control cell line. Thus, by generating modified cells with an immortalized phenotype that is independent of Matrigel, the cells show a reduced doubling time and an immortalized phenotype.

[0289] Example 4: Removal of FGF and its effect on doubling time

[0290] method

[0291] Doubling times were assessed using the method detailed above.

[0292] result

[0293] FGF is a growth factor used to promote the growth and proliferation of cells cultured in vitro. The ability to culture cells in a medium lacking this growth factor is advantageous for cell cultures for growing meat, as FGF is an expensive culture medium additive. When cultured in a medium lacking FGF, a lower doubling time indicates an immortalized phenotype, as cells do not require the stimulation provided by FGF to proliferate.

[0294] Figure 5 e shows that the triple-edited cell line exhibits a reduced doubling time compared to the Cas9 control cell line, highlighting that the triple-edited cell line exhibits an immortalized phenotype compared to the Cas9 control cell line.

[0295] Figure 5 The last graph of e shows that the doubling time of the triple edited cell line decreases with the extension of culture time, and decreases with the increase of passage number after the 18th generation. This is directly opposite to what primary cells usually show after longer in vitro culture. When cultured in vitro for a long time, the unedited primary cells are expected to have their growth slowed down and have an increased doubling time. This difference emphasizes that the triple edited cell line has an immortalized phenotype compared to the Cas9 control and unedited cell lines.

[0296] Example 5: Editing efficiency and growth data from porcine myoblast cell line

[0297] method

[0298] Cells were edited following the protocol described for the triple-edited porcine myoblast cell line. Guide RNAs with the following sequences were used and the genes in Table 5 were targeted using Strep. pyogenes Cas9 protein. Note that the same guide RNA was used between various given species (e.g., Wagyu and Angus variants) and cell types (e.g., porcine myoblasts and porcine ADSCs).

[0299] Table 5

[0300]

[0301] For porcine and bovine HRAS, a G12V knockout was created by adding a ssODN homology template (IDT Technologies). The sequence of this template is given in Table 6.

[0302] Table 6.

[0303]

[0304] Editing efficiency was validated in a pool of cells at 2-3 time points post-editing to screen for enrichment or depletion of the desired mutation. Enrichment of the target mutation indicates a positive effect of the given mutation on cell growth, while depletion indicates a deleterious effect on cell health or growth. Editing efficiency was measured by PCR amplification of the target region, Sanger sequencing (Source Biosciences), and ICE analysis (synthesized) of the Sanger sequencing files.

[0305] Growth assay:

[0306] Allow cells to adhere to the culture medium for multiple generations to obtain doubling time data and / or cumulative number of generations. 2 Inoculate into flasks coated with Matrigel or directly onto plastic (as annotated in the figure). Count cells and passage every 3-4 days. The culture medium for myoblasts is DMEM 4.5g / L glucose, 20% FBS, 2mM L-glutamine, 5ng / μl FGF2. The culture medium for ADSCs is DMEM 1g / L glucose, 10% FBS, 2mM L-glutamine, 5ng / μl FGF.

[0307] result

[0308] Use 1 sgRNA targeting P53 ( Fig.12 a) and 1 sgRNA targeting RB1 ( Fig.12 b) or use a combination of both ( Fig.12 c) Edited cells. Editing efficiency (knockdown) was measured at 2 to 3 time points after editing. In all cases, p53 and RB1 editing increased or remained high during this time period, suggesting a beneficial effect of those mutations on cell doubling time.

[0309] For growth assays, cells were seeded into 3 replicate flasks (starting from growth phase 2) and plated on Matrigel-coated flasks ( Fig.12 d) or on plastic ( Fig.12 e) Adherent growth for 8 generations. Doubling times were compared to control lines (transfected with Cas9 alone, no sgRNA; control). In the single gene-edited lines, P53 knockout showed a growth advantage compared to the control, whereas RB1 knockout alone did not appear to be sufficient to consistently enhance growth in this cell line. Under both conditions, the dual-edited P53 - / - / RB1 - / - The lines also showed growth advantages. As a reference point, Fig.12 d and Fig.12 P53 is plotted in the figure shown in e - / - / RB1 - / - / HRAS G12V / - The average doubling time of the cell lines was 8 passages. - / - Single knockout lines and P53 - / - / RB1 - / - Doubling time of double knockout lines and P53 - / - / RB1 - / - / HRAS G12V / - Doubling times of the triple-edited lines were comparable.

[0310] Example 6: Editing efficiency and growth data from porcine adipose-derived stem cell (ADSC) cell lines

[0311] Use 1 sgRNA targeting P53 ( Fig.13 a) and 1 sgRNA targeting RB1 ( Fig.13 b) or use a combination of both ( Fig.13 c) or as a triple editor with HRAS G12V knock-in ( Fig.13 d, 3 replicate flasks) of cells edited. Editing efficiency was measured at 3 time points after editing (knockout of P53 and RB1; knockin of HRAS). In all cases, P53 and RB1 editing increased or remained high over the time period, suggesting a beneficial effect of those mutations on cell doubling time. HRAS editing efficiency was low and did not increase.

[0312] For growth assays, cells were seeded into triplicate flasks and allowed to adhere to plastic for 5–8 generations. The cumulative number of generations was compared to control lines (transfected with Cas9 only, no sgRNA; control). Fig.13 e) Compared with the control, P53 - / - Single knockouts showed growth advantages, while / RB1 - / - Single knockout alone does not appear to be sufficient to enhance growth in this cell line. - / - / RB1 - / - Tie( Fig.13 f) and triple-edited P53 - / - / RB1 - / - / HRAS G12V / - ( Fig.13 g) all showed growth advantage.

[0313] Example 7: Editing efficiency and growth data from Angus cattle variant myoblast cell line

[0314] Use one of the three sgRNAs targeting bovine P53 ( Fig.14 a) One of the three sgRNAs targeting bovine RB1 ( Fig.14b) or 1 of 3 sgRNAs targeting bovine HRAS ( Fig.14 c) Edit cells, or use a combination of bP53 sgRNA1 and bRB1 sgRNA1 ( Fig.14 d) or as triple editor using bP53 sgRNA3 / bRB1 sgRNA3 / HRAS sgRNA3 ( Fig.14 e) Edited cells. Editing efficiency was measured at 3 time points after editing (knockout of P53 and RB1; knockin of HRAS). In all cases, P53 and RB1 editing increased or remained high over the time period, suggesting a beneficial effect of those mutations on cell doubling time. HRAS editing efficiency was low and did not increase over time except for the last sampling time point.

[0315] For growth assays, cells were seeded into 3 replicate flasks and grown on Matrigel ( Fig.14 f) or plastic ( Fig.14 g) and allowed to adhere for 6 generations where possible. The cumulative number of generations was compared to control lines (transfected with Cas9 only, no sgRNA; control). All edited lines showed a growth advantage under both conditions over the control lines, which reached their Hayflick limit and died during the growth assay. - / - / RB1 - / - Dual edited and P53 - / - / RB1 - / - / HRAS G12V / - Optimal growth was observed in the triple-edited cell lines.

[0316] Example 8: Editing effect of an Angus cattle adipose-derived stem cell (ADSC) cell line

[0317] Cells edited with a combination of bP53 sgRNA3 and bRB1 sgRNA2 ( Fig.15 Editing efficiency was measured at 2 time points after editing (knockdown). In all cases, p53 and RB1 editing increased or remained high during this time period, suggesting a beneficial effect of those mutations on cell doubling time.

[0318] Example 9: Editing efficiency and growth data from Wagyu variant myoblast cell lines

[0319] Use 1 sgRNA targeting P53 ( Fig.16 a) and 1 sgRNA targeting RB1 ( Fig.16 b) or use a combination of both ( Fig.16c) Edited cells. Editing efficiency was measured at 3 time points after editing (knockout). In all cases, p53 and RB1 editing remained high over this time period, suggesting a beneficial effect of those mutations on cell doubling time.

[0320] For growth assays, cells were seeded into 3 replicate flasks and placed on Matrigel-coated flasks or on plastic ( Fig.16 d) Adherent growth for 5 generations. Doubling time was compared with a control line (transfected with Cas9 only, without sgRNA; control). Under both conditions, the double-edited p53 - / - / RB1 - / - The line also showed a sustained growth advantage.

[0321] Example 10: Editing efficiency and growth data of adipose-derived stem cell (ADSC) cell lines from Wagyu variants

[0322] Use 1 sgRNA targeting P53 ( Fig.17 a) and 1 sgRNA targeting RB1 ( Fig.17 b) or use a combination of both ( Fig.17 c) Edited cells. Editing efficiency (knockdown) was measured at 3 time points after editing. In all cases, p53 and RB1 editing remained high (>80%) over this time period, suggesting a beneficial effect of those mutations on cell doubling time.

[0323] Example 11: Editing efficiency of chicken myoblast cell line

[0324] Using 1 sgRNA targeting P53 ( Fig.18 a) or 1 of 3 sgRNAs targeting RB1 to edit cells ( Fig.18 b). Editing efficiency was measured at 3 time points after editing (knockdown). In all cases, p53 and RB1 editing increased or remained high during this time period, suggesting a beneficial effect of those mutations on cell doubling time.

[0325] Table 7 Sequence (pig)

[0326]

[0327]

[0328]

[0329]

[0330] References

[0331] T Dull, R Zufferey, M Kelly, RJ Mandel, M Nguyen, D Trono, LNaldini. A third-generation lentivirus vector with a conditional packaging system. J Virol. 1998 Nov;72(11):8463-71. doi: 10.1128 / JVI.72.11.8463-8471.1998.

[0332] Ran, F., Hsu, P., Wright, J. et al. Genome engineering using theCRISPR-Cas9 system. Nat Protoc 8, 2281–2308 (2013). https: / / doi.org / 10.1038 / nprot.2013.143

[0333] Table 8 Ras isoform amino acid sequences (pig)

[0334]

Claims

1. A modified animal cell having a genetic modification in one or more genes associated with genome surveillance, cell cycle control and / or cell death control, and wherein the animal is an animal species suitable for human or animal consumption, optionally for use in agriculture.

2. A modified animal cell according to claim 1, wherein said modification renders said cell immortal.

3. The modified animal cell according to claim 1 or claim 2, wherein the animal is selected from pigs, cattle, poultry, sheep, goats, fish, crustaceans or molluscs.

4. A modified animal cell according to any one of the preceding claims, wherein the modified cell is a somatic cell.

5. The modified animal cell according to claim 4, wherein the modified cell is selected from one of the following cell types: myoblasts, fibroblasts, myofibroblasts, adipose-derived stem cells, epithelial cells, mesenchymal stem cells, satellite cells or hepatocytes.

6. A modified animal cell according to any one of the preceding claims, wherein the cell does not express exogenous nucleic acids to manipulate the genome surveillance, cell cycle control and / or cell death control pathways.

7. A modified animal cell according to any one of the preceding claims, wherein the animal cell has a genetic modification in one or more of the following genes: RB1, TP53 and / or RAS genes.

8. The modified animal cell according to any one of the preceding claims, wherein the animal cell has a genetic modification in RB1.

9. A modified animal cell according to any one of the preceding claims, wherein the animal cell has a genetic modification in TP53.

10. The modified animal cell according to any one of the preceding claims, wherein the animal cell has a genetic modification in the RAS gene.

11. The modified animal cell according to any one of the preceding claims, wherein the animal cell has a genetic modification in RB1 and in TP53.

12. The modified animal cell according to any one of the preceding claims, wherein the animal cell has a genetic modification in RB1 and in the RAS gene.

13. The modified animal cell according to any one of the preceding claims, wherein the animal cell has a genetic modification in TP53 and in the RAS gene.

14. The modified animal cell according to any one of the preceding claims, wherein the animal cell has genetic modifications in RB1, TP53 and in the RAS gene.

15. The modified animal cell according to any one of claims 7, 10, 12, 13 or 14, wherein the RAS gene is HRAS, NRAS or KRAS. The modified animal cell according to claim 15, wherein the RAS gene is HRAS.

16. The modified animal cell according to any one of the preceding claims, wherein the modification is in the promoter region or coding region of the one or more genes.

17. A modified animal cell according to any one of the preceding claims, wherein the modification is introduced using targeted genome modification.

18. The modified animal cell according to claim 17, using an endonuclease.

19. The modified animal cell according to claim 18, wherein the endonuclease is selected from TALEN, ZFN or CRISPR / Cas9.

20. The modified animal cell according to any one of the preceding claims, wherein the gene is selected from one or both of RB1 and / or TP53, and the modification is a loss-of-function modification.

21. The modified animal cell of claim 20, wherein the loss-of-function modification comprises knockout of a gene.

22. The modified animal cell according to any one of claims 1 to 21, wherein the gene is a RAS gene, the modification is a hyperactivation modification, optionally, wherein the RAS gene is HRAS, NRAS or KRAS.

23. The modified animal cell of claim 22, wherein the hyperactivation modification comprises one or more amino acid substitutions.

24. The modified animal cell of claim 22, wherein the one or more amino acid substitutions comprise substitution of glycine at position 12 or 13 or glutamine at position 61 of SEQ ID NO:46, 47 or 48.

25. A modified animal cell according to claim 22, wherein the one or more amino acid substitutions comprise substitution of a glycine at position 12 or 13 of SEQ ID NO:46, 47 or 48, wherein the one or more amino acids are selected from a list comprising alanine, cysteine, aspartic acid, arginine, serine and valine.

26. The modified animal cell of claim 22, wherein the one or more amino acid substitutions comprise substitution of glycine at position 12 or 13 of SEQ ID NO: 46, 47 or 48 with valine.

27. A modified animal cell according to claim 22, wherein the one or more amino acid substitutions comprise substitution of glycine at position 61 of SEQ ID NO:46, 47 or 48, wherein the one or more amino acids are selected from a list comprising glutamic acid, histidine, lysine, proline and arginine.

28. A method for preparing cultured meat or cultured meat products, comprising culturing the modified animal cell according to any one of claims 1 to 27.

29. The method of claim 28, wherein the method comprises continuous or batch culture of the modified cells.

30. The method of claim 28 or 29, comprising the step of causing the cells to form a tissue-like structure.

31. The method of any one of claims 28 to 30, wherein the cells form muscle tissue-like structures.

32. A method for preparing a modified animal cell according to any one of claims 1 to 27, wherein the method comprises introducing a genetic modification in one or more genes associated with genome surveillance, cell cycle control and / or cell death control, and wherein the animal is an animal suitable for human or animal consumption, optionally for use in agriculture.

33. A method of immortalizing an animal cell, wherein the method comprises introducing a genetic modification in one or more genes associated with genome surveillance, cell cycle control and / or cell death control, and wherein the animal is an animal suitable for human or animal consumption, optionally for use in agriculture.

34. The method of claim 32 or 33, wherein the genetic modification alters the expression or function of one or more genes associated with genome surveillance, cell cycle control and / or cell death control.

35. The method according to any one of claims 32 to 34, wherein the animal cell is immortalized.

36. The method of any one of claims 32 to 35, wherein the animal is selected from pigs, cattle, poultry, sheep, goats, fish, crustaceans or molluscs.

37. The method of any one of claims 32 to 36, wherein the modified cell is a somatic cell.

38. The modified animal cell of claim 37, wherein the modified cell is selected from one of the following cell types: myoblasts, fibroblasts, myofibroblasts, adipose-derived stem cells, epithelial cells, mesenchymal stem cells, satellite cells, or hepatocytes.

39. The method of claims 32 to 38, wherein the cells do not express exogenous nucleic acids to manipulate genome surveillance, cell cycle control and / or cell death control.

40. The method of any one of claims 32 to 39, wherein the animal cell has a genetic modification in one or more of the following genes: RB1, TP53 and / or RAS genes.

41. The method of any one of claims 32 to 40, wherein the animal cell has a genetic modification in RB1.

42. The method of any one of claims 32 to 41, wherein the animal cell has a genetic modification in TP53.

43. The method of any one of claims 32 to 42, wherein the animal cell has a genetic modification in the RAS gene.

44. The method according to any one of claims 32 to 43, wherein the animal cell has a genetic modification in RB1 and in TP53.

45. The method of any one of claims 32 to 44, wherein the animal cell has a genetic modification in RB1 and in the RAS gene.

46. ​​The method of any one of claims 32 to 45, wherein the animal cell has a genetic modification in TP53 and in the RAS gene.

47. The method of any one of claims 32 to 46, wherein the animal cell has genetic modifications in RB1, TP53 and in the RAS gene.

48. The method of any one of claims 40, 43, 45, 46 or 47, wherein the RAS gene is HRAS, NRAS or KRAS. The method of claim 45, wherein the RAS gene is HRAS.

49. The method of any one of claims 32 to 48, wherein the modification is performed on a promoter region or a coding region of the one or more genes.

50. The method of claims 32 to 49, wherein the modification is introduced using targeted genomic modification.

51. The method of claim 50 using an endonuclease.

52. The method of claim 51, wherein the endonuclease is selected from TALEN, ZFN or CRISPR / Cas9.

53. The method of claims 32 to 52, wherein the gene is selected from one or both of RB1 and / or TP53, and the modification is a loss-of-function modification.

54. The method of claim 53, wherein the loss-of-function modification comprises knockout of a gene.

55. The method of any one of claims 32 to 54, wherein the gene is a RAS gene and the modification is a hyperactivation modification, optionally wherein the RAS gene is HRAS, NRAS or KRAS.

56. The method of claim 55, wherein the hyperactivation modification comprises one or more amino acid substitutions.

57. The method of claim 55, wherein the one or more amino acid substitutions comprise substitution of glycine at position 12 or 13 or glutamine at position 61 of SEQ ID NO:46, 47 or 48.

58. The method of claim 55, wherein the one or more amino acid substitutions comprise substitution of glycine at position 12 or 13 of SEQ ID NO:46, 47 or 48, wherein the one or more amino acids are selected from a list comprising alanine, cysteine, aspartic acid, arginine, serine and valine.

59. The method of claim 55, wherein the one or more amino acid substitutions comprise substitution of glycine at position 12 or 13 of SEQ ID NO: 46, 47 or 48 with valine.

60. The method of claim 55, wherein the one or more amino acid substitutions comprise substitution of glycine at position 61 of SEQ ID NO:46, 47 or 48, wherein the one or more amino acids are selected from a list comprising glutamic acid, histidine, lysine, proline and arginine.

61. A cultivated or cultured animal tissue or a cultivated or cultured meat product comprising a modified cell according to any one of claims 1 to 27.

62. The cultured animal tissue of claim 61, wherein the culture is a suspension culture.

63. Use of the modified animal cell according to any one of claims 1 to 27 for cellular agriculture.

64. A method for preparing an immortalized animal cell line, the method comprising the method according to any one of claims 16 to 27.

65. A guide RNA for use in a method of preparing a modified, immortalized cell or immortalized animal cell line according to any one of claims 32 to 60 or claim 64.

66. A guide RNA comprising any sequence selected from SEQ ID NO. 15, 16, 17, 18.

67. The guide RNA of claim 66, for use in a method of preparing a modified or immortalized cell according to any one of claims 32 to 60.

68. The guide RNA of claim 67, wherein the modified cell is a modified cell according to any one of claims 1 to 31.

69. A kit of parts comprising the guide RNA according to any one of claims 65 to 68.

Images