Lactobacillus plantarum WCSF1-0012 and its applications

By providing a preserved Lactobacillus plantarum WCSF1-0012, this strain has a significant mononuclear-macrophage activation function, solving the problem of difficult to prepare highly effective immune-activated lactic acid bacteria in the prior art, achieving effective inhibition and treatment of oral tumors, with low cost, high safety and high reliability.

CN119899777BActive Publication Date: 2025-06-27SICHUAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510362393.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-26
Publication Date
2025-06-27
Estimated Expiration
2045-03-26

AI Technical Summary

Technical Problem

The prior art is difficult to prepare highly immunoactivated lactic acid bacteria through genetic engineering, and does not introduce exogenous gene sequences, making it difficult to effectively enhance the host's anti-tumor ability.

Method used

A strain of Lactobacillus plantarum WCSF1-0012 has been provided. This strain has been deposited in the China Microbial Sperm Conservation Management Committee. It has a significant monocyte-macrophage activation function and can inhibit oral tumors by activating the NF-κB and ISRE pathways.

Benefits of technology

Lactobacillus plantarum WCSF1-0012 can safely and effectively inhibit and treat oral tumors, activate macrophages to kill tumor cells, and has low cost, high safety and high reliability. It is suitable for the preparation of drugs or food and beverages for the prevention and treatment of oral tumors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119899777B_ABST
    Figure CN119899777B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of microbial technology, and specifically discloses a Lactobacillus plantarum WCSF1-0012 and its application. The Lactobacillus plantarum ( Lactobacillus plantarum WCSF1-0012) was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on December 19, 2024, with the deposit number CGMCC No. 33131; the special gene sequence of the Lactobacillus plantarum WCSF1-0012 is shown in SEQ ID NO. 1; the Lactobacillus plantarum WCSF1-0012 is used to prepare drugs, health products or food and beverages for preventing, inhibiting or treating oral tumors. The Lactobacillus plantarum WCSF1-0012 is a safe probiotic without toxic and side effects, which can effectively inhibit oral tumors, that is, play an anti-tumor role by activating macrophages. In addition, it also has the safety for long-term use, and has low cost, high safety and high reliability, and can be used to prepare drugs or food and beverages for preventing and even treating oral tumors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microbiology, and specifically to a Lactobacillus plantarum WCSF1-0012 and its application. Background Art

[0002] Oral squamous cell carcinoma (OSCC) is the most common malignant tumor in the head and neck, accounting for more than 90% of oral tumors. Statistical data in 2020 showed that there were approximately 380,000 newly diagnosed malignant tumors and approximately 180,000 deaths globally in the oral cavity and tongue. Modulating the immune system and enhancing the host's anti-tumor function are emerging frontiers in the field of tumor treatment.

[0003] In recent years, the immunomodulatory functions of microorganisms have attracted extensive attention. Microorganisms, especially lactic acid bacteria, are characterized by low cost, high safety, and high reliability. Lactobacillus, as one of the few microorganisms rated as generally recognized as non-toxic by the US Food and Drug Administration and the China National Medical Products Administration, has good biosafety. Lactobacillus plantarum WCSF1 is a probiotic derived from the oral cavity. How to further prepare lactic acid bacteria with high-efficiency immune activation, enhanced host anti-tumor ability, and no introduction of foreign gene sequences through genetic engineering means is a current technical difficulty. Therefore, a Lactobacillus plantarum WCSF1-0012 and its application are provided. Summary of the Invention

[0004] The purpose of the present invention is to address the deficiencies of the prior art by providing a Lactobacillus plantarum WCSF1-0012 and its application to solve the problems raised in the above background art.

[0005] To achieve the above purpose, the present invention provides the following technical solution: A Lactobacillus plantarum WCSF1-0012, the Lactobacillus plantarum ( Lactobacillus plantarum ) WCSF1-0012 was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on December 19, 2024, with the deposit number CGMCC No. 33131, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing.

[0006] The present invention also provides a gene sequence of Lactobacillus plantarum WCSF1-0012 as shown in SEQ ID NO.1.

[0007] In addition, the present invention also provides an application of Lactobacillus plantarum WCSF1-0012, and the Lactobacillus plantarum WCSF1-0012 is used to prepare drugs or food and beverages for preventing, inhibiting, or treating oral tumors.

[0008] Furthermore, the drug includes live strains of Lactobacillus plantarum WCSF1-0012.

[0009] Furthermore, the drug includes pharmaceutically acceptable excipients.

[0010] Furthermore, the dosage form of the drug is tablets, capsules, oral liquids or lyophilized powders.

[0011] Furthermore, the food and beverage is a product prepared by adding an effective amount of Lactobacillus plantarum WCSF1-0012 to lactic acid bacteria beverages, yogurt, fermented soy products, bacterial powders or milk powders.

[0012] Furthermore, the content of Lactobacillus plantarum WCSF1-0012 in the drug or food and beverage is 10 8 CFU~10 11 CFU.

[0013] Furthermore, the drug or food and beverage is a drug or food and beverage for activating monocytes-macrophages and inhibiting oral tumors.

[0014] Furthermore, the drug or food and beverage is a drug or food and beverage for highly activating the NF-κB and ISRE pathways of monocytes-macrophages and inhibiting oral tumors.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention discloses Lactobacillus plantarum WCSF1-0012 that can effectively inhibit oral tumors. This Lactobacillus plantarum WCSF1-0012 is a safe lactic acid bacterium without toxic side effects, which can effectively inhibit oral tumors and even treat oral tumors, that is, it can activate monocytes-macrophages and at the same time promote macrophages to kill tumor cells. In addition, it also has the safety for long-term use, and is low in cost, high in safety and high in reliability, and can be used to prepare drugs or food and beverages for preventing and even treating oral tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the relative content of c-di-AMP in the bacterial cells of Lactobacillus plantarum WCSF1-0012 in Example 2 of the present invention;

[0017] Figure 2 It is a diagram showing the activation of the NF-κB and ISRE pathways of monocytes-macrophages by WCSF1-0012 in Example 3 of the present invention;

[0018] Figure 3In Example 4 of the present invention, WCSF1-0012 is superior to the wild type in promoting macrophages to clear oral tumor cells. Among them, Cal-27 only is the oral tumor cell group, Ctrl is the co-culture group of macrophages and oral tumors, 10 ng / mL LPS is the co-culture group of lipopolysaccharide-treated macrophages and oral tumors; 10 μg / mL c-di-AMP is the co-culture group of macrophages treated with cyclic diadenosine monophosphate and oral tumors; WT 50MOI is the co-culture group of macrophages treated with Lactobacillus plantarum WCSF1 and oral tumors; 0012 is the co-culture group of macrophages treated with Lactobacillus plantarum WCSF1-0012 and oral tumors;

[0019] Figure 4 In Example 5 of the present invention, the resistance of WCSF1-0012 to antibiotics has not changed significantly compared with the parent strain. The OD of WCSF1 and WCSF1-0012 after overnight treatment with different concentrations of antibiotics is shown in the figure 600 nm readings, and the antibiotics are erythromycin and chloramphenicol. Detailed implementation manners

[0020] The following elaborates on the preferred embodiments of the present invention in conjunction with the accompanying drawings, so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more definite definition of the protection scope of the present invention.

[0021] In the following examples, the required strains are as follows:

[0022] Lactobacillus plantarum ( Lactobacillus plantarum WCSF1-0012) strain. The Lactobacillus plantarum WCSF1-0012 was deposited at the China General Microbiological Culture Collection Center on December 19, 2024, with the deposit number CGMCC No. 33131, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing;

[0023] In the following examples, the required strains and cell lines are as follows:

[0024] Lactobacillus plantarum WCSF1 ( L.plantarum WCSF1)

[0025] Human monocyte-macrophage cell line THP-1 with NFκB and ISRE luciferase reporter systems;

[0026] Human OSCC cell line Cal-27 with luciferase-green fluorescent protein fusion protein;

[0027] In the following examples, the required reagents are as follows:

[0028] The MRS medium was purchased from Qingdao Haibo Biotechnology Co., Ltd.;

[0029] The RPMI medium, DMEM medium, and fetal bovine serum were purchased from GIBCO (Thermo Fisher Scientific);

[0030] The high-purity potassium D-luciferin was purchased from Beyotime;

[0031] The lipopolysaccharide LPS was purchased from Beyotime;

[0032] The c-di-AMP disodium was purchased from MCE;

[0033] The recombinant mouse M-CSF protein was purchased from proteintech;

[0034] The chloramphenicol was purchased from Beijing Solarbio Science & Technology Co., Ltd.;

[0035] The erythromycin was purchased from Macklin.

[0036] In the following examples, the nucleotide sequences are as follows:

[0037] Lactobacillus plantarum ( Lactobacillus plantarum ) The special gene sequence of WCSF1-0012 is shown in SEQ ID NO.1:

[0038] caccatcaagcagtgctaacaacaataatcaggctgacccattcgctaataatggcgatcaaattgatatctcggatgatgatttaccattctagtctaattgcttagacagataacgaggagggaaatatcaatggcacaacaaagaagaggtggccgtcgtcgtcgtaaagtcgacttcatcgccgcaaaccatatcgaatacatcgattataaagatactgacttattacgtcgctttatttcagaacgtgggaagattttgccacgtcgtgtaacggggactagtgctaagaaccaacgttctttaactatcgccatcaagcgtgcacggatcatgggcttattagcctttgtatctgaagactaatttttagtcattcaaaaaccacagacttcggctctgtggtttttatttacccttaacttgactagatagggtggtggccgttcaatgaagcgtttacggtgattgacacgaaacgctgaagcggacggtggtttgtgataaaatatagtcattactgagaaggcttgagggatttttaatgagtgagtctaaatgcaagttatttttttgaatgatgtccgtggtaagggcaagcggggccaaatcaagaatgtcccggatggttacgcgcagaactttttaattaaaaagggattggccaaggaagccactaaagcggcaatcaatacgttgaaggctgaacagaagtctgaagcagcacgtgccgctgaggaattagccgaagctaagcaa;

[0039] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials, reagents, etc. used can be obtained from commercial sources unless otherwise specified.

[0040] The following is a detailed description of some embodiments of the present invention in conjunction with the accompanying drawings. Without conflict, the following embodiments and the features in the embodiments can be combined with each other.

[0041] Example 1: Culture and preservation method of Lactobacillus plantarum ( Lactobacillus plantarum WCSF1-0012);

[0042] (1) Culturing method of strains;

[0043] Step 1: Take 100 µl of glycerol bacteria of Lactobacillus plantarum ( Lactobacillus plantarum WCSF1-0012), coat it on the MRS solid medium plate containing 1.5% agar, and anaerobically culture it at 37 °C for 72 h, then pick a single colony. Inoculate the single colony of Lactobacillus plantarum ( Lactobacillus plantarum WCSF1-0012) into the MRS liquid medium and culture it at 37 °C for 16 h for standby.

[0044] (2) Preservation and activation methods of strains;

[0045] Add 50% glycerol to the bacterial liquid of Lactobacillus plantarum ( Lactobacillus plantarum WCSF1-0012) in Step 1 to obtain a mixture with a final glycerol concentration of 25%. After mixing, place it in a -80 °C refrigerator, and it can be stored for 2 - 3 years. When activating, take out the glycerol cryopreservation tube, melt it under ice bath conditions, and use a sterile inoculation loop to inoculate the bacterial liquid into the pre-prepared MRS culture dish, and place it in an anaerobic incubator to grow for 48 h - 72 h, or until a complete colony grows in the culture dish, then subculture can be carried out.

[0046] Example 2: Detection of the relative content of c-di-AMP in Lactobacillus plantarum WCSF1-0012;

[0047] After the solid plate of Lactobacillus plantarum WCSF1-0012 and its comparison strain Lactobacillus plantarum WCSF1 are activated and subcultured, use an inoculation needle to pick single colonies into 10 mL of MRS seed liquid respectively, and anaerobically culture it at 37 °C for 12 - 16 h. Then take 2% of the seed liquid and add it to a centrifuge tube containing 10 mL of MRS medium, and statically culture it overnight for 12 - 16 h.

[0048] Adjust the cultured bacterial liquid to OD 600 ≈0.5, take 30 mL of the bacterial liquid, at 4 °C, 4,000 x g , centrifuge for 5 min, resuspend it in 250 µL of extraction buffer, store it at -20 °C for 30 min, 15,000 x g , at 4 °C, centrifuge for 10 min, extract the supernatant, and store it at -20 °C as Liquid 1; resuspend the precipitate in 125 µL of extraction buffer, store it at -20 °C for 15 min, 15,000 x g , at 4 °C, centrifuge for 5 min as Liquid 2. Melt Liquid 1 at 4 °C, mix it with Liquid 2, 15,000 x g, at 4 °C, centrifuge for 5 min, and take 100 µL of the supernatant as a sample for the targeted detection of c-di-AMP. Detection was performed by LC-MS, and the detection results are as Figure 1 shown.

[0049] Example 3: Lactobacillus plantarum WCSF1-0012 has the function of activating monocytes and macrophages;

[0050] After the solid plates of Lactobacillus plantarum WCSF1-0012 and its comparative strain Lactobacillus plantarum WCSF1 were activated and passaged, single colonies were picked with an inoculation needle into 10 mL of MRS seed liquid and anaerobically cultured at 37 °C for 12-16 h. Then, 2% of the seed liquid was taken and added to a centrifuge tube containing 10 mL of MRS medium, and statically cultured overnight for 12-16 h.

[0051] Use an ultraviolet-visible spectrophotometer to measure its absorbance at a wavelength of 600 nm (OD 600 ), and collect the bacterial suspension at the logarithmic growth phase (OD 600 ≈0.5-0.6) according to the centrifugation, discard the supernatant, add 10 mL of PBS and mix well for washing.

[0052] According to the previously determined OD-CFU comparison table, prepare 10 8 CFU / mL, 5x10 7 CFU / mL and 2.5x10 7 CFU / mL RPMI bacterial solution (the bacterial solution concentration in RPMI medium is 10 8 CFU / mL) for standby. Add 0.1 mL of RPMI bacterial solution, blank RPMI culture medium, and RPMI culture medium containing LPS and c-di-AMP to THP1 reporter cells, and treat them under the conditions of 37° and 5% CO2 for 2 h, centrifuge at 1500 rpm for 5 min, remove the bacterial solution, resuspend with 0.2 mL of PBS, centrifuge, re-add RPMI medium, treat under the conditions of 37° and 5% CO2 for 8 h, centrifuge to remove the medium, resuspend with 0.2 mL of PBS, centrifuge, re-add potassium D-luciferin solution, read the spontaneous fluorescence value, record the relative spontaneous fluorescence intensity unit R.L.U., and obtain the comparison results of the activation levels of NF-κB and ISRE by different strains and control stimulants.

[0053] As Figure 2 shown, the activation of WCSF1-0012 at MOI 25, 50, and 100 is stronger than that of Lactobacillus WCSF1.

[0054] Example 4: Lactobacillus plantarum WCSF1-0012 promotes macrophages to kill oral tumor cells;

[0055] Mouse primary bone marrow-derived macrophages induced by M-CSF were treated with blank medium, 10 ng / ml LPS, 10 μg / ml c-di-AMP, Lactobacillus plantarum WCSF1 at an MOI of 50, and Lactobacillus plantarum WCSF1-0012 at an MOI of 50 for 2 h. The treatment solution was removed, and the cells were washed twice with PBS. Take 2x10 5 Cal-27 cell line expressing luciferase-green fluorescent protein fusion protein and the 10 5 macrophages treated as described above were co-cultured with 2x10 5 Cal-27 cell line expressing luciferase-green fluorescent protein fusion protein overnight under the conditions of 37 °C and 5% CO2. The medium was removed, and the cells were resuspended in 0.2 mL PBS, centrifuged, and then D-luciferin potassium solution was added again. The autofluorescence value was read, and the relative autofluorescence intensity unit R.L.U. was recorded for comparing the survival rate of Cal-27 cells.

[0056] As Figure 3 shown, after co-culturing the macrophages treated with WCSF1-0012 with the Cal-27 cell line, the survival rate of the Cal-27 cell line decreased.

[0057] Example 5: The growth of Lactobacillus plantarum WCSF1-0012 can be inhibited by antibiotics;

[0058] After activation and passage of the solid plates of Lactobacillus plantarum WCSF1-0012 and its comparative strain Lactobacillus plantarum WCSF1, single colonies were picked with an inoculation needle into 10 mL MRS seed solution and anaerobically cultured at 37 °C for 12 - 16 h. Then, 2% of the seed solution was added to MRS medium containing different concentrations of erythromycin and chloramphenicol, and cultured overnight at 37 °C in a 96-well plate. The absorbance of the cultured bacterial solution at a wavelength of 600 nm was recorded to evaluate the inhibition of Lactobacillus plantarum WCSF1-0012 by antibiotics.

[0059] As Figure 4 shown, there was no significant difference in the inhibition degree of different concentrations of antibiotics on Lactobacillus plantarum WCSF1-0012 and its comparative strain WCSF1.

[0060] In the above examples, through in vitro experiments, namely the activation of monocytes-macrophages, the killing of oral tumor cells, and the detection of antibiotic resistance, it was found that Lactobacillus plantarum WCSF1-0012 of the present invention can activate immunity and inhibit oral tumors.

[0061] In addition, Lactobacillus plantarum WCSF1-0012 of the present invention is a Lactobacillus plantarum that can effectively inhibit oral tumors. This Lactobacillus is a safe lactic acid bacterium without toxic side effects, which can effectively inhibit oral tumors and even treat oral tumors. In addition, it has safety, low cost, high safety, and high reliability, and can be used to prepare drugs or food and beverages for preventing and even treating oral tumors.

[0062] The above embodiments only express the implementation modes of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. An application of Lactobacillus plantarum WCSF1-0012 in preparing a medicine for treating oral tumors, characterized in that: The Lactobacillus plantarum ( Lactobacillus plantarum )WCSF1-0012 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on December 19, 2024, with the deposit number CGMCC No.33131.

2. The use according to claim 1, characterized in that The medicine comprises a live strain of Lactobacillus plantarum WCSF1-0012.

3. The use according to claim 1, characterized in that: The drug includes pharmaceutically acceptable excipients.

4. The use according to claim 1, characterized in that The dosage form of the drug is tablet, capsule, oral solution or lyophilized powder.

5. The use according to claim 1, characterized in that: The content of Lactobacillus plantarum WCSF1-0012 in the drug is 10 8 CFU~10 11 CFU.