RNA, pharmaceutical compositions, conjugates and applications

Abstract

The present application relates to the technical field of retinal ischemia-reperfusion injury, and specifically to RNA, pharmaceutical compositions, conjugates and applications. The nucleotide sequence of the RNA is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. The RNA can inhibit the proliferation of retinal Müller cells, increase the changes in mitochondrial membrane potential of retinal Müller cells, promote Müller cell apoptosis, reduce Müller cell glial activation and protect ganglion cells from damage, reduce the inflammatory response of retinal ischemia-reperfusion injury, and has application prospects in the prevention and treatment of retinal ischemia-reperfusion injury.

Description

Technical Field

[0001] The present application relates to the technical field of retinal ischemia-reperfusion injury, and in particular to RNA, pharmaceutical compositions, conjugates and applications. Background Art

[0002] Retinal ischemia-reperfusion injury (RIRI) is the main pathological process leading to permanent visual impairment and blindness, and is associated with many eye diseases, such as acute glaucoma, diabetic retinopathy, ischemic optic neuropathy, retinal vascular occlusion, and retinopathy of prematurity (ROP) in neonates. "Ischemia" refers to the situation where local tissue blood supply is insufficient due to reasons such as vascular obstruction. "Reperfusion" refers to the process of restoring blood perfusion after tissue ischemia. In the retina, when ischemia occurs due to vascular obstruction, followed by recanalization of the blood vessels or restoration of blood flow, retinal ischemia-reperfusion injury may be triggered. This type of damage involves multiple pathological mechanisms such as oxidative stress, inflammatory response, and cell apoptosis. It is one of the key research topics in the field of ophthalmology, especially in the study of retinal vascular diseases, glaucoma and other diseases.

[0003] Currently, treatment strategies for RIRI focus on halting disease progression through intraocular injections (such as anti-vascular endothelial growth factor drugs), angiostatic steroids, eye drops, or surgical intervention. However, these treatments primarily target late-stage lesions through a single action, necessitating the development of novel therapies that limit early-stage lesions and have multiple actions. Summary of the Invention

[0004] The inventors of this application have creatively discovered an RNA that can inhibit the proliferation of retinal Müller cells, increase changes in mitochondrial membrane potential of retinal Müller cells, promote Müller cell apoptosis, reduce Müller cell glial activation and protect ganglion cells from damage, and reduce the inflammatory response of retinal ischemia-reperfusion injury. It has application prospects in the prevention and treatment of retinal ischemia-reperfusion injury.

[0005] To this end, the embodiments of the present application disclose at least the following technical solutions:

[0006] In a first aspect, the embodiments disclose an RNA, the nucleotide sequence of which is shown in SEQ ID NO: 1 (GAGUCCAGAGUGCUAACCAUUACAC) and / or SEQ ID NO: 2 (GUGUAAUGGUUAGCACUCUGGACUC).

[0007] In a second aspect, a pharmaceutical composition comprises the RNA described in the first aspect and a pharmaceutically acceptable diluent, carrier or adjuvant.

[0008] In a third aspect, the embodiments disclose a conjugate comprising the RNA of the first aspect.

[0009] In a fourth aspect, the embodiments disclose applications of the RNA described in the first aspect. The applications are selected from at least one of the following:

[0010] Preparation of drugs for preventing or treating retinal ischemia-reperfusion injury;

[0011] Preparation of drugs for preventing or treating diabetic retinopathy;

[0012] Preparation of drugs related to inhibiting retinal Müller cell proliferation;

[0013] Preparation of drugs related to increasing changes in mitochondrial membrane potential of retinal Müller cells;

[0014] Preparation of drugs related to promoting apoptosis of retinal Müller cells;

[0015] Preparation of drugs related to reducing Müller cell glial activation;

[0016] Preparation of drugs related to protecting ocular ganglia;

[0017] Preparation of drugs for reducing inflammatory response to retinal ischemia-reperfusion injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 These are the GFAP staining and GS staining images of primary mouse Müller cells provided in the examples.

[0019] Figure 2 The results of the CCK-8 assay for the inhibitory effect of RNA on mouse Müller cell viability are shown in the examples.

[0020] Figure 3 The results of the EdU method test show that RNA provides an inhibitory effect on the proliferation of mouse Müller cells.

[0021] Figure 4 The results of the rhodamine staining experiment test show the effect of the RNA provided in the example on the mitochondrial membrane potential of mouse Müller cells.

[0022] Figure 5 The results of the RNA-promoting apoptosis effect of Müller cells provided in the Calcein-AM / PI double staining experiment test example are shown.

[0023] Figure 6This is an example of Tuj1 staining identification of primary retinal ganglion cells extracted from retinal tissue.

[0024] Figure 7 The results of the PI / Hoechst double staining experiment test show that the RNA provided in the example inhibits the apoptosis of primary ganglion cells under Müller cell co-culture conditions.

[0025] Figure 8 The RNA provided in the retinal ischemia-reperfusion model animal experiment test example alleviates the mouse retinal tissue morphology caused by retinal ischemia-reperfusion injury.

[0026] Figure 9 The results of RNA reduction of GS-positive cells provided in the retinal ischemia-reperfusion model animal experiment test example are shown.

[0027] Figure 10 The results of the RNA provided in the retinal ischemia-reperfusion model animal experiment test example were used to increase NeuN-positive cells.

[0028] Figure 11 The mRNA expression detection results of RNA inhibiting the expression of inflammatory factors provided in the retinal ischemia-reperfusion model animal experiment test example.

[0029] Figure 12 The protein expression detection results of RNA inhibiting the expression of inflammatory factors provided in the animal experiment test example of the retinal ischemia-reperfusion model. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solutions and advantages of this application more clearly understood, the present application is further described in detail below with reference to the following examples. It should be understood that the specific examples described herein are merely for the purpose of explaining this application and are not intended to limit this application. Reagents not described in detail in this application are all conventional reagents and can be obtained from commercial channels; methods not specifically described in detail are all conventional experimental methods and can be obtained from the prior art.

[0031] The inventors of the present application have creatively discovered an RNA, the nucleotide sequence of which is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. The single-stranded molecule of the RNA (as shown in SEQ ID NO: 1 or SEQ ID NO: 2), or the double-stranded molecule of the RNA (composed of at least one of SEQ ID NO: 1 and SEQ ID NO: 2), can inhibit the proliferation of retinal Müller cells, increase the changes in mitochondrial membrane potential of retinal Müller cells, promote Müller cell apoptosis, reduce excessive glial activation of Müller cells, protect ganglion cells from damage, and reduce the inflammatory response to retinal ischemia-reperfusion injury. The invention has application prospects in the prevention and treatment of retinal ischemia-reperfusion injury.

[0032] In some test examples, the inhibitory effect of RNA such as SEQ ID NO: 1 on the proliferation of mouse Müller cells was tested using the CCK-8 method.

[0033] The testing process includes:

[0034] 1) Fresh retinal tissue was obtained from 7-day-old C57BL / 6J mice under sterile conditions and transferred to a mixture of DPBS containing 0.25% trypsin and DNase I, and digested at 37°C for 30 min. The cell pellet was collected by centrifugation, resuspended in DMEM complete medium containing 12% FBS, and plated on a 25 cm 2 Cell culture flasks were cultured in a 37°C incubator. Cells were passaged when the cell density reached 80%. Purified primary mouse Müller cells were obtained after about 3 passages. Purified primary mouse Müller cells were identified using GFAP and GS. Figure 1 As shown, the proportion of GFAP-positive and GS-positive cells reached 90%, indicating that the purity of Müller cells reached more than 90% and was used in subsequent experiments.

[0035] 2) Primary mouse Müller cells were cultured in DMEM medium containing 12% fetal bovine serum, 1% penicillin, and 1% streptomycin at 37°C in 5% CO2 in 24-well plates until the confluence reached approximately 60%. The cells were then divided into a model group (OGD / R), a treatment group (RNA), a non-treatment group (NC), and a blank group (Ctrl). In the treatment group, 1×10 5 Müller cells were mixed with lipofectamine 3000 (CatNo: L3000015, Thermo Fisher) and 50 nM RNA of SEQ ID NO: 1 and cultured for 6 h. In the non-treatment group, 1×10 5Müller cells were mixed with lipofectamine 3000 and 50 nM RNA of SEQ ID NO: 11 and cultured for 6 hours. Blank and model cells were cultured in the same volume of culture medium for 6 hours. The treated, untreated, and model cells, cultured for 6 hours, were then subjected to oxygen-glucose deprivation (OGD) followed by reoxygenation and re-glucose treatment (the blank cells were not subjected to OGD and re-glucose treatment). The culture medium was discarded and the cells were incubated with basal medium containing 10% CCK-8 (Cat No: C0038; Biyuntian, China) for color development at 37°C for 1 hour. The absorbance was measured at 450 nm, and the cell viability (%) of each group was calculated based on the absorbance. Cell viability was calculated as the percentage of the difference between the absorbance at 450 nm measured for each group and the absorbance at 450 nm of the blank group.

[0036] like Figure 2 As shown, the cell viability of the treatment group was lower than that of the model group, while that of the non-treatment group was higher than that of the model group, which indicates that the RNA provided by the present application can inhibit the proliferation of Müller cells.

[0037] In some test cases, the inhibitory effect of RNA such as SEQ ID NO: 1 on the proliferation of primary mouse Müller cells was tested by the EdU method.

[0038] The testing process includes:

[0039] 1) Müller cells were seeded into 24-well plates and cultured in complete medium containing 12% fetal bovine serum and 1% penicillin / streptomycin until the cell density reached about 60%. The cells were then divided into a model group (OGD / R), a treatment group (RNA), a non-treatment group (NC), and a blank group (Ctrl). In the treatment group, 2×10 5 Müller cells were mixed with lipofectamine 3000 and 50 nM RNA of SEQ ID NO: 1 and cultured for 6 hours. In the non-treatment group, Müller cells were mixed with lipofectamine 3000 and 50 nM RNA of SEQ ID NO: 11 and cultured for 6 hours. Cells in the blank group and the model group were added to the same volume of culture medium and cultured for 6 hours. The treated, non-treated, and model cells cultured for 6 hours were then treated with oxygen-glucose deprivation (OGD) followed by reoxygenation and re-glucose treatment (cells in the blank group were not treated).

[0040] 2) Discard the culture medium, wash the cells twice with PBS buffer, and use EdU working solution (EdU stock solution was diluted 1000 times with complete culture medium, EdU stock solution was obtained from BeyoClick TMEdU-488 cell proliferation detection kit, CatNo: C0071S, Biyuntian) was added to a 24-well plate at a volume of 1 mL / well; after incubation for 3 hours, the EdU working solution was discarded, 1 mL of 4% paraformaldehyde was added to each well, and fixed at room temperature for 15 minutes; the paraformaldehyde was discarded, 500 μL of washing solution (PBS containing 3% BSA) was added to each well, and washed 3 times, each time for 3-5 minutes; the washing solution was discarded, 500 μL of permeabilization solution (PBS containing 0.3% Triton X-100) was added to each well, and incubated at room temperature for 10-15 minutes; the permeabilization solution was discarded, and 500 μL of washing solution was added to each well, and washed 1-2 times, each time for 3-5 minutes; the washing solution was discarded, and the Click reaction solution was prepared according to the manufacturer's instructions, and 200 μL of Incubate the Click reaction solution at room temperature in the dark for 30 minutes. Discard the reaction solution and wash the wells 1-2 times with 500 μL of wash solution for 3-5 minutes each time. Discard the wash solution and add 200 μL of DAPI to each well and incubate at room temperature in the dark for 10 minutes. Discard the DAPI stain and wash the wells 3 times with 500 mL of PBS for 3-5 minutes each time. Photograph using a fluorescence microscope. Blue indicates DAPI signal and red indicates EdU signal.

[0041] like Figure 3 As shown, using OGD / R to simulate the pathological environment, the proliferation signal of Müller cells treated with the RNA provided in the examples of the present application was reduced, indicating that the RNA treatment provided in the examples of the present application can significantly inhibit the proliferation ability of Müller cells under pathological conditions induced by OGD / R.

[0042] In some test cases, the effect of RNA such as SEQ ID NO: 1 on the mitochondrial membrane potential of mouse primary Müller cells was tested by rhodamine staining experiment.

[0043] The testing process includes:

[0044] 1) Müller cells were seeded into 24-well plates and cultured in complete medium containing 12% fetal bovine serum and 1% penicillin / streptomycin until the cell density reached about 60%. The cells were then divided into a model group (OGD / R), a treatment group (RNA), a non-treatment group (NC), and a blank group (Ctrl). In the treatment group, 2×10 5Müller cells were mixed with lipofectamine 3000 and 50 nM RNA of SEQ ID NO: 1 and cultured for 6 hours. In the non-treatment group, Müller cells were mixed with lipofectamine 3000 and 50 nM RNA of SEQ ID NO: 11 and cultured for 6 hours. The blank group and model group cells were added with the same volume of culture medium and cultured for 6 hours. The treated group cells, non-treated group cells, and model group cells cultured for 6 hours were treated with oxygen-glucose deprivation (OGD) followed by reoxygenation and re-glucose treatment (the blank group cells were not treated with OGD and re-glucose treatment).

[0045] 2) Prepare 1 mL / mL of rhodamine stock solution in deionized water. Aspirate the culture medium from each cell well, wash twice with preheated sterile PBS, then add 1 mL of serum-free DMEM medium to each well. Then, add 5 μL of rhodamine stock solution in sequence. Place the wells in a 37°C, 5% CO2 incubator for staining for 30 min and photograph under an inverted fluorescence microscope.

[0046] like Figure 4 As shown, OGD / R was used to simulate the pathological environment, and the RNA provided in the examples of the present application significantly increased the changes in the mitochondrial membrane potential of Müller cells under OGD / R-induced pathological conditions.

[0047] In some embodiments, the effect of RNA of SEQ ID NO: 1 on inhibiting the apoptosis of Müller cells induced by OGD / R pathological conditions was tested by Calcein-AM / PI double staining assay.

[0048] The testing process includes:

[0049] 1) Müller cells were seeded into 24-well plates and cultured in complete medium containing 12% fetal bovine serum and 1% penicillin / streptomycin until the cell density reached about 60%. The cells were then divided into a model group (OGD / R), a treatment group (RNA), a non-treatment group (NC), and a blank group (Ctrl). In the treatment group, 2×10 5 Müller cells were mixed with lipofectamine 3000 and 50 nM RNA of SEQ ID NO: 1 and cultured for 6 hours. In the non-treatment group, Müller cells were mixed with lipofectamine 3000 and 50 nM RNA of SEQ ID NO: 11 and cultured for 6 hours. The blank group and model group cells were added with the same volume of culture medium and cultured for 6 hours. The treated group cells, non-treated group cells, and model group cells cultured for 6 hours were treated with oxygen-glucose deprivation (OGD) followed by reoxygenation and re-glucose treatment (the blank group cells were not treated with OGD and re-glucose treatment).

[0050] 2) Remove the culture medium from each cell group and wash twice with preheated sterile phosphate-buffered saline (PBS). Add 1 mL of serum-free DMEM to each cell, followed by 2 μL of a 1 mg / mL PI stock solution and 3 μL of a 1 mg / mL calcein-AM stock solution (DMSO). Incubate at 37°C, 5% CO₂ for 10 min. Observe under an inverted fluorescence microscope, using excitation at 490 ± 10 nm to visualize live cells (yellow-green), and at 545 nm to visualize dead cells (red). Photographs were taken. I represents the red dead cell signal, and calcein-AM represents the green live cell signal.

[0051] like Figure 5 As shown, using OGD / R to simulate the pathological environment, the RNA provided by the present application can significantly increase the apoptosis of primary mouse Müller cells under OGD / R-induced pathological conditions and reduce the glial activation of the cells.

[0052] In some embodiments, the effect of RNA of SEQ ID NO: 1 on inhibiting apoptosis of primary retinal ganglion cells under OGD / R-induced pathological conditions and Müller cell co-culture conditions was tested by PI / Hoechst double staining assay.

[0053] The testing process includes:

[0054] 1) Fresh retinal tissue was obtained from C57BL / 6J pups aged 0-3 days after birth. Retina tissue was transferred to a mixture of papain and DNase I in DPBS and digested at 37°C for 30 min. Cell pellets were collected by centrifugation, resuspended in DMEM complete medium containing 10% FBS, and plated on 25 cm 2 Cell culture flasks were incubated at 37°C. The culture medium was transferred to a cell culture dish coated with an anti-mouse macrophage antibody (Cat No: MABF2252; Millipore) for primary purification. Unbound cell suspension was transferred to a culture dish coated with an anti-Thy1.2 antibody (Cat No: ab269343; Abcam) for secondary purification. The supernatant was discarded, and mouse retinal ganglion cell culture medium (Cat No: CM-M122; Pronocell) was added, and the cells were gently pipetted on the bottom of the dish to obtain a suspension of primary mouse retinal ganglion cells. Cells were seeded onto culture plates and cultured at 37°C. Identification and experiments were performed when the cell density reached 80%. Purified primary mouse ganglion cells were immunostained with the ganglion-specific antibody Tuj1 (XY-809, Xinyu Biotechnology). If the proportion of Tuj1-positive cells reached 90%, the primary retinal ganglion cells were at least 90% pure and could be used for subsequent experiments. Figure 6The figure shows the identification of Tuj1, and the purity of the obtained primary retinal ganglion cells is over 90%.

[0055] 2) Place 1×10 5 Müller cells were seeded in the upper chamber of a 24-well cell co-culture system, and primary ganglion cells were seeded in the bottom chamber of the co-culture system. The cells were cultured in complete medium containing 12% fetal bovine serum and 1% penicillin / streptomycin until the cell density reached approximately 60%. The cells were then divided into a blank group (Ctrl), a model group (OGD / R), a treatment group (RNA), and a non-treatment group (NC). In the treatment group, Müller cells were co-cultured with 50 nM RNA of SEQ ID NO: 1 for 6 hours. In the non-treatment group, Müller cells were co-cultured with lipofectamine 3000 and 50 nM of SEQ ID NO: 11 for 6 hours. The blank and model group cells were added to the same volume of culture medium and cultured for 24 hours. The treated, non-treated, and model group cells, which had been cultured for 24 hours, were then treated with oxygen-glucose deprivation (OGD / R) followed by reoxygenation and re-glucose treatment (the blank group cells were not treated). The primary ganglion cells in each group were stained with PI / Hoechst staining.

[0056] like Figure 7 As shown, using OGD / R to simulate a pathological environment and co-culturing with primary mouse Müller cells treated with the RNA provided in this application can inhibit apoptosis of primary ganglion cells. This shows that the RNA treatment provided in this application significantly inhibits apoptosis of primary mouse ganglion cells under OGD / R-induced pathological conditions.

[0057] In some test cases, the effect of RNA such as SEQ ID NO: 1 on alleviating retinal ischemia-reperfusion injury was tested in animal experiments using a retinal ischemia-reperfusion model.

[0058] The testing process includes:

[0059] 1) 6-8 week old C57BL / 6J mice (Institute of Model Animals, Nanjing University) were anesthetized with an intraperitoneal injection of ketamine (80 mg / kg) and xylazine (4 mg / kg). Mydriasis was then applied pre-corneal with 0.5% tropicamide and 2.5% phenylephrine, followed by anesthesia with 0.4% lidocaine hydrochloride. After pupil dilation, a 30-gague needle was inserted into the anterior chamber under a microscope and connected to sterile saline drip to elevate and maintain intraocular pressure at 80-100 mmHg for 45 minutes. After 45 minutes, the needle was carefully removed, and intraocular pressure was allowed to return to normal. To prevent bacterial infection, tobramycin ointment was applied to the eyes. Seven days after modeling, a significant decrease in retinal thickness and GCL cell number was observed, indicating successful modeling. Animal experiments were then performed at this time.

[0060] 2) C57BL / 6J normal mice were used as the blank group (Ctrl), and the retinal ischemia-reperfusion model mice were divided into a model group (RIR), a treatment group (RNA), and a non-treatment group (NC). The mice in the blank group and the model group were not treated. On the third day after modeling, the mice in the treatment group were injected with 1 nmol 1 μL of RNA such as SEQ ID NO: 1 into the vitreous cavity. On the 7th day after modeling, the retinal tissues of the mice were collected for HE staining of paraffin sections and immunofluorescence staining of frozen sections. On the third day after modeling, the mice in the non-treatment group were injected with 1 nmol 1 μL of RNA such as SEQ ID NO: 11 into the vitreous cavity. On the 7th day after modeling, the retinal tissues of the mice were collected for HE staining of paraffin sections and immunofluorescence staining of frozen sections.

[0061] A HE staining assay involves general anesthesia of mice in each group with intraperitoneal injection of ketamine (80 mg / kg) and xylazine (4 mg / kg). The mice are then immobilized with their heads, limbs, and tails positioned with the abdomen facing upward. The chest and abdominal hair are removed, the skin at the xiphoid process is incised, the fascia is bluntly dissected, and the ribs are severed to expose the thoracic cavity. After perfusion of the left ventricle with normal saline, the eyeballs are immediately harvested for paraffin sectioning. The paraffin sections are then placed in a 65°C oven for 25 minutes. The sections are then dewaxed and hydrated with xylene for 30 minutes, anhydrous ethanol for 2 minutes, 95% ethanol for 2 minutes, 80% ethanol for 2 minutes, 70% ethanol for 2 minutes, and ddH2O for 2 minutes. The sections are then incubated with hematoxylin for 5 minutes, washed with water to remove the stain, and incubated with eosin for 2 minutes. The sections are then dehydrated with graded ethanol to achieve transparency, mounted with neutral gum, and allowed to dry for photography.

[0062] like Figure 8 As shown, in RIR model mice, intravitreal injection of the RNA provided by the present application alleviated the decrease in thickness of the entire retinal layer and inner plexiform layer (IPL) of the mouse retina, and reduced the loss of ganglion cells in the ganglion cell layer (GCL). The results showed that the RNA provided by the present application alleviated the changes in retinal tissue morphology of mice caused by retinal ischemia-reperfusion injury.

[0063] The immunofluorescence staining assay process for frozen sections included the following steps: retinal tissue was collected from mice on day 7 after modeling and frozen sections were prepared; after rinsing with PBS to remove OCT gel, the sections were blocked and permeabilized with 1% Triton X-100 and 5% BSA for 45 minutes; glutamine synthetase (GS) (Cat No: ab228590, Abcam) and neuronal nuclear antigen antibody (NeuN antibody, Cat No: ab177487, Abcam) were prepared in appropriate proportions and incubated with the sample tissue overnight at 4°C; the next day, the sections were incubated with the corresponding secondary antibodies in the dark for 2 hours, and images were recorded using a fluorescence microscope.

[0064] like Figure 9 、 10As shown, in RIR model mice, after intravitreal injection of the RNA provided by the present application, the number of GS-positive cells (cells expressing glutamine synthetase) decreased and the number of NeuN-positive cells (cells that specifically bind to neuronal nuclear antibodies and show positive signals) increased, indicating that the RNA provided by the present application alleviates RIR-induced mouse retinal glial activation and thereby alleviates ganglion cell damage.

[0065] In some test cases, the changes in inflammatory factors in the above-mentioned animal model experiments were also tested.

[0066] The testing process includes:

[0067] 1) Total RNA was extracted from retinal homogenates of each mouse group using a Cellular RNA Column Extraction Kit (Cat No: RC112-01; Nanjing Novozymes Biotech Co., Ltd.). RNA quality and purity were determined by spectrophotometry. Reverse transcription and PCR reagent SYBR Green (Cat Nos: RC112-01, 18091050, 100029284; Nanjing Novozymes Biotech Co., Ltd.) was used to generate cDNA for real-time quantitative PCR. Amplification was performed using 4 μL of 2× SYBR Green qPCR Master Mix, 1 μL of a mixture of 10 μM upstream primer and 10 μM downstream primer (as shown in Table 1), 1 μL of cDNA, and 4 μL of double-distilled water. Amplification was performed using the ABI 7500 Real-Time PCR System: 95°C for 30 seconds, 95°C for 5 seconds, and 60°C for 34 seconds for a total of 40 cycles. Melting curve analysis was then performed at 95°C for 15 seconds, 60°C for 1 minute, 95°C for 30 seconds, and 60°C for 15 seconds. Each sample was replicated three times. β-actin was used as an internal reference gene, and the ct values ​​were calculated using the 2-ΔΔct method. In addition, mouse IL-1β, IL-6, and TNF-α ELISA kits (Cat Nos. MM-0040M2, MM-0163M2, and MM-0132M2, Wuhan Enzyme Immunoassay Biotechnology Co., Ltd.) were used to detect IL-1β, IL-6, and TNF-α protein expression in the retinas of mice in each group.

[0068] Table 1

[0069] Gene Upstream primer (5'→3') Downstream primer (5'→3') IL-1β GCCTGTGTTTTCCTCCTTGC, SEQ ID NO:3 TGCTGCCTAATGTCCCCTTG, SEQ ID NO:4 IL-6 TCCATCCAGTTGCCTTCTTG, SEQ ID NO:5 TTCCACGATTTCCCAGAGAAC, SEQ ID NO:6 TNF-α CAGGCGGTGCCTATGTCTC, SEQ ID NO:7 CGATCACCCCGAAGTTCAGTAG, SEQ ID NO:8 β-actin GGGAAATCGTGCGTGAC, SEQ ID NO:9 AGGCTGGAAAAGAGCCT, SEQ ID NO:10

[0070] like Figure 11 and 12 As shown, in RIR model mice, after intravitreal injection of the RNA provided by this application, the level of retinal inflammatory factor RNA was reduced, indicating that the RNA provided by this application can significantly reduce RIR-induced retinal inflammation in mice.

[0071] Based on the above test examples, the present application found that RNA such as SEQ ID NO: 1 and / or 2 can inhibit the proliferation of retinal Müller cells, increase the changes in mitochondrial membrane potential of retinal Müller cells, promote Müller cell apoptosis, reduce Müller cell glial activation and protect ganglion cells from damage, reduce the inflammatory response of retinal ischemia-reperfusion injury, and has application prospects in the prevention and treatment of retinal ischemia-reperfusion injury.

[0072] Based on this, the embodiment discloses an RNA, whose nucleotide sequence is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0073] The embodiments disclose pharmaceutical compositions comprising the RNA described herein and a pharmaceutically acceptable diluent, carrier, or adjuvant.

[0074] The Examples disclose conjugates comprising the RNA described herein.

[0075] The embodiment discloses the application of the RNA. The application is selected from at least one of the following:

[0076] Preparation of drugs for preventing or treating diabetic retinopathy;

[0077] Preparation of drugs for preventing or treating retinal ischemia-reperfusion injury;

[0078] Preparation of drugs related to inhibiting retinal Müller cell proliferation;

[0079] Preparation of drugs related to increasing changes in mitochondrial membrane potential of retinal Müller cells;

[0080] Preparation of drugs related to promoting apoptosis of retinal Müller cells;

[0081] Preparation of drugs related to reducing Müller cell glial activation;

[0082] Preparation of drugs related to protecting ocular ganglia;

[0083] Preparation of drugs for reducing inflammatory response to retinal ischemia-reperfusion injury.

[0084] In one embodiment of the present application, the oligomeric compound is connected to a ligand / conjugate, which can, for example, be used to increase the cellular uptake of the antisense RNA. This conjugation can occur at the 5' / 3' terminal position, but the ligand can also occur on a sugar and / or base. In particular, the growth factor to which the antisense RNA can be conjugated can include transferrin or folic acid. Transferrin-polylysine-RNA complexes or folic acid-polylysine-RNA complexes can be prepared for uptake by cells expressing high levels of transferrin or folic acid receptors. Other examples of conjugates / ligands are cholesterol moieties, duplex intercalators such as acridine, poly-L-lysine, "capping" with one or more nuclease-resistant linking groups such as monothioate, etc. The application also provides conjugates comprising a compound according to the present application as described herein, and at least one non-nucleotide or non-polynucleotide portion covalently attached to the compound. Thus, in one embodiment in which the compounds of the present application consist of a specified nucleic acid, as disclosed herein, the compound may further comprise at least one non-nucleotide or non-polynucleotide moiety (e.g., not comprising one or more nucleotides or nucleotide analogs) covalently attached to the compound. The non-nucleotide base moiety may, for example, be or comprise a sterol such as cholesterol.

[0085] Thus, it will be appreciated that the RNA of the present application, for example for use in pharmaceutical (therapeutic) formulations, may comprise further non-nucleotide base components, such as conjugates as defined herein.

[0086] Based on this, the embodiments disclose the RNA and a pharmaceutically acceptable diluent, carrier or adjuvant.

[0087] The RNA of the present application can be used directly or in the form of various pharmaceutically acceptable salts. As used herein, the term "pharmaceutically acceptable salt" refers to a salt that retains the desired biological activity of the RNA identified herein and exhibits minimal undesirable toxicological effects. Non-limiting examples of such salts can be formed with organic amino acids, and base addition salts formed with metal cations or cations formed by ammonium, N, N-dibenzylethylenediamine, D-glucosamine, tetraethylammonium or ethylenediamine, such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium, potassium, etc.

[0088] In some embodiments, RNA can be in the form of a prodrug. RNA is negatively charged ions in nature. Due to the lipophilic nature of cell membranes, cellular uptake of RNA is reduced compared to neutral or lipophilic equivalents. This polarity 'hinderance' can be avoided by using a prodrug approach (see, for example, Crooke, RM (1998) in Crooke, STAntisense research and Application. Springer-Verlag, Berlin, Germany, vol. 131, pp. 103-140).

[0089] Pharmaceutically acceptable binders and adjuvants may form part of the formulated pharmaceutical composition.

[0090] The pharmaceutical compositions of the present application include but are not limited to solutions, emulsions or liposome-containing preparations. These compositions can be produced from a variety of components, including but not limited to preformed liquids, self-emulsifying solids and self-emulsifying semisolids. The delivery of drugs to tumor tissues can be enhanced by carrier-mediated delivery, including but not limited to cationic liposomes, cyclodextrins, porphyrin derivatives, branched dendrimers, polyethyleneimine polymers, nanoparticles and microspheres (DassCR.J Pharm Pharmacol 2002; 54 (1): 3-27). The pharmaceutical preparations of the present application that can be conveniently present in unit dosage form can be prepared according to conventional techniques well known to the pharmaceutical industry. Such techniques include the step of contacting the active ingredient with a pharmaceutical carrier or excipient. In general, the preparation is prepared by: uniformly and closely contacting the active ingredient with a liquid carrier or a finely separated solid carrier or both, and then molding the product if necessary. The composition of the present application can be formulated into any of many possible dosage forms, such as but not limited to tablets, capsules, gel capsules, liquid syrups, soft gels and suppositories. The compositions of the present application can also be formulated as suspensions in aqueous, non-aqueous, or mixed media. Aqueous suspensions can further contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension can also contain stabilizers. The compounds of the present application can also be conjugated with active pharmaceutical ingredients such as aspirin, ibuprofen, sulfonamides, antidiabetics, antibacterials, or antibiotics.

[0091] The above is only a preferred specific implementation method of the present application, but the scope of protection of the present application is not limited thereto. Any changes or replacements that can be easily thought of by any technician familiar with this technical field within the technical scope disclosed in this application should be included in the scope of protection of this application.

Claims

1. A use of RNA, characterized in that, The use is to prepare a drug for preventing or treating retinal ischemia-reperfusion injury, or to prepare a drug related to reducing the inflammatory response of retinal ischemia-reperfusion injury; Wherein, the nucleotide sequence of the RNA is shown as SEQ ID NO.1.

Images