RNAi interference system of ADGRG6 gene and application of RNAi interference system

Abstract

The invention discloses an RNAi interference system of an ADGRG6 gene and application of the RNAi interference system, and relates to the technical field of biological medicines. The invention discloses an application of an RNAi interference system of an ADGRG6 gene in preparation of a medicine for treating pancreatic cancer. The RNAi interference system of the ADGRG6 gene comprises a knockdown system and a knockout system. Results of the embodiment of the invention show that the interference system knocks down and knocks out protein expression of the ADGRG6 gene, can inhibit proliferation, invasion and migration of pancreatic cancer cells, and has no adverse effect on nude mouse health. Therefore, the knockout or knockout system of the ADGRG6 gene, provided by the invention, has a very good application prospect in preparation of the medicines for treating the pancreatic cancer.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and more specifically, relates to an RNAi interference system of ADGRG6 gene and application thereof. Background Art

[0002] Pancreatic cancer is one of the most deadly malignant tumors in the world, and its incidence rate continues to rise at a rate of 0.6%-1% per year. Due to the insidious onset of pancreatic cancer, some pancreatic cancer patients are already unresectable or have distant metastases at the time of initial diagnosis. Even for patients with early pancreatic cancer who receive surgery combined with postoperative chemotherapy, most patients will still experience disease recurrence within three years. And when recurrence occurs, it is often systemic and multi-site, and the clinical effect of treatment is poor. The mFOLFIRINOX regimen, NALIRIFOX regimen and AG regimen have become the first-line standard regimens for patients with metastatic pancreatic cancer. However, due to the poor general condition of patients with advanced pancreatic cancer and poor tolerance to chemotherapy, the treatment regimen is limited to traditional chemotherapy, with limited efficacy and large side effects, and patients have little clinical benefit. Secondly, compared with other malignant tumor microenvironments, dendritic cells and effector T cells are scarce in pancreatic cancer. Therefore, the clinical benefits of pancreatic cancer immunotherapy are limited to a small number of patients with mismatch repair gene defects. In summary, it is of great significance to further study the occurrence and development mechanism of pancreatic cancer.

[0003] Adhesion G protein-coupled receptor G6 (ADGRG6) belongs to G-protein-coupled receptors (GPCRs). GPCRs are the largest protein superfamily in the human genome. They are considered important early diagnostic biomarkers for tumors because of their key role in regulating and activating tumor-related signaling pathways. More than 40% of drugs target GPCRs and their related pathways. Therefore, the development of GPCR-related drugs has great potential.

[0004] Existing studies have found mutations in intron 6 of ADGRG6 in 2.7% of cancer sequences, and ADGRG6 copy number variations are associated with reduced patient survival. Another study showed that the ADGRG6 enhancer is frequently mutated in bladder transitional cell carcinoma and breast adenocarcinoma. Among bladder cancer patients, the probability of ADGRG6 somatic mutations in patients with invasive bladder cancer is significantly higher than that in non-invasive bladder cancer, suggesting that ADGRG6 intron mutations are associated with tumor progression. In urothelial carcinoma, reduced ADGRG6 expression reduces the ability of endothelial cells to recruit and induce tube formation. In lung cancer, ADGRG6 promotes cancer by fusing with other oncogenes. ADGRG6 also promotes the proliferation of pancreatic cancer cells and plays a specific tumorigenic role in patients with acute myeloid leukemia. A bioinformatics-based study showed that the expression of ADGRG6 transcription levels may be associated with prognosis in pancreatic cancer (https: / / doi.org / 10.1186 / s13020-021-00534-y). In addition, studies have shown that ADGRG6 can directly activate the Akt-mTOR signaling pathway through Gai to promote tumor malignant biological behavior (https: / / doi.org / 10.1073 / pnas.2117004119). Existing studies have shown that increased expression of Gai3 promotes the growth of pancreatic cancer cells (https: / / doi.org / 10.1038 / s41419-024-07079-6).

[0005] Therefore, detecting the expression of ADGRG6 in pancreatic cancer, analyzing its correlation with various clinical indicators, clarifying the role and molecular mechanism of ADGRG6 in promoting the progression of pancreatic cancer, and exploring the application of targeting ADGRG6 in the treatment of pancreatic cancer are of great significance for breakthroughs in the clinical diagnosis and treatment of pancreatic cancer. Summary of the invention

[0006] In view of the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide an RNAi interference system of the ADGRG6 gene. Another technical problem to be solved by the present invention is to provide an application of the RNAi interference system of the ADGRG6 gene for preparing a drug for treating pancreatic cancer.

[0007] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0008] The RNAi interference system of the ADGRG6 gene includes a knockdown system and a knockout system; the sequence of the knockdown system is as follows:

[0009] ①ADGRG6-RNAi (120823-1)-a:

[0010] 5'-CcggCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGGTTTTTg-3',

[0011] ADGRG6-RNAi (120823-1)-b:

[0012] 5'-aattcaaaaaCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGG-3';

[0013] and / or ②ADGRG6-RNAi (120824-1)-a:

[0014] 5'-CcggCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGGTTTTTTg-3',

[0015] ADGRG6-RNAi (120824-1)-b:

[0016] 5'-aattcaaaaaCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGG-3';

[0017] The knockout system described has the following sequence:

[0018] ADGRG6-sgRNA (14104-1)-a: 5'-CACCgCTGAATGATATAACCGGTGG-3',

[0019] ADGRG6-sgRNA (14104-1)-b: 5'-aaacCCACCGGTTATATCATTCAG-3'.

[0020] Application of the RNAi interference system of the ADGRG6 gene in the preparation of a drug for treating pancreatic cancer, wherein the RNAi interference system of the ADGRG6 gene comprises a knockdown system and a knockout system.

[0021] The target sequence of the knockdown system is as follows:

[0022] ①ADGRG6-RNAi (120823-1): CCTCACTTTCATCAGCTATAT,

[0023] and / or ②ADGRG6-RNAi (120824-1): CCAAGCAATAATGAATCGTAT.

[0024] The target sequence of the knockout system is as follows:

[0025] ADGRG6-sgRNA (14104-1): CTGAATGATATAACCGGTGG.

[0026] The knockdown system sequence is:

[0027] ①ADGRG6-RNAi (120823-1)-a:

[0028] 5'-CcggCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGGTTTTTg-3',

[0029] ADGRG6-RNAi (120823-1)-b:

[0030] 5'-aattcaaaaaCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGG-3';

[0031] and / or ②ADGRG6-RNAi (120824-1)-a:

[0032] 5'-CcggCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGGTTTTTTg-3',

[0033] ADGRG6-RNAi (120824-1)-b:

[0034] 5'-aattcaaaaaCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGG-3'.

[0035] The knockout system sequence is:

[0036] ADGRG6-sgRNA (14104-1)-a: 5'-CACCgCTGAATGATATAACCGGTGG-3',

[0037] ADGRG6-sgRNA (14104-1)-b: 5'-aaacCCACCGGTTATATCATTCAG-3'.

[0038] The application of the RNAi interference system of the ADGRG6 gene in the preparation of a drug for treating pancreatic cancer is to inhibit the proliferation, migration, invasion and growth of pancreatic cancer cells.

[0039] Application of ADGRG6 gene in the preparation of drugs for treating pancreatic cancer, and designing and preparing drugs with ADGRG6 gene as a target.

[0040] Compared with the prior art, the present invention has the following beneficial effects:

[0041] 1) The present invention constructs ADGRG6 shRNA knockdown vector, ADGRG6 CRISPR-Cas9 knockout vector, and ADGRG6 overexpression vector, and transfects the ADGRG6 shRNA knockdown vector, ADGRG6 CRISPR-Cas9 knockout vector, and ADGRG6 overexpression vector into human primary pancreatic cancer cells (primary pancreatic cancer-1, priPC-1), respectively, to construct pancreatic cancer cells expressing ADGRG6-shRNA stably, pancreatic cancer cells highly expressing wild-type ADGRG6 (ADGRG6-OE), and priPC-1 pancreatic cancer cells with CRISPR- ADGRG6-KO. The results show that the protein expression of ADGRG6 in the three types of stable cell lines, ADGRG6-shRNA, ADGRG6-OE, and CRISPR-ADGRG6-KO, is as expected. Knockdown of ADGRG6 inhibited the colony formation, proliferation, invasion and migration ability of human primary pancreatic cancer cells priPC-1. Conversely, overexpression of ADGRG6 enhanced the proliferation, migration and invasion ability of pancreatic cancer cells.

[0042] 2) The present invention established female BALB / c nude mice carrying priPC-1 xenografts by subcutaneously injecting priPC-1 cells expressing ADGRG6-shRNA ("sh-ADGRG6-s1" and "sh-ADGRG6-s2") and non-specific control shRNA ("shC") (each nude mouse was injected with 1×10 6 The results showed that compared with the nonspecific control shRNA ("shC"), the volume and weight of sh-ADGRG6-s1 or sh-ADGRG6-s2priPC-1 allograft tumors were significantly smaller than those of shC priPC-1 xenografts. Importantly, no significant differences in body weight were observed among the three experimental groups, indicating no adverse effects on nude mouse health. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1The number of ADGRG6 transcripts in 60 pancreatic cancer tissues and adjacent per-cancer tissues analyzed for the GEO dataset (A); the number of ADGRG6 transcripts in 178 pancreatic cancer tissues (“Tumor”) and 171 normal pancreatic tissues (“Normal”) analyzed in the TCGA-GTEx-PAAD cohort Relative transcripts of mRNA (B); ADGRG6 protein expression in 137 pancreatic cancer tissues ("Tumor") and 74 normal pancreatic tissues ("Normal") analyzed by CPTAC dataset (C); Receiver operating characteristic (ROC) curve of the prognostic potential of ADGRG6 overexpression associated with the overall survival probability of pancreatic cancer patients (D); Kaplan-Meier survival analysis of overall survival, disease-specific survival, progression-free survival and disease-specific survival based on ADGRG6 expression in TCGA-PAAD dataset (EH); ADGRG6 protein expression in the described pancreatic cancer cells and human normal pancreatic epithelial cells ("hTERT-HPNE") (IJ); "*" indicates P < 0.05, which is statistically significant.

[0044] Figure 2 The protein expression of ADGRG6 in ADGRG6-shRNA stable cell line (A), colony formation (B), proliferation (C), cell migration (D) and invasion (E); the protein expression of ADGRG6 in CRISPR- ADGRG6-KO stable cell line (F), proliferation (G), migration (H) and invasion (I); the protein expression of ADGRG6 in ADGRG6-OE stable cell line (J). The cells were further cultured for the specified time period, and the proliferation (K), migration (L) and invasion (M) are shown in the figure. The expression of EMT-related markers was analyzed by Western blot (L). Compared with the "shC" group and the "Vec" group, "*" represents P < 0.05, which is statistically significant; scale bar = 100μm.

[0045] Figure 3Female BALB / c nude mice bearing priPC-1 xenografts were established by subcutaneous injection of priPC-1 cells expressing ADGRG6 shRNA ("sh-ADGRG6-s1" and "sh-ADG RG6-s2") and scrambled control shRNA ("shC"), respectively. The tumor volume (A) and body weight (D) of nude mice were measured every five days. After 35 days, all tumors were harvested (B) and tumor weights (C) were recorded. Western blot analysis (E) was used to analyze the expression of ADGRG6 protein in tumor tissue lysates. The data are expressed as mean ± standard deviation (SD). Compared with the "shC" group, "*" represents P < 0.05, which is statistically significant. DETAILED DESCRIPTION

[0046] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. Unless otherwise specified in the following embodiments, the technical means used are conventional means well known to those skilled in the art.

[0047] The human primary pancreatic cancer cell lines (priPC-1 and priPC-2) used in this application were extracted from tumor tissues of two patients with pancreatic cancer who were diagnosed with pancreatic cancer by pathology in the Department of Oncology of Kunshan First People's Hospital. The process was informed and the informed consent was signed in accordance with the requirements of the Ethics Committee. The normal pancreatic epithelial cell line hTERT-HPNE and three pancreatic cancer cell lines (PATU-8988, CFPAC-1, BxPC3) were purchased from the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China).

[0048] Example 1

[0049] The datasets in the TCGA database (https: / / www.cancer.gov / ccg / research / genome-sequencing / tcga) and the GEO database (https: / / www.ncbi.nlm.nih.gov / geo / ) were downloaded from their respective official websites. The downloaded data were sorted and analyzed using SPSS 23.0 (SPSS Co., Chicago, IL). Figure 1 The result is AH. The following is Figure 1 Detailed description of each result:

[0050] The results are as follows Figure 1As shown in A, the GEO dataset (GSE62452) shows that the number of ADGRG6 transcripts in 60 cases (GEO database is an online database, which means 60 cases in the database) of pancreatic cancer tissues matches that in adjacent paracancerous tissues. The results show that the expression of ADGRG6 mRNA in pancreatic cancer is higher than that in adjacent normal tissues (A).

[0051] The results are as follows Figure 1 As shown in B, the pancreatic cancer cohort in TCGA-GTEx (TCGA-GTEx database is also an online database, and 178 pancreatic cancer and 171 normal pancreatic cancer tissues were downloaded from it) shows the relative transcripts of ADGRG6 mRNA in 178 pancreatic cancer tissues ("Tumor") and 171 normal pancreatic tissues ("Normal"). The results show that the TCGA-GTEx database verifies the same conclusion as above (B).

[0052] The results are as follows Figure 1 As shown in C, the CPTAC dataset (https: / / ualcan.path.uab.edu) shows the protein expression of ADGRG6 in 137 pancreatic cancer tissues ("Tumor") and 74 normal pancreatic tissues ("Normal") (also an online database, which contains 137 pancreatic cancer and 74 normal pancreatic tissues). The results show that the CPTAC database shows that the expression of ADGRG6 protein in pancreatic cancer is much higher than that in adjacent normal tissues (C).

[0053] The results are as follows Figure 1 D shows the receiver operating characteristic (ROC) curve used to evaluate the prognostic potential of ADGRG6 overexpression and the overall survival probability of pancreatic cancer patients. The results showed that the ROC curve analysis of ADGRG6 mRNA expression level had a good predictive value for the one-year, three-year, and five-year survival of pancreatic cancer patients (D).

[0054] The results are as follows Figure 1 As shown in EH, based on the expression of ADGRG6 in the TCGA-PAAD dataset, Kaplan-Meier survival analysis was performed on overall survival, disease-specific survival, progression-free survival, and disease-specific survival. The results showed that the relationship between the expression level of ADGRG6 and prognosis in four datasets in the GEO database (GSE21501, GSE85916, GSE62452, and GSE78229) was analyzed, and the overall survival of pancreatic cancer patients with high ADGRG6 expression was significantly reduced compared with patients with low expression (EH).

[0055] The results are as follows Figure 1As shown in IJ, the expression of ADGRG6 protein in pancreatic cancer cells and human normal pancreatic epithelial cells ("hTERT-HPNE") was shown, and the results were quantified. The results showed that the protein expression level of ADGRG6 in commercial pancreatic cancer cell lines (CFPAC-1, PATU-8988, BxPC3) and human primary pancreatic cancer cells (priPC-1, priPC-2) was also higher than that in normal pancreatic cells (IJ).

[0056] Example 2

[0057] 1. Construction of ADGRG6 shRNA knockdown system

[0058] For the ADGRG6 gene sequence (Gene ID: 57211; GenBank ID: NM_020455), an RNAi interference system specifically targeting the ADGRG6 gene was constructed to construct the ADGRG6 shRNA knockdown system. The target sequence of the RNAi interference system of the ADGRG6 gene is as follows:

[0059] ADGRG6-RNAi (120823-1): CCTCACTTTCATCAGCTATAT,

[0060] ADGRG6-RNAi (120824-1): CCAAGCAATAATGAACGTAT.

[0061] The final sequence of the knockdown system of the ADGRG6 gene is as follows:

[0062] ADGRG6-RNAi (120823-1)-a:

[0063] 5'-CcggCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGGTTTTTg-3',

[0064] ADGRG6-RNAi (120823-1)-b:

[0065] 5'-aattcaaaaaCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGG-3';

[0066] ADGRG6-RNAi (120824-1)-a:

[0067] 5'-CcggCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGGTTTTTTg-3',

[0068] ADGRG6-RNAi (120824-1)-b:

[0069] 5'-aattcaaaaaCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGG-3';

[0070] The linearized GV493 vector was obtained by digestion with restriction endonucleases AgeI and EcoRI, and the primers were annealed to form double-stranded DNA. The linearized vector was ligated with the double-stranded DNA and transformed to obtain the ADGRG6 shRNA knockdown vector shRNA-ADGRG6-s1 / s2, where shRNA-ADGRG6-s1 corresponds to ADGRG6-RNAi (120823-1) and shRNA-ADGRG6-s2 corresponds to ADGRG6-RNAi (120824-1).

[0071] 2. Construction of ADGRG6 CRISPR-Cas9 knockout system

[0072] For the ADGRG6 gene sequence (Gene ID: 57211; GenBank ID: NM_020455), the sgRNA target sequence was designed, and the sequence is as follows:

[0073] ADGRG6-sgRNA (14104-1): CTGAATGATATAACCGGTGG.

[0074] Sent to the company (Shanghai GeneCare Gene Medical Technology Co., Ltd.) to synthesize single-stranded DNA oligo (PAGE purification), the sequence is as follows:

[0075] ADGRG6-sgRNA (14104-1)-a: 5'-CACCgCTGAATGATATAACCGGTGG-3',

[0076] ADGRG6-sgRNA (14104-1)-b: 5'-aaacCCACCGGTTATATCATTCAG-3'.

[0077] The two ends of the double-stranded DNA were annealed to form double-stranded DNA, which was then connected to the Lenti-CAS9-puro vector. The connected product was transformed using TOP10 competent cells, and the positive clones were obtained by colony PCR and sequenced to obtain the correct sequence of the lentiviral vector ko-ADGRG6 expressing sgRNA to knock out ADGRG6, corresponding to ADGRG6-sgRNA (14104-1).

[0078] 3. Construction of ADGRG6 overexpression vector

[0079] Use BamHI / AgeI to digest the GV492 vector to obtain a linearized vector. Use primers to PCR amplify the 3830bp target gene fragment (SEQ ID NO.1). The PCR amplification primer sequences are as follows:

[0080] ADGRG6 (90976-1)-p1:

[0081] 5'-AGGTCGACTCTAGAGGATCCCGCCACCATGATGTTTCGCTCAGATCGAATGTGG-3',

[0082] ADGRG6 (90976-1)-p2:

[0083] 5'-TCCTTGTAGTCCATACCGCATGGGCCAGTTTTGACAAGGACTTG-3'.

[0084] The linearized vector and the target gene amplification product were subjected to recombination reaction to achieve in vitro circularization of the linearized vector and the target gene fragment. The recombinant product was directly used to transform 293T cells, and the single clones on the plate were picked for PCR identification, and the positive single clones were sequenced and analyzed. The correct cloned bacterial solution was expanded and extracted to obtain a high-purity plasmid, which was then used to package lentivirus, thereby obtaining a lentiviral vector OE-ADGRG6 with a correct sequence overexpressing ADGRG6, corresponding to ADGRG6 (90976-1).

[0085] 4. Transfection of target cells

[0086] The ADGRG6 shRNA knockdown vector and control vector ("shC"), ADGRG6 CRISPR-Cas9 knockout vector and control vector ("Cas9-C"), ADGRG6 overexpression vector and control vector ("Vec") were transfected into human primary pancreatic cancer cells priPC-1, and pancreatic cancer cells expressing shRNA-ADGRG6-s1 / s2 stably transfected with pancreatic cancer cells, pancreatic cancer cells highly expressing wild-type OE-ADGRG6, and pancreatic cancer cells with CRISPR-KO-ADGRG6 were constructed; the specific steps are as follows:

[0087] 1) Culture of pancreatic cancer cell lines

[0088] Human primary pancreatic cancer cells priPC-1 were cultured in DMEM containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Pen / Strep). On the first day, human primary pancreatic cancer cells priPC-1 were inoculated in a six-well plate, with 100,000 cells per well; on the second day, at MOI=10, the number of cells was 200,000. The volume of lentivirus to be added to each well was calculated according to the virus concentration, and the transfer reagent was added at the same time. Gently mix, place in a 37°C, 5% CO2 incubator for 24 hours, and replace with fresh complete medium to remove residual viruses.

[0089] 2) Screening of stable transgenic lines

[0090] Determine the working concentration of puromycin: First, conduct an antibiotic killing experiment and test different concentrations of puromycin (0.5-10 μg / mL) in uninfected primary human pancreatic cancer cells priPC-1. Record the survival of cells at different concentrations and determine that the lowest puromycin concentration that can kill all uninfected cells is 2 μg / mL).

[0091] Puromycin selection: Add puromycin working concentration to the culture medium of target cells after transfection. Replace the culture medium containing puromycin every 2-3 days until the uninfected control cells are completely dead (7 days).

[0092] Screening for stable expression strains: After the screening is completed, the successfully transfected cell population (or monoclonal strain) continues to be cultured in a low-concentration puromycin (1 μg / mL) culture medium.

[0093] 3) Extraction of total cell protein

[0094] Total cell protein was extracted using standard RIPA buffer. First, cultured cells were washed by conventional methods before treatment to remove the culture medium. Subsequently, the cells were frozen and gently resuspended in phosphate-buffered saline (PBS) on ice. To completely lyse the cells, RIPA buffer containing 1% Triton X-100, 0.5% sodium deoxycholate, and 0.1% SDS was added. The lysis buffer also contained a mixture of protease inhibitors (such as PMSF and complex inhibitors) to prevent protein degradation during the extraction process. The cell suspension was repeatedly pipetted and then centrifuged at 12,000g for 10 minutes at 4°C, and the supernatant was collected, which was the total cell protein solution. The extracted protein solution was frozen at -80°C for future use. The protein concentration was determined by the BCA method to ensure the protein amount in subsequent experiments.

[0095] 4) Western blot

[0096] 20 μg protein samples were heated to 95°C for 5 minutes and then separated using 10% polyacrylamide gel using SDS-PAGE electrophoresis system. After electrophoresis, the proteins were transferred to polyvinylidene fluoride (PVDF) membranes by transfer method. The transfer conditions were 110V for 1.5 hours, and an ice bath was used to reduce the temperature rise of the membrane. After transfer, the PVDF membrane was washed with Tris-buffered saline (TBST) to remove non-specifically bound proteins and blocked with 5% skim milk powder solution at room temperature for 1 hour. After blocking, the membrane was incubated in ADGRG6 primary antibody solution (1:2000) and ADGRG6 antibody stock solution (purchased from Biorbyt, https: / / www.biorbyt.com / ) at 4°C overnight. Then, the membrane was washed 3 times with TBST buffer for 5 minutes each time to remove excess primary antibody. Subsequently, the membrane was incubated in the corresponding HRP-labeled secondary antibody solution for 1 hour at room temperature. After incubation with the secondary antibody, the membrane was washed again with TBST buffer for 3 times, 5 minutes each time. Finally, chemiluminescent reagent (ECL) was used for color development.

[0097] 5) Cell plate cloning experiment

[0098] Collect cells in logarithmic growth phase, prepare single cell suspension after trypsin digestion. Count cells with a hemocytometer and adjust the cell density to a concentration suitable for the experiment (1×10^3 cells). Add 2 mL of culture medium to each well of a 6-well plate. Inoculate an appropriate amount of single cell suspension (500 cells) in each well and shake gently to evenly distribute the cells. Place the culture plate in a 37°C, 5% CO2 incubator for 14 days, and replace fresh culture medium every 2-3 days to keep the cells in good condition. Use an inverted microscope to observe the formation of cell clones. Usually, each clone containing more than 50 cells is considered a valid clone. Carefully aspirate the culture medium and gently wash the cells twice with PBS. Add 1-2 mL of 4% paraformaldehyde solution and fix at room temperature for 15 minutes. After fixation, wash the cells 1-2 times with PBS. Add 0.1% crystal violet stain (or Giemsa stain) to each well to cover the surface of the cell clones. Stain at room temperature in the dark for 15-30 minutes. Carefully aspirate the stain and wash 3 times with PBS until there is no obvious background staining. Allow the plates to air dry at room temperature.

[0099] 6) Edu proliferation assay

[0100] Preparation of reagents and consumables: EdU reagent and fluorescent labeling reagent (Click-iT™ EdU Alexa Fluor™ kit, purchased from RiboBio), 4% paraformaldehyde (PFA), permeabilization solution (0.3%-0.5% Triton X-100 solution, prepared in PBS), and Click reaction reagent.

[0101] Experimental steps: Add EdU reagent at a final concentration of 10μM to the cell culture medium and mix gently. Incubate the cells in a 37℃, 5% CO2 incubator for 72 hours. Aspirate the culture medium and gently wash the cells 1-2 times with PBS. Add 4% paraformaldehyde solution and fix at room temperature for 10-15 minutes. Aspirate the fixative and wash the cells 1-2 times with PBS. Add 0.3%-0.5% Triton X-100 solution and incubate at room temperature for 10-15 minutes to permeabilize the cell membrane. Click reaction solution preparation: According to the instructions of the kit, the Click reaction mixture is prepared, which contains the following components: copper ions (CuSO4) as a catalyst, ethyleneimine (sodiumascorbate) as a reducing agent, and fluorescent azide (Alexa Fluor™ azide). Add the Click reaction mixture and incubate at room temperature for 30 minutes to 1 hour under light-proof conditions. Aspirate the reaction solution and wash the cells 2-3 times with PBS. Use DAPI or Hoechst dye to stain the cell nucleus (stain for 5-10 minutes at room temperature in the dark). Observe the cells under a fluorescence microscope at an appropriate excitation wavelength. EdU-labeled cell nuclei will show specific fluorescence signals, and cell proliferation can be evaluated based on fluorescence intensity and distribution. Randomly select three fields of view and count the proportion of EdU-positive cells or changes in fluorescence intensity. Use software such as ImageJ for fluorescence quantitative analysis.

[0102] 7) Migration experiment

[0103] Add 100 μL of cells suspended in low serum medium to the upper chamber of the Transwell (cell number is 5×10^4). Gently tap or shake the chamber to ensure that the cells are evenly distributed. Add complete medium to the lower chamber. Add 600 μL of complete medium containing 10% FBS to the lower chamber of the Transwell and incubate the Transwell chamber in a 37°C, 5% CO2 incubator for 24 hours. Carefully remove the Transwell chamber and discard the medium in the upper and lower chambers. Wash the upper chamber of the Transwell 2-3 times with PBS to remove cells that have not migrated or invaded. Add 4% cell fixative to the upper chamber and fix at room temperature for 15-20 minutes. After fixation, wash the cells with PBS. Add 0.1% crystal violet stain and stain at room temperature for 15-30 minutes. After staining, wash off the excess stain with PBS. Gently wipe the inner surface of the upper chamber membrane with a cotton swab to remove cells that have not migrated or invaded, ensuring that only cells on the outer surface of the membrane are retained. Microscope observation: Observe and photograph the cells on the outer surface of the Transwell membrane with an inverted microscope. Three fields of view were randomly selected, and the number of cells in each field of view was counted.

[0104] 8) Invasion assay

[0105] Add 100ul of matrix gel solution (the ratio of matrix gel to low-concentration serum culture medium is 1:9) to the bottom of the Transwell upper chamber, place it at 37°C for 30 minutes, and then absorb the excess liquid. The subsequent steps are the same as the migration experiment.

[0106] The results are as follows Figure 2 As shown in the figure, Western blot results showed that the protein expression of ADGRG6 in the three stable cell lines of shRNA-ADGRG6-s1 / s2, OE-ADGRG6, and CRISPR-KO-ADGRG6 was as expected. Knockdown of ADGRG6 inhibited the colony formation, proliferation, migration and invasion of pancreatic cancer cells. On the contrary, overexpression of ADGRG6 enhanced the proliferation, migration and invasion of pancreatic cancer cells.

[0107] Example 3

[0108] Female BALB / c nude mice (16-18 g) aged five to six weeks were purchased and housed in-house under standard conditions. Female BALB / c nude mice bearing human primary pancreatic cancer cell priPC-1 xenografts were established by subcutaneous injection of human primary pancreatic cancer cell priPC-1 expressing ADGRG6-shRNA ("sh-ADGRG6-s1" and "sh-ADGRG6-s2") and nonspecific control shRNA ("shC") (1 × 10 cells / mL per nude mouse) 6 The tumor volume (A) and body weight (D) of nude mice were measured every 5 days with a digital caliper. After 35 days, all tumors were harvested (B), and tumor weights were recorded (C). The expression of ADGRG6 protein in tumor tissue lysates was evaluated using Western blot analysis (E), and the results were quantified. Data are expressed as mean ± standard deviation (SD). Compared with the "shC" group, "*" represents P < 0.05, which is statistically significant; "ns" represents no statistical significance.

[0109] The results are as follows Figure 3 As shown, the volume and weight of the tumor in the experimental group sh-ADGRG6-s1 or sh-ADGRG6-s2 were significantly smaller than those in the shC control group. No significant difference in the body weight of nude mice was observed among the three groups, indicating that there was no adverse effect on the health of nude mice.

Claims

1. RNAi interference system of ADGRG6 gene, including knockdown system and knockout system; the sequence of the knockdown system is as follows: ①ADGRG6-RNAi (120823-1)-a: 5'-CcggCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGGTTTTTg-3', ADGRG6-RNAi (120823-1)-b: 5'-aattcaaaaaCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGG-3'; and / or ②ADGRG6-RNAi (120824-1)-a: 5'-CcggCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGGTTTTTTg-3', ADGRG6-RNAi (120824-1)-b: 5'-aattcaaaaaCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGG-3'; The knockout system described has the following sequence: ADGRG6-sgRNA (14104-1)-a: 5'-CACCgCTGAATGATATAACCGGTGG-3', ADGRG6-sgRNA (14104-1)-b: 5'-aaacCCACCGGTTATATCATTCAG-3'.

2. Use of the RNAi interference system of the ADGRG6 gene according to claim 1 in the preparation of a drug for treating pancreatic cancer, wherein the RNAi interference system of the ADGRG6 gene comprises a knockdown system and a knockout system.

3. The use according to claim 2, characterized in that: The target sequence of the knockdown system is as follows: ①ADGRG6-RNAi (120823-1): CCTCACTTTCATCAGCTATAT, and / or ②ADGRG6-RNAi (120824-1): CCAAGCAATAATGAATCGTAT.

4. The use according to claim 2, characterized in that: The target sequence of the knockout system is as follows: ADGRG6-sgRNA (14104-1): CTGAATGATATAACCGGTGG.

5. The use according to claim 3, characterized in that: The knockdown system sequence is: ①ADGRG6-RNAi (120823-1)-a: 5'-CcggCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGGTTTTTg-3', ADGRG6-RNAi (120823-1)-b: 5'-aattcaaaaaCCTCACTTTCATCAGCTATATCTCGAGATATAGCTGATGAAAGTGAGG-3'; and / or ②ADGRG6-RNAi (120824-1)-a: 5'-CcggCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGGTTTTTTg-3', ADGRG6-RNAi (120824-1)-b: 5'-aattcaaaaaCCAAGCAATAATGAATCGTATCTCGAGATACGATTCATTATTGCTTGG-3'.

6. The use according to claim 4, characterized in that: The knockout system sequence is: ADGRG6-sgRNA (14104-1)-a: 5'-CACCgCTGAATGATATAACCGGTGG-3', ADGRG6-sgRNA (14104-1)-b: 5'-aaacCCACCGGTTATATCATTCAG-3'.

7. The use according to claim 2, characterized in that: Inhibit pancreatic cancer cell proliferation, migration, invasion and growth.

8. Application of ADGRG6 gene in the preparation of drugs for treating pancreatic cancer.

9. The use according to claim 8, characterized in that: Design and prepare drugs targeting the ADGRG6 gene.

Images