Plasmid vector containing cucumber mosaic virus Fny isolate mutant RNA1 and application thereof

Abstract

The invention discloses a plasmid vector containing cucumber mosaic virus Fny isolate mutant RNA1 and application of the plasmid vector, and belongs to the technical field of plant virology and molecular biology. The plasmid vector contains a CMVFny isolate mutant RNA1 (ribonucleic acid 1), and the nucleotide sequence of the CMVFny isolate mutant RNA1 is as shown in SEQ ID NO. 1. According to the present invention, the structure of the RNA1 of the cucumber mosaic virus Fny isolate is modified so as to provide the cucumber mosaic virus Fny isolate with weak toxicity; and when being used as a vaccine vector, the vaccine vector at least can accommodate 200bp exogenous fragments and maintain genetic stability, thereby providing a basis for developing multivalent attenuated vaccines.

Description

Technical Field

[0001] The invention relates to the technical field of plant virology and molecular biology, and in particular to a plasmid vector containing mutant RNA1 of cucumber mosaic virus Fny isolate and application thereof. Background Art

[0002] In agricultural production, plant viral diseases are second only to fungal diseases in terms of the extent to which they harm plants. More than 700 plant viral diseases have been discovered, harming 147 crops, with more than 80 found on vegetables alone (Guo Wanzhuo et al., 2010). Since plants do not have a complete immune system and lack effective control agents and measures, plant viral diseases are difficult to control. Once an epidemic breaks out, it will cause heavy losses.

[0003] Through the continuous deepening of cross-protection research, attenuated vaccine prevention and control technology has attracted more and more attention and has been continuously developed. A virus usually has multiple strains. The strains that do not show or only show mild symptoms of viral disease after infecting plants are called attenuated strains. After the attenuated strain of the virus infects the plant in advance, it induces the plant's own immune system, and when it is infected by the same virus again, it will stimulate "immunity" and protect it from the invasion of the virulent strain (Lou Hu et al., 2017).

[0004] In the process of developing attenuated vaccines, in order to achieve safe, efficient and stable cross-protection and prevention effects, the newly constructed vaccines need to have the following requirements: First, the attenuated vaccine created should be weakly pathogenic, and will not produce obvious symptoms when inoculated into plants, and will not affect the growth of plants; second, the basic vector for creating attenuated vaccines should have broad host characteristics, should have a certain ability to infect various plants, and be able to resist reinfection by virulent strains of multiple viruses; third, after the attenuated vaccine is pre-vaccinated, it should have good genetic stability within a certain period of time, and be able to maintain the long-term immune effect of the vaccine.

[0005] Cucumber mosaic virus (CMV) is one of the plant viruses with the widest host range known so far. CMV consists of three genomic RNAs: RNA1, RNA2, and RNA3, as well as subgenomic RNAs 4 and RNA4A (Sivakumaran et al., 2002). Among them, RNA1 encodes a protein called 1a. The sequence of protein 1a is highly conserved and has two functional domains. The N-terminal domain has methyltransferase activity and is used to add cap structures to the 5' end of genomic and subgenomic RNAs, while the C-terminal domain of the 1a protein is a putative helicase whose function is to "unwind" the double-stranded RNA produced during viral replication. RNA2 encodes 2a and 2b proteins. 2a protein has RNA-dependent RNA polymerase (RdRp) activity and participates in the virus replication process together with 1a protein (Palukaitis et al., 1992; Rozanov et al., 1992); 2b protein is translated from the subgenomic RNA chain in the 3′ part of RNA2 called RNA4A. CMV2b protein is involved in long-distance virus movement, expression of systemic symptoms and inhibition of gene silencing. RNA3 encodes subgenomic RNA4 to express 3a protein and coat protein (CP). 3a protein is related to cell-to-cell movement and long-distance transport of the virus in the host, so it is also called movement protein (MP). CP is the only protein associated with virus particles and the only determinant of aphid vector transmission (Nagano et al., 2001; Llamas et al., 2006).

[0006] Cucumber mosaic virus has a wide host range, rich isolate resources, and a tripartite genome that confers multiple site mutations and pseudo-recombination selection, which has good potential for developing attenuated vaccine vectors. In previous studies, mutation modification was mainly performed on cucumber mosaic virus RNA2 to construct an attenuated vaccine with a genetically stable CMV backbone and good cross-protection effect. However, there are few reports on attenuated vaccine vectors constructed for cucumber mosaic virus RNA1. Summary of the invention

[0007] In view of the above-mentioned prior art, the purpose of the present invention is to provide a mutant plasmid vector containing cucumber mosaic virus Fny isolate RNA1 and its application. The present invention structurally transforms the RNA1 of cucumber mosaic virus Fny isolate to make it weakly toxic; using it as a vaccine vector, it can accommodate at least 200bp of exogenous fragments and maintain genetic stability, providing a basis for the development of multivalent attenuated vaccines.

[0008] To achieve the above object, the present invention adopts the following technical solution:

[0009] In the first aspect of the present invention, a plasmid vector containing a mutant RNA1 of a cucumber mosaic virus Fny isolate is provided, which is named pCC F R1-3U m2 , the plasmid vector contains CMV Fny Isolate mutant RNA1.

[0010] The CMV Fny The mutant RNA1 of the isolate has a multiple cloning restriction site GGATCCGTCGACCCCGGG (BamH I, SalI, Sma I) inserted between nucleotides 3079-3080 of RNA1; CMV Fny The nucleotide sequence of the isolated mutant RNA1 is shown in SEQ ID NO.1.

[0011] The second aspect of the present invention provides the plasmid vector pCC F R1-3U m2 The preparation method comprises the following steps:

[0012] CMV Fny RNA1 infectious cloning plasmid pCB301-CMV Fny -R1 was used as a template, and reverse PCR amplification was performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain a linearized vector; BamHI restriction enzyme digestion and ligation technology were used to finally obtain the plasmid vector pCC F R1-3U m2 .

[0013] Preferably, the conditions for inverse PCR amplification are: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 54°C for 15 s, extension at 72°C for 4 min, 30 cycles; complete extension at 72°C for 5 min; and storage at 4°C.

[0014] The third aspect of the present invention provides the plasmid vector pCC F R1-3U m2 Application in constructing attenuated plant virus vaccines.

[0015] The fourth aspect of the present invention provides the plasmid vector pCC F R1-3U m2 Its application as a attenuated vaccine in the prevention and treatment of cucumber mosaic virus disease.

[0016] The fifth aspect of the present invention provides a plant attenuated vaccine, comprising: a plasmid vector pCC F R1-3U m2 , wild-type CMV Fny RNA2 and wild-type CMV Fny RNA3.

[0017] Preferably, the plasmid vector pCC F R1-3U m2 , wild-type CMV Fny RNA2 and wild-type CMV Fny The concentration ratio of RNA3 was 1:1:1.

[0018] Beneficial effects of the present invention:

[0019] (1) The present invention retains the protein coding sequence of cucumber mosaic virus 1a, inserts a multiple cloning restriction site GGATCCGTCGACCCCGGG (BamHI, SalI, SmaI) between nucleotides 3079-3080 of RNA1, and obtains a cucumber mosaic virus attenuated mutant. The plasmid is combined with a CMV-containing Fny Mixed inoculation of the RNA2 and RNA3 plasmids of the isolates can prevent infection by virulent strains of CMV and can be used as a weak vaccine against cucumber mosaic virus.

[0020] (2) The attenuated vaccine vector pCC of cucumber mosaic virus obtained by the present invention F R1-3U m2 As the basic vector for the construction of multivalent attenuated vaccines, it can accommodate at least 200bp of exogenous fragments and maintain genetic stability, providing more virus types to choose from for the construction of multivalent attenuated vaccines.

[0021] (3) The attenuated mutant of cucumber mosaic virus obtained in the present invention can be used as the basic vector for constructing a multivalent attenuated vaccine. By using the introduced multiple cloning restriction sites, other important plant virus sequences can be inserted to obtain a multivalent attenuated vaccine against yellow CMV and other viruses. The attenuated vaccine vector based on RNA1 can be used alone or mixed with the attenuated vaccine vector based on RNA2 as needed to increase the range of target viruses that the vaccine can prevent and treat. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : Basic vector pCB301-CMV Fny -R1, mutant vector pCC F R1-3U m2 and mutant pCC for determination of insertion length of foreign fragments F R1-3U m2-PDS schematic diagram; in the figure, LB, T-DNA left border (LB); RB, T-DNA right border (RB); 35S, promoter (from gene 2x35S); RZ, ribozyme (HDV-RZ); NOS, terminator (NOS terminator).

[0023] Figure 2 : Vector pCC F R1-3U m2 Schematic diagram of electrophoresis of enzyme digestion identification results; the marker is the 1kb DNA Ladder molecular weight standard of GenStar Company, and the fragment after digestion is about 8.0kb.

[0024] Figure 3 :pCC F R1-3U m2 Determination of pathogenicity and cross-protection against CMV on Nicotiana benthamiana; mock, empty Agrobacterium culture; R1, CMV Fny RNA1; R2, CMV Fny RNA2; R3, CMV Fny RNA3.

[0025] Figure 4 :pCC F R1-3U m2 Determination of the length limit of the foreign fragment. A. Determination of the pathogenicity of the foreign fragment insertion mutant; R1, CMV Fny RNA1; R2, CMV Fny RNA2; R3, CMV Fny RNA3; P100 and P200 represent PDS sequences with lengths of 100 bp and 200 bp, respectively; dpi, days after inoculation. B. RT-PCR detection of genetic stability of exogenous fragment insertion mutants; where the marker is the D2000 molecular weight standard of Tiangen Company. DETAILED DESCRIPTION

[0026] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0027] As introduced in the background technology, the genetic stability, pathogenicity and ability to accommodate exogenous fragments of the basic vector are key indicators for measuring the performance of the basic vector. CMV is a tripartite RNA virus that encodes a total of 5 proteins, of which the 1a protein contains important viral replicase components, including methyltransferase and helicase domains (Seo et al., 2009), and together with the 2a protein completes the replication of the viral genome. The 3' end of CMV RNA1 is a highly homologous conserved region of about 300nt, containing a TLS structure of about 135nt in length (Rietveld et al., 1983; Rizzo et al., 1989), which can interact with the viral replicase and is a necessary structure for the synthesis of negative-strand RNA in vitro of the virus. In the previous study, the inventors mainly carried out mutation modification on RNA2 of CMV, but lacked in-depth research on RNA1.

[0028] UTR is the untranslated region, located at the 5' and 3' ends of mature mRNA, does not encode protein, but has translation regulation function and is involved in the stability and intracellular localization of mRNA. In order to obtain a cucumber mosaic virus Fny isolate mutant RNA1 with weak toxicity, the present invention mutated the 3' untranslated region of cucumber mosaic virus RNA1.

[0029] The present invention has found that the selection of the position for the transformation of the 3' untranslated region of the cucumber mosaic virus RNA1 is very critical, which directly affects the toxicity and the ability to accommodate exogenous fragments of the transformed plasmid vector containing the mutant RNA1 of the cucumber mosaic virus Fny isolate. The present invention tried to insert multiple cloning restriction sites at different positions of the 3' untranslated region of the cucumber mosaic virus RNA1 during the experiment. The results showed that the toxic mutation directions were different, and the ability to accommodate exogenous fragments was also very different, which was unpredictable. For example: inserting a multiple cloning restriction site at 3150bp of the cucumber mosaic virus RNA1, its toxicity became stronger, becoming a highly toxic mutant, and the ability to accommodate exogenous fragments was 100bp; while inserting a multiple cloning restriction site at 3079bp of the cucumber mosaic virus RNA1, its toxicity was weakened, becoming a weakly toxic mutant, and the ability to accommodate exogenous fragments was increased to 200bp.

[0030] Therefore, in order to obtain a stable attenuated mutant with the ability to accommodate exogenous fragments, the present invention transforms the 3' untranslated region of cucumber mosaic virus RNA1. The basic vector of the present invention is to insert a multi-cloning restriction site GGATCCGTCGACCCCGGG (BamHI, SalI, SmaI) between nucleotides 3079-3080 of RNA1 to obtain a mutant CMV Fny RNA1 plasmid vector pCC F R1-3U m2 . Plasmid vector pCCF R1-3U m2 CMV Fny The nucleotide sequence of RNA1 is shown in SEQ ID NO.1, and is as follows:

[0031] GGATCCGTCGACCCCGGG tctccctcttcgggcggggatctgagttggcggtaatctgcaaaccgtctgaagtcactaaacacattgtgtggtgaacgggttgtccatccagctaacggctaaaatggtcagtcgtggagaaatccacgccagtagac ttacaagtctctgaggcacctttgaaaccatctcctaggtttcttcggaaggacttcggtccgtgtacttctagcacaacgtgctagtttcagggtacgggtgccccccactttcgtgggggtctctaaaaggagacca

[0032] In the above sequence, lowercase letters represent CMV Fny RNA1 sequence, capital letters represent the introduced exogenous sequence, and underlines represent restriction sites.

[0033] By adopting this design of the present invention, the integrity of the 1a protein can be ensured while the ability of the vector to accommodate exogenous fragments is increased to 200 bp. Positions 3079-3080 of RNA1 are far from the TLS region stem-loop structure "caacg" of the 3'UTR of RNA1 and will not destroy "caacg". The present invention indirectly reduces the accumulation level of the 1a protein by modifying and regulating the 3'UTR of the 1a protein, thereby showing attenuated symptoms.

[0034] In a preferred embodiment of the present invention, a mutant CMV Fny RNA1 plasmid vector pCC F R1-3U m2 The construction method is as follows:

[0035] According to the CMV published in GenBank Fny RNA1 sequence (accession number: D00356), designed primers Fny1-BSS-3080-F and Fny1-B-3079-R (detailed information see Table 1). Fny -R1 was used as a template, and reverse PCR amplification was performed under the action of Phanta Max Super-Fidelity DNA Polymerase (Vazyme). After the plasmid template was degraded by DpnI (NEB), the PCR amplified fragment was digested with BamHI and then self-ligated. The ligated product was transformed into Escherichia coli DH5α, and the vector pCC was confirmed by colony PCR, plasmid digestion and DNA sequencing. F R1-3U m2The vector pCC F R1-3U m2 Insert the multiple cloning restriction site GGATCCGTCGACCCCGGG (BamHI, SalI, SmaI) between nucleotides 3079-3080 of RNA1 Figure 1 ).

[0036] Table 1: Primers used in the present invention

[0037]

[0038] Note: Protected bases are in bold and restriction sites are underlined.

[0039] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0040] The experimental materials used in the examples of the present invention that are not specifically described are all conventional experimental materials in the art and can be purchased through commercial channels. If the specific experimental conditions and methods are not specified in the examples of the present invention, conventional conditions are usually followed, such as J. Sambrook et al., ed., Molecular Cloning Experiment Guide (3rd Edition), Science Press, 2002; DL Spector et al., ed., Cell Experiment Guide, Science Press, 2001; or the conditions recommended by the manufacturer.

[0041] Example 1. Vector pCC F R1-3U m2 Build:

[0042] CMV Fny Infectious cloning plasmid pCB301-CMV Fny -R1 is a template (CMV Fny The construction of the infectious cloning plasmid pCB301-Fny1 was based on “Construction of CMV infectious cloning and 2b deletion mutant mediated by Agrobacterium tumefaciens”, Yao Min et al., Chinese Agricultural Science, 2011, 44(14): 3060-3068). Inverse PCR amplification was performed under the action of Phanta Max Super-Fidelity DNA Polymerase (Vazyme), with primers Fny1-BSS-3080-F and Fny1-B-3079-R; PCR conditions: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 54°C annealing for 15 s, 72°C extension for 4 min, 30 cycles; 72°C complete extension for 5 min; 4°C storage; the amplified PCR product was the linearized basic vector pCC F R1-3U m2 .

[0043] Degradation of plasmid template pCB301-CMV in PCR reaction using DpnI (NEB) Fny -R1, reaction conditions: 37°C, 1h; 80°C, 20min; the product was recovered by anhydrous ethanol precipitation method: add ddH2O to 450μl of the product, add 50μl pH5.2, 3.0mM sodium acetate, 1ml anhydrous ethanol, precipitate at -80°C for 2h; centrifuge at room temperature at 12000rpm for 10min, pour out the liquid, add 600μl 70% ethanol; centrifuge at room temperature at 12000rpm for 5min, pour out the liquid; centrifuge at room temperature at 12000rpm for 1min, then aspirate the liquid in the centrifuge tube and add 30μl ddH2O to dissolve it again.

[0044] The product was then digested with BamHI (Takara) and recovered. The digested product was recovered with a DNA recovery kit and then self-ligated at 16°C overnight under the action of T4 DNA ligase (Takara). The ligated product was transformed into Escherichia coli DH5α and coated on an LB plate with 100 μg / mL kanamycin. The vaccine basic vector pCC was confirmed by colony PCR, plasmid digestion identification and DNA sequencing. F R1-3U m2 .

[0045] Result analysis: The PCR product was self-ligated after BamHI digestion. After the transformation product was initially screened by colony PCR, the plasmid was extracted for restriction digestion identification. BamHI and SmaI were used for restriction digestion identification respectively. The digestion results showed that the plasmid could be linearized by these two enzymes, and the length of the linearized plasmid was about 8.0 kb ( Figure 2 ), basically confirming that the plasmid contains multiple cloning sites of BamHI, SalI and SmaI, and finally confirmed by DNA sequencing of the plasmid.

[0046] The vaccine basic vector pCC constructed in this example F R1-3U m2 A multiple cloning restriction site GGATCCGTCGACCCCGGG (BamHI, SalI, SmaI) was inserted between nucleotides 3079-3080 of RNA1.

[0047] Example 2. Plasmid vector pCC F R1-3U m2 Determination of biological effects and cross-protection effects:

[0048] Agrobacterium infiltration and infection of Nicotiana benthamiana: First, CMV-containing Fny R1-3U m2 , wild-type CMV Fny RNA2, wild-type CMV FnyThe plasmids of RNA3 were transformed into competent cells of Agrobacterium GV3101, respectively, and evenly spread on LB solid medium (50 μg / ml kanamycin, 100 μg / ml rifampicin), cultured at 28°C for 48 h, picked a single plaque for colony PCR verification, and then picked a single plaque in 2 ml LB culture medium (50 μg / ml kanamycin, 100 μg / ml rifampicin), 28°C, 200 rpm shaking culture for 24 h.

[0049] Take 100 μl of bacterial solution and add it to 5 ml LB culture medium (50 μg / ml kanamycin, 100 μg / ml rifampicin), and culture at 28°C with shaking at 200 rpm until OD 600 It is 1.0-2.0.

[0050] Place the bacterial suspension in a 10 ml centrifuge tube and centrifuge at 6000 rpm for 10 min at room temperature; collect the bacterial cells and resuspend them in 1 ml of Agrobacterium resuspension solution (10 mM MgCl2, 10 mM MES, 0.15 mM AS) and adjust the concentration to OD 600 The OD of the three bacterial cultures was 1.2. 600 Consistent.

[0051] Adjust the OD of the three 600 Value of bacterial solution (containing CMV Fny R1-3U m2 、CMV Fny RNA2, CMV Fny RNA3) in equal proportions and incubate at 28°C for 3 h.

[0052] Take a 1ml disposable syringe, remove the needle and absorb the Agrobacterium solution. Select Nicotiana benthamiana at the 6-8 leaf stage and use pressure to inject the solution in the syringe between the veins on the back of the leaf. Inject two leaves per plant, and the injection amount for each leaf should cover at least 1 / 3 of the leaf.

[0053] Inoculate with equal amount of CMV Fny RNA1, wild-type CMV Fny RNA2, wild-type CMV Fny N. benthamiana inoculated with RNA3 plasmid was used as control (wt), and uninoculated N. benthamiana was used as mock.

[0054] Seven days after the mutant was inoculated, the target virulent CMV was used to infect the plants pre-inoculated with the mutant and the plants not pre-inoculated with the mutant by Agrobacterium injection to test their cross-protection effects.

[0055] The inoculated plants were cultured at 25°C with alternating 16h light / 8h dark conditions.

[0056] 14 days after inoculation, the inoculation symptoms were observed, and the disease index and relative protection efficiency of the plants infected with the target highly virulent CMV were calculated. Disease classification was carried out according to the national standard of the People's Republic of China "Grading and Investigation Methods for Tobacco Diseases and Insects GB / T 23222-2008".

[0057] Disease index: 100×∑(number of diseased plants at each level×disease level) / (total number of plants surveyed×highest level)

[0058] Relative efficacy: 100% × (disease index of control group - disease index of treatment group) / disease index of control group

[0059] Results: 14 days after inoculation, the symptoms showed that the mock N. benthamiana did not develop disease and grew well; wild-type CMV (wt)-inoculated N. benthamiana developed severe disease, with dwarf plants and shrunken leaves; m2 Benthamina plant symptoms were basically the same as those of the mock plants, with no obvious virus symptoms, indicating that R1-3U m2 CMV Fny The attenuated mutant of RNA1 ( Figure 3 ).

[0060] Direct inoculation of CMV with virulent virus without prior inoculation of R1-3U m2 The leaves of the mutant Nicotiana benthamiana plants were severely wrinkled, similar to those of the wt plants. m2 The mutant N. benthamiana has good growth and flat leaves, similar to the mock. m2 CMV Fny The attenuated mutant of RNA1 has a good preventive effect on CMV, with a relative protection rate of 88.9% ( Figure 3 ).

[0061] Example 3. Plasmid vector pCC F R1-3U m2 Determination of the limit of accommodation of foreign fragments:

[0062] Plasmid vectors containing PDS sequences of different lengths were constructed. The method was as described in the previous study (Patent No.: 202011259238.8). Total RNA of Nicotiana benthamiana plants at the 6-leaf stage was extracted and reverse transcribed using the reverse primer PDS-BamHI-531-R. The reverse transcribed cDNA was then used as a template to perform PCR reactions using the forward primer PDS-SmaI-333-F and the reverse primers PDS-BamHI-432-R and PDS-BamHI-531-R, respectively, to amplify partial PDS sequences of 100 bp and 200 bp in length. The vector pCC F R1-3U m2The PDS fragment was double-digested with BamHI and SmaI and then recovered using a DNA recovery kit; the vector pCC F R1-3U m2 The ligated products were transformed into competent cells of E. coli DH5α and coated on LB plates with 100 μg / mL kanamycin. The positive clones pCC were confirmed by colony PCR screening, enzyme digestion identification and DNA sequencing. F R1-3U m2 -P100, pCC F R1-3U m2 -P200.

[0063] The plasmid vector containing the PDS sequence was inoculated using the method in Example 2. After 14 days of inoculation, the mutant inoculation status was recorded ( Figure 4 A), and total RNA was extracted from the upper non-inoculated leaves. m2 Primers CMV-Fny1-2558-F (SEQ ID NO.7) and CMV-Fny1-3357-R (SEQ ID NO.8) were designed upstream and downstream of the exogenous fragment insertion site, and RT-PCR detection was performed to determine whether the inserted PDS fragment was stable based on the length of the amplified fragment ( Figure 4 B) If pCC F R1-3U m2 -PDS is stable. When the length of inserted PDS is 0bp, 100bp, and 200bp, the corresponding PCR product fragment length should be 818bp, 912bp, and 1012bp.

[0064] Results: The inoculation symptoms showed that the mock N. benthamiana did not develop disease and grew well; the wild-type CMV (wt)-inoculated N. benthamiana developed severe disease, with dwarfed plants and shrunken leaves; the N. benthamiana inoculated with different exogenous fragment insertion mutants had obvious whitening of new leaves, flat leaves, and plant heights similar to those of the mock plants, with no obvious disease symptoms, indicating that the exogenous fragment insertion mutants were all attenuated mutants ( Figure 4 A).

[0065] It should be noted that Figure 3 , Figure 4 In A, in the upper and lower rows of plant photos, the upper and lower photos at the same position correspond to the observation results of the same plant from different angles.

[0066] The RT-PCR results showed that the amplified band of the wt inoculated sample was approximately 800 bp, which was consistent with the expected band size ( Figure 4 B, lane3); mutant R1-3U m2The amplified band of the inoculated sample was approximately 818 bp, which was consistent with the expected band size ( Figure 4 B, lane 4), indicating the mutant R1-3U without the foreign fragment inserted m2 Able to stably exist in plants; mutant R1-3U m2 -P100, R1-3U m2 -P200 inoculated samples, the amplified bands were approximately 912 bp and 1012 bp ( Figure 4 B, lane5 / 6), which is consistent with the expected band size, indicating that the inserted exogenous fragments of 100-200 bp can be stably present. m2 、R1-3U m2 -P100, R1-3U m2 -P200 has stable inheritance.

[0067] Combined with the above results, it is shown that the mutant vector pCC F R1-3U m2 It can accommodate at least 200 bp of exogenous fragments and maintain genetic stability.

[0068] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A plasmid vector containing a mutant RNA1 of a cucumber mosaic virus Fny isolate, characterized in that: The plasmid vector contains CMV Fny Isolate mutant RNA1, the CMV Fny The nucleotide sequence of the isolated mutant RNA1 is shown in SEQ ID NO.

1.

2. The method for preparing the plasmid vector according to claim 1, characterized in that: The following steps are involved: CMV Fny RNA1 infectious cloning plasmid pCB301-CMV Fny -R1 was used as a template, and reverse PCR amplification was performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain a linearized vector; BamHI restriction enzyme digestion and ligation technology was used to finally obtain a plasmid vector containing the mutant RNA1 of the cucumber mosaic virus Fny isolate.

3. The preparation method according to claim 2, characterized in that: The conditions for reverse PCR amplification were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 54°C for 15 s, extension at 72°C for 4 min, 30 cycles; complete extension at 72°C for 5 min; and storage at 4°C.

4. Use of the plasmid vector according to claim 1 in constructing a plant virus attenuated vaccine.

5. Use of the plasmid vector according to claim 1 as an attenuated vaccine in preventing and treating cucumber mosaic virus disease.

6. A plant attenuated vaccine, characterized in that: include: The plasmid vector according to claim 1, wild-type CMV Fny RNA2 and wild-type CMV Fny RNA3.

7. The attenuated plant vaccine according to claim 6, characterized in that: Plasmid vector, wild-type CMV Fny RNA2 and wild-type CMV Fny The concentration ratio of RNA3 was 1:1:1.

Images