Application of AKT3 in diagnosis and treatment of head and neck cancer

Abstract

The invention discloses an application of a reagent for detecting the expression of a biomarker AKT3 in preparation of a product for auxiliary diagnosis or diagnosis of a head and neck cancer object, an application of AKT3 as a target in screening of a medicine for treating head and neck cancer, and an application of an AKT3 expression inhibitor in preparation of a medicine for treating head and neck cancer. The invention provides a novel head and neck cancer diagnosis marker AKT3, and compared with normal tissues and normal cells, the marker shows that the expression in the head and neck cancer tissues and cells is obviously up-regulated, and can be used for diagnosing the head and neck cancer; research experiments prove that knock-down of the AKT3 can inhibit migration and invasion of head and neck cancer cells and can inhibit growth of subcutaneous transplantation tumors in mice, and the AKT3 can be used as a treatment target of the head and neck cancer; and a new target and a treatment strategy are provided for the treatment of the head and neck cancer.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of AKT3 in the diagnosis and treatment of head and neck cancer. Background Art

[0002] Head and Neck Cancer is the sixth most common cancer in the world, of which more than 90% originate from the mucosal epithelium of the oral cavity, pharynx and larynx, and most are called head and neck squamous cell carcinoma (HNSCC). About 47% of HNSCC metastasize. Given the high incidence, high mortality and high metastasis rate of HNSCC, it is particularly important to understand the pathogenesis of HNSCC.

[0003] The four major inducing factors of HNSCC include tobacco, betel nut, alcohol and viral infection. In recent years, more and more data have shown that human papillomavirus (HPV)-positive (HPV+) HNSCC accounts for an increasing proportion of the entire HNSCC, and compared with HPV-negative HNSCC patients, HPV-positive HNSCC patients have better sensitivity to chemotherapy and radiotherapy and better prognosis. This means that the pathogenesis of HPV+HNSCC is very different from that of HPV-HNSCC.

[0004] The PI3K / AKT signaling pathway regulates a variety of cellular processes, such as cell survival, proliferation, growth, apoptosis, drives cancer proliferation, and regulates glycogen metabolism. Its abnormal activation is often closely related to the occurrence of various cancers.

[0005] Phosphatidylinositol 3 kinase, phosphatidylinositol 3 kinase, can specifically catalyze the phosphorylation of the 3-hydroxyl group of phosphatidylinositol, produce inositol lipid substances with second messenger functions, recruit and activate downstream target substances, and then initiate a series of signal cascade reactions. One of the important target kinases downstream of PI3K is serine / threonine protein kinase (RAC-αserine / threonine-protein kinase, AKT), which has serine and threonine kinase activity. As the main downstream effector of PI3K, AKT is likely to be an important anti-cancer target. AKT was originally discovered as an oncogene, which is expressed in almost all human cell tissues. Its family has three members-AKT1 (PKBα), AKT2 (PKBβ) and AKT3 (PKBγ). Although each AKT subtype has a similar structure, they show redundant and opposite functions. AKT1 and AKT2 usually play a certain role in tumor growth and metabolism, and AKT3 has a role in promoting cancer metastasis in other cancers. Among them, there are few studies on the occurrence and development of HNSCC, and the mechanism of AKT3 in HPV+HNSCC is still unclear. Summary of the invention

[0006] The purpose of the present invention is to provide an application of AKT3 in the diagnosis and treatment of head and neck cancer in view of the above problems.

[0007] In order to achieve its purpose, the present invention adopts the following technical solution:

[0008] A first aspect of the present invention provides a use of a reagent for detecting the expression of the biomarker AKT3 in the preparation of a product for auxiliary diagnosis or diagnosis of a subject with head and neck cancer.

[0009] The diagnostic method comprises: obtaining a test sample from a subject suspected of having head and neck cancer, and determining the expression level of AKT3 in the test sample. If AKT3 is highly expressed compared with a normal control, it indicates that the subject is a high-risk group for head and neck cancer or a head and neck cancer patient.

[0010] The second aspect of the present invention provides the use of AKT3 as a target in screening drugs for treating head and neck cancer.

[0011] The drug inhibits the expression of AKT3, inhibits the migration and invasion of head and neck cancer cells, and inhibits the proliferation of tumor tissue.

[0012] The drug inhibits the expression of AKT3, inhibits the expression of chemokine CCL2, and inhibits immune inflammatory response.

[0013] The third aspect of the present invention provides use of an AKT3 expression inhibitor in the preparation of a medicament for treating head and neck cancer.

[0014] The expression inhibitors include nucleic acid molecules, proteins, and compounds.

[0015] Preferably, the nucleic acid molecule comprises shRNA.

[0016] Preferably, the shRNA is shAKT3#4 or shAKT3#5, and the sequence of the shRNA is:

[0017] Sense strand of shAKT3#4: 5′-AAATGATGTGTGGGAGGTTA-3′;

[0018] Antisense strand of shAKT3#4: 5′-TAACCTCCCACACATCATTT-3′;

[0019] Sense strand of shAKT3#5: 5′-CTGCCTTGGACTATCTACATT-3′;

[0020] Antisense strand of shAKT3#5: 5'-AATGTAGATAGTCCAAGGCAG-3'.

[0021] In any of the above application technology solutions, the head and neck cancer is head and neck squamous cell carcinoma.

[0022] The beneficial effects of the present invention are: providing a new head and neck cancer diagnostic marker AKT3, which shows significantly upregulated expression in head and neck cancer tissues and cells compared with normal tissues and normal cells, providing ideas for the diagnosis of head and neck cancer. The research experiments of the present invention confirm that knocking down AKT3 can inhibit the migration and invasion of head and neck cancer cells, and can inhibit the growth of subcutaneous transplanted tumors in mice. AKT3 can be used as a therapeutic target for head and neck cancer; it provides a new target and therapeutic strategy for the treatment of head and neck cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The results showed that AKT3 was abnormally upregulated in head and neck cancer: A. GEPIA database analysis showed that AKT3 gene was highly expressed in head and neck cancer; B. HPA database analysis showed that AKT3 was highly expressed in head and neck cancer tissue chips; C. RT-qPCR analysis showed that AKT3 expression was significantly increased in head and neck cancer tissues; D-E. RT-qPCR and immunoblotting experiments showed that the mRNA (D) and protein (E) expression levels of AKT3 were high in head and neck cancer cell lines.

[0024] Figure 2 It was shown that knocking down AKT3 significantly inhibited the tumor size (A), weight (B) and growth rate (C) of subcutaneously transplanted tumors in nude mice. The results of immunohistochemical staining (D) showed that knocking down AKT3 affected the proliferation of tumor tissue.

[0025] Figure 3 The effect of knocking down AKT3 on the proliferation of head and neck cancer cells is shown: A. The efficiency of cell knockdown was detected at the mRNA level; B. Western blot results also showed that AKT3 knockdown was efficient and had no effect on the protein expression of AKT1 and AKT2; C. The growth rate of cells in the AKT3 knockdown group was not affected; D. Ki67 immunofluorescence staining analysis showed that AKT3 silencing did not affect the cell proliferation of head and neck cancer cells.

[0026] Figure 4 It shows that knocking down AKT3 affects the migration and invasion of head and neck cancer cells: A. Knocking down AKT3 greatly reduced the scratch healing rate; B. The migration and invasion ability of cells in the knockdown AKT3 group decreased.

[0027] Figure 5 The results of protein expression level detection of EMT-related markers in AKT3 knockdown cell lines are shown.

[0028] Figure 6Shown are: A. mRNA expression level detection results of inflammation-related cytokines and chemokines after knockdown of AKT3; BC. Knockdown of AKT3 significantly inhibited the expression of CCL2 at the mRNA (B) and protein (C) levels. DETAILED DESCRIPTION

[0029] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0030] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0031] Example 1

[0032] 1 Experimental Materials and Methods

[0033] 1.1 Cell culture

[0034] This experiment used one human immortalized keratinocyte (HaCat) and four human head and neck cancer cell lines CAL27, SCC15, SCC47, and SCC90.

[0035] HaCat cell lines were cultured in α-MEM medium (L570KJ, Basalmedia) containing 10% fetal bovine serum (C8010, Adamas, USA) and 1% penicillin-streptomycin solution (100X) (C0222, Beyotime); CAL27, SCC15 and SCC90 cell lines (Zhejiang Meisen Cell Technology Co., Ltd., Zhejiang) were cultured in DMEM medium (C11995500BT, Gibco) containing 10% fetal bovine serum and 1% penicillin-streptomycin solution (100X); SCC47 cell lines were cultured in RPMI-1640 medium (C11875500BT, Gibco) containing 10% fetal bovine serum and 1% penicillin-streptomycin solution (100X). All these cell lines were cultured at 37°C, 5% CO 2 The cells were cultured in a standard sterile incubator protected from light.

[0036] 1.2 Lentiviral packaging

[0037] Lentiviral packaging was used to produce a virus containing shRNA targeting AKT3 knockdown. The shRNA sequence is as follows:

[0038]

[0039] The process is as follows:

[0040] Packaging plasmids: pMD2G, psPAX2 (Sigma-Aldrich, USA)

[0041] Target plasmid: shAKT3 (Sigma-Aldrich, USA) plasmid of pLKO.1-puro vector and control (Scramble, Sigma-Aldrich, USA) plasmid of pLKO.1-puro vector were used to package lentivirus at a ratio of 1 (pMD2G) ﹕ 3 (psPAX2) ﹕ 4 (target plasmid).

[0042] When the density of 293T cells reaches 70%, it is recommended to package the virus. Discard the complete medium in the 293T culture dish 30 minutes in advance and replace it with the basal medium; transfer the cells through PEI (24765-1, Polysciences) according to the operation steps of the plasmid system product manual, and replace the culture medium in the culture dish with complete medium after 6-8 hours. Collect the supernatant after 48 hours and filter it with a 0.45um filter for aliquoting.

[0043] 1.3 Cell transfection

[0044] The night before, cells to be infected were transferred to 6-well plates or 6 cm dishes. When the cell density grew to 20%-50%, shRNAs containing AKT3 as the target were transfected into SCC15 and SCC47 cells, and 5ug / ml polybrene reagent (C0351, Beyotime) was added to mediate infection. The culture medium was replaced after 6-8h. At 48h, transiently transfected cells were taken or puromycin (ST551, Beyotime) was used to screen stable knockdown cell lines.

[0045] 1.4 Immunohistochemistry (IHC)

[0046] The steps are as follows:

[0047] 1. Baking: Place slices and xylene 1 in a constant temperature oven (65°C) for 60 minutes;

[0048] 2. Dewaxing: Place the slices in xylene in a constant temperature box① and soak for 10 minutes; take out the slices and place them in xylene at room temperature② for 10 minutes;

[0049] 3. Hydration: gradient ethanol (100% ethanol ① 100% ethanol ② 95% ethanol 85% ethanol 75% ethanol soaking, 5 min / time);

[0050] 4. Washing: Put the hydrated slices into a clean water box, shake gently on a shaker for 5 minutes, and soak in PBS for 3 minutes;

[0051] 5. EDTA antigen repair: Place the slices in a slice box containing repair solution, put them in boiling water, and boil them at 100°C for 20 minutes; wait for the repair solution to cool to room temperature, take out the slices, soak them in distilled water twice, and then wash them once with PBS buffer, 5 minutes each time;

[0052] 6. Hydrophobic circle: Draw a hydrophobic line for later use and place it horizontally in the incubation wet box;

[0053] 7. Quenching / blocking: drop a drop of catalase blocker into the hydrophobic circle and incubate at room temperature for 20 minutes; wash with PBS buffer 3 times, 5 minutes each time;

[0054] 8. Blocking: Add a drop of immunostaining blocking solution to the slices and block for 30 minutes at room temperature; wash with PBS buffer 3 times, 5 minutes each time;

[0055] 9. Primary antibody incubation: Add diluted primary antibody (AKT3, 21641-1-AP, Proteintech) to the sample and incubate overnight at 4°C;

[0056] 10. Rewarm the slices that have been incubated overnight at room temperature for 1 hour and wash them 3 times with PBS buffer, 5 minutes each time;

[0057] 11. Secondary antibody incubation: add enzyme-labeled goat anti-mouse / rabbit IgG polymer secondary antibody (PV-6000, zsbio, China) to the sections and incubate at room temperature for 30 min; wash with PBS buffer 3 times, 5 min / time;

[0058] 12. Color development: Use DAB color developing solution (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.) to develop the substrate for 30-90 seconds; rinse with a large amount of water to terminate the color development;

[0059] 13. Nuclear staining: stain with hematoxylin solution (Beijing Solebow Technology Co., Ltd.) for 1-30 seconds; rinse with plenty of water to stop color development;

[0060] 14. Dehydration: gradient ethanol (75% ethanol-85% ethanol-95% ethanol-100% ethanol②-100% ethanol①, 5 min / time), xylene② immersion for 10 min, xylene① immersion for 10 min; air-dry naturally;

[0061] 16. Sealing: Add neutral gum to the slide and cover with a coverslip; take photos and observe.

[0062] 1.5 Immunoblotting

[0063] The steps are as follows:

[0064] 1. Electrophoresis: 80V 30min, 120V 50min;

[0065] 2. Transfer: Soak the black and white filter papers in transfer solution, activate the PVDF membrane with methanol for 1 minute, and then place it in the transfer solution. Place the cut glue in the transfer solution as well, in a sandwich manner: transparent plate - black - white - PVDF membrane - glue - white - black - black plate, and place it in the transfer solution after fixation; put an ice pack in the instrument and place it at 4°C, with a constant current of 300mA for 2h or a constant voltage of 100V for 2h (slightly different for different protein sizes);

[0066] 3. Blocking: Dissolve 5% skim milk with TBST and shake at room temperature for 1 hour; wash the PVDF membrane with TBST;

[0067] 4. Primary antibody incubation: dilute the antibody with TBST, incubate overnight at 4°C; wash with TBST 3 times, 10 min each time;

[0068] 5. Secondary antibody incubation: incubate at room temperature for 1 hour; wash 3 times with TBST, 10 minutes each time;

[0069] 6.ECL color development.

[0070] 1.6 RNA extraction

[0071] The steps are as follows:

[0072] 1. Add 1 ml Trizol (RNAiso Plus, 9109, Takara) to the extracted cell pellet, gently pipette to mix, and place at room temperature for 5 minutes to lyse;

[0073] 2. Add 0.2 ml of chloroform to every 1 ml of Trizol, shake vigorously for 15 seconds to mix thoroughly, and leave at room temperature for 3 minutes; centrifuge at 12,000 rpm and 4°C for 15 minutes;

[0074] 3. Carefully aspirate into a new enzyme-free EP tube, add the same volume of isopropanol, mix evenly, and let stand at room temperature for 10 minutes; centrifuge at 12000 rpm at 4°C for 10 minutes, and discard the upper waste liquid;

[0075] 4. Add 1 ml of 75% ethanol and tap the bottom of the tube to mix; centrifuge at 12000 rpm at 4°C for 5 min, discard the upper layer of waste liquid, and precipitate a small amount of RNA;

[0076] 5. Open the lid and place the extracted RNA in a clean bench to dry naturally to allow the alcohol to evaporate; add 10-100ul of enzyme-free water to each tube and mix well, and then test the RNA concentration.

[0077] 1.7 Reverse transcription and cDNA synthesis

[0078] The kit AB Script III RT Master Mix for qPCR with gDNA Remover (RK20429, ABclonal, Wuhan) was used and operated according to the instructions.

[0079] 1.8 Real-time quantitative polymerase chain reaction (RT-q PCR)

[0080] The cDNA template, specific primers (Qingke, China), and SYBR Green Fast qPCR Mix reagent (RK21203, ABclonal, China) were mixed, and the volume was supplemented with enzyme-free water to amplify the target gene for RT-qPCR reaction. The reaction system was set up according to the instructions. The CT values ​​of the target gene and the internal reference gene were normalized and analyzed using GraphPad software.

[0081] The main primer sequences are as follows:

[0082] Primer name Sequence (5'-3') SEQ ID NO AKT3-F ACCGCACACGTTTCTATGGT SEQ ID NO.5 AKT3-R TGGCCATCTTTGTCCAGCAT SEQ ID NO.6 GAPDH-F GATTCCACCCATGGCAAATTC SEQ ID NO.7 GAPDH-R CTGGAAGATGGTGATGGGATT SEQ ID NO.8 CCL2-F TCTCTTCCTCCACCACCATG SEQ ID NO.9 CCL2-R CTCCAGCCTACTCATTGGGA SEQ ID NO.10

[0083] 1.9 CCK8 Experiment

[0084] Digest the cells and resuspend them. After counting, inoculate 100ul of the cell suspension into a 96-well plate, ensuring 3,000 cells per well, with a total of 5 replicates. Subsequently, CCK-8 (10X) solution diluted in culture medium was added to each well at 0, 24, 48, 72, and 96 hours, and incubated at 37°C in the dark for 1 hour. Use an ELISA reader to measure the absorbance at a wavelength of 450nm. Draw the Time (h)-OD (450nm) cell viability and proliferation curve based on the absorbance value.

[0085] 1.10 Transwell assay

[0086] The steps are as follows:

[0087] 1. Starvation: Inoculate cells into 6-well plates. When the cell density reaches 70%, discard the complete culture medium in the well plate, wash off the residual complete culture medium on the surface with PBS, add the basic culture medium without serum and double antibody, and culture for 8 hours;

[0088] 2. Migration: Digest the cells with trypsin, add basal culture medium to resuspend, and calculate the cell density with an automatic counter. Then add 150ul of cell suspension to each upper chamber, of which 1x10 cells of SCC15 are added. 5 / per chamber, the number of SCC47 cells is 3x10 5 / each chamber; the corresponding culture medium containing 20% ​​serum was added to the lower chamber, and the SCC15 cell line and SCC47 cell line were allowed to migrate for 24 hours in an incubator at 37°C;

[0089] 3. Invasion: Dilute Matrigel (356234, Corning) with culture medium to 1 mg / ml. Add 60 ul of Matrigel diluted with culture medium to the upper chamber of the chamber 2 hours in advance and incubate at 37°C to allow the gel to solidify. The subsequent steps are the same as step 2;

[0090] 4. Fixation: Use tweezers to remove the chamber, discard the culture medium in the upper and lower chambers, rinse gently with PBS three times, absorb 600ul 4% paraformaldehyde and place it in a new 24-well plate, then immerse the chamber membrane in the fixative and fix it at room temperature for 30 minutes;

[0091] 5. Staining: Gently rinse the chamber in PBS, add 600ul of 0.1% crystal violet staining solution to a new 24-well plate, immerse the chamber membrane in the staining solution, and stain at room temperature in the dark for 15 minutes;

[0092] 6. Remove cells that have not migrated or invaded: Gently rinse the chamber twice in PBS to remove floating color. Use a moistened cotton swab to wipe the cells on the upper chamber membrane that have not passed through the chamber membrane, rinse the chamber with distilled water, and wash off the demembraned cells;

[0093] 7. Turn the chamber upside down, let it air dry naturally, and take photos for observation.

[0094] 1.11 Scratch healing experiment

[0095] The cells were plated into 6-well plates, and scratched with a 200ul pipette tip when the cell density reached 95%-100%. The detached cell clusters were washed with PBS, and 1ml of basal culture medium was added to each well. The cells were photographed and then placed in a 37°C incubator to avoid light. The scratches were recorded by taking photos with a microscope every 0h and 12h for the SCC15 cell line, and every 0h and 24h for the SCC47 cell line. The scratch area was measured using Image J software, and the cell migration coefficient ((0h-Xh) / Xh) was calculated.

[0096] 1.12 Xenograft tumor model establishment

[0097] This study was approved by the Ethics Committee of Chongqing Medical University. All animal experimental procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals. Balb / c nude mice (male, 4-5 weeks old, Hunan Slake Jingda Laboratory Animal Co., Ltd., China) were housed in a standard environment to familiarize them with the environment. Stably transfected Scramble (control) cells and shAKT3 cells were cultured at 5 × 10 cells per mouse. 6 SCC47 cells were injected subcutaneously into the right axilla at a density of 10 cells / 100 μl. The tumor volume was observed every 4 days and the tumor diameter (d) was measured with a caliper. The volume (mm 3 )=4πd 3The tumor volume was calculated using the formula of 1:1 / 6. The mice were sacrificed 21 days later and the tumor weight was measured.

[0098] 2 Results

[0099] 2.1 Abnormal upregulation of AKT3 expression in head and neck cancer

[0100] The gene expression level in the GEPIA database (http: / / gepia2.cancer-pku.cn / ) shows that the AKT3 gene is highly expressed in head and neck cancer compared with normal tissues. Figure 1 A). Similarly, in the HPA database (www.proteinatlas.org), tissue microarray staining showed that AKT3 was highly expressed in head and neck cancer tissue microarrays compared with normal tissue microarrays ( Figure 1 B), which suggests that AKT3 may play an important role in head and neck cancer. In addition, we detected the AKT3 mRNA level in 8 normal head and neck tissues and 8 head and neck cancer tissues by quantitative reverse transcription polymerase chain reaction (RT-qPCR) analysis. The results showed that the expression of AKT3 in head and neck cancer tissues was significantly increased ( Figure 1 C). Then, the expression of AKT3 was detected in several head and neck cancer cell lines (CAL27, SCC15, SCC47, and SCC90) by RT-qPCR and immunoblotting. Compared with the immortalized keratinocyte cell line (HaCat), the mRNA expression of AKT3 in head and neck cancer cells ( Figure 1 D) and protein ( Figure 1 E) The expression level is high, which is consistent with our findings in big data prediction.

[0101] 2.2 Knockdown of AKT3 inhibits the growth of subcutaneous transplanted tumors in nude mice

[0102] In order to observe the effect of knocking down AKT3 in vivo, we constructed a nude mouse subcutaneous transplant tumor model in male nude mice aged 4-6 weeks. The experiment was divided into a control group (Scramble) and an experimental group (shAKT3). The control group was subcutaneously injected with SCC47 cells carrying an empty vector in the right axilla, and the shAKT3 group was injected with SCC47 cells with stable knockdown of AKT3 in the same location. The results showed that knocking down AKT3 significantly inhibited the tumor size of the subcutaneous transplanted tumor ( Figure 2 A) Weight ( Figure 2 B) and growth rate ( Figure 2 C). In addition, the expression of AKT3 in the tumor tissue of the experimental group decreased, and the expression of the proliferation indicator Ki67 also decreased, indicating that knocking down AKT3 affects the proliferation of tumor tissue ( Figure 2 D).

[0103] 2.3 Knockdown of AKT3 does not affect the proliferation of head and neck cancer cells

[0104] To test whether AKT3 regulates the development of head and neck cancer, two cell models with knockdown of AKT3 were used to examine the effect of downregulating AKT3 on cell proliferation. RT-qPCR analysis showed that these generated cells had a high knockdown efficiency ( Figure 3 A), western blot results also showed that the protein knockdown efficiency was high and AKT3 had no effect on the protein expression levels of AKT1 and AKT2 ( Figure 3 B). The results of CCK-8 analysis showed that the growth rate of cells in the AKT3 knockdown group was not affected compared with the control group ( Figure 3 C). Similarly, Ki67 immunofluorescence staining analysis showed that AKT3 silencing did not affect the cell proliferation of head and neck cancer cells ( Figure 3 D).

[0105] 2.4 Knockdown of AKT3 affects migration and invasion of head and neck cancer cells

[0106] The knockout cells were compared with control cells using a scratch healing assay, and the results showed that knockdown of AKT3 significantly reduced the scratch healing rate ( Figure 4 A). Transwell migration and invasion assays were used to detect the effect of knocking down AKT3 on cell migration and invasion. Compared with the control group, the number of cells that migrated and invaded in the AKT3 knockout group decreased ( Figure 4 B). These results suggest that AKT3 promotes migration and invasion of head and neck cancer cells.

[0107] 2.5AKT3 does not promote cell migration and invasion by affecting epithelial-mesenchymal transition (EMT)

[0108] Through the above experiments, we found that AKT3 does not affect cell proliferation, but only affects cell migration and invasion, which suggests whether AKT3 promotes the metastasis of head and neck cancer. We detected the protein expression levels of EMT-related markers in AKT3 knockdown cell lines, which are important markers of cell membrane phenotype changes, but we found that AKT3 did not affect EMT ( Figure 5 ).

[0109] 2.6 Knockdown of AKT3 inhibits CCL2 expression in cells

[0110] A large number of studies have shown that cancer and inflammatory response are closely related, and some literature reports that AKT3 promotes the occurrence and development of head and neck cancer by promoting immune inflammatory response. Therefore, we verified the mRNA expression level of inflammation-related cytokines and chemokines ( Figure 6 A). The results of five RT-q PCR experiments showed that knocking down AKT3 inhibited the expression of chemokine CCL2.

[0111] We verified the mRNA and protein levels of CCL2 in cells with AKT3 knockdown and found that knockdown of AKT3 significantly inhibited the mRNA expression of CCL2 ( Figure 6 B) and protein ( Figure 6 C) level of expression.

Claims

1. Use of a reagent for detecting the expression of the biomarker AKT3 in the preparation of a product for auxiliary diagnosis or diagnosis of a subject with head and neck cancer.

2. The use according to claim 1, characterized in that: The diagnostic method comprises: obtaining a test sample from a subject suspected of having head and neck cancer, and determining the expression level of AKT3 in the test sample. If AKT3 is highly expressed compared with a normal control, it indicates that the subject is a high-risk group for head and neck cancer or a head and neck cancer patient.

3. Application of AKT3 as a target in screening drugs for the treatment of head and neck cancer.

4. The use according to claim 3, characterized in that: The drug inhibits the expression of AKT3, inhibits the migration and invasion of head and neck cancer cells, and inhibits the proliferation of tumor tissue.

5. The use according to claim 4, characterized in that: The drug inhibits the expression of AKT3, inhibits the expression of chemokine CCL2, and inhibits immune inflammatory response.

6. Application of AKT3 expression inhibitors in the preparation of drugs for the treatment of head and neck cancer.

7. The use according to claim 6, characterized in that: The expression inhibitors include nucleic acid molecules, proteins, and compounds.

8. The use according to claim 7, characterized in that: The nucleic acid molecule includes shRNA.

9. The use according to claim 8, characterized in that: The shRNA is shAKT3#4 or shAKT3#5, and the sequence of the shRNA is: Sense strand of shAKT3#4: 5′-AAATGATGTGTGGGAGGTTA-3′; Antisense strand of shAKT3#4: 5′-TAACCTCCCACACATCATTT-3′; Sense strand of shAKT3#5: 5′-CTGCCTTGGACTATCTACATT-3′; Antisense strand of shAKT3#5: 5'-AATGTAGATAGTCCAAGGCAG-3'.

10. The use according to any one of claims 1 to 9, characterized in that: The head and neck cancer is head and neck squamous cell carcinoma.

Images