KASP molecular markers associated with caryophyllene, an aroma trait in non-heading Chinese cabbage, their primers and applications

Abstract

This invention discloses a KASP molecular marker and method for detecting caryophyllene, an aroma trait closely related to non-heading Chinese cabbage. The molecular marker was designed based on caryophyllene content and the F2 genetic population, with the SNP locus located at chromosome A06-37805032, named YNβc. The nucleotide sequence of YNβc is shown in SEQ ID NO.1. The KASP marker primers include two forward specific primers and one reverse universal primer. Genotyping using the KASP marker provided by this invention eliminates the need for enzyme digestion and electrophoresis after PCR amplification, allowing for high-throughput detection of multiple samples and rapid detection of the distribution of the Bcβc allele in a segregating population of non-heading Chinese cabbage. The results are accurate and offer advantages over conventional molecular markers, including speed, simplicity, and lower cost. This invention is of significant importance for marker-assisted selection breeding of caryophyllene in non-heading Chinese cabbage.

Description

Technical Field

[0001] This invention relates to the field of non-heading Chinese cabbage breeding technology, specifically to a KASP molecular marker closely linked to caryophyllene, an aroma trait of non-heading Chinese cabbage, its primers, and applications. Background Technology

[0002] Non-heading Chinese cabbage is a common leafy green vegetable in my country with a long history of cultivation and abundant germplasm resources. As people's living standards improve, their demands for the appearance and quality of vegetables are constantly increasing, making non-heading Chinese cabbage, with its unique flavor, valuable in both the market and nutritional aspects.

[0003] Aroma is one of the most important traits in the breeding of non-heading Chinese cabbage. Aroma is mainly influenced by various volatile compounds, and caryophyllene is a unique volatile sesquiterpene found in the non-heading Chinese cabbage variety, Xiangqingcai. Traditional breeding and variety identification methods are time-consuming and labor-intensive. With the development of sequencing and molecular biology techniques, marker-assisted selection (MAG) breeding techniques have gradually emerged. By analyzing the close linkage between the presence or absence of caryophyllene and molecular markers, the presence of caryophyllene in non-heading Chinese cabbage can be determined during the seed stage by detecting linked molecular markers. This accelerates the breeding progress of caryophyllene-related traits in non-heading Chinese cabbage, shortens the breeding cycle, and can also serve as a method for identifying the aroma traits of different non-heading Chinese cabbage varieties in the market. Summary of the Invention

[0004] This invention provides a KASP molecular marker for detecting caryophyllene-related substances in non-heading Chinese cabbage, along with its primers and applications. Its main purpose is to provide a molecular marker that reduces the cost of marker-assisted selection for the presence of caryophyllene in a large number of samples and improves breeding efficiency.

[0005] The technical solution of this invention is as follows:

[0006] The first objective of this invention is to provide a KASP molecular marker closely linked to caryophyllene in non-heading Chinese cabbage, said molecular marker being located on chromosome 6 of non-heading Chinese cabbage and named YNβc, the nucleotide sequence of which is shown in SEQ ID NO.1:

[0007] TCTCTGCCCCAAACATTTCTTGGTTCAAGTGTCGCCTCTCACCATTTCAGTTTTGTTTTCATTAAAAAATCATTTTTATTAGTTATAACAAACTGTTTATTTCCAATTTCCTTCCTATATGAGTGCTTCACGTATCTATAACAGAGAATTGAAGGCATTTTTTCTTTCCATAGTTTTTTATTTACAGAGATTGTTCAATAAAATTTTATATACTTTTCAGTTGGTTAATTATTTTTAGAGTATAATTAGTTTTTTTTAATTATTTCTCCATTACATTTGTGTGTTTACATTATTTTGGTTG, where a G→T mutation occurs at the 151bp position, and the base T is unique to the non-heading Chinese cabbage material without caryophyllene.

[0008] The second object of the present invention is to provide a primer pair for detecting the aforementioned KASP molecular marker tightly linked to caryophyllene in non-heading Chinese cabbage.

[0009] Furthermore, the primer pair includes the upstream primer YNβc-F of the non-heading Chinese cabbage allele type containing caryophyllene, the upstream primer YNβc-H of the non-heading Chinese cabbage allele type without caryophyllene, and the common downstream primer YNβc-C.

[0010] In a specific embodiment, the non-heading Chinese cabbage variety containing caryophyllene is Xiangqingcai.

[0011] In a specific embodiment, the non-heading Chinese cabbage variety without caryophyllene is Suzhouqing.

[0012] The sequence of YNβc-F is shown in SEQ ID NO.2:

[0013] 5’-FAM- GAAGGTGACCAAGTTCAT GCTGCTTCACGTATCTATAACAGAGAATTG-3’;

[0014] The sequence of YNβc-H is shown in SEQ ID NO.3:

[0015] 5’-HEX- GAAGGTCGGAGTCAACGGATT GCTTCACGTATCTATAACAGAGAATTT-3’;

[0016] The sequence of YNβc-C is shown in SEQ ID NO.4:

[0017] 5’-AAAACTATGGAAAGAAAAAATGCCT-3’.

[0018] The 5' end of the YNβc-F is a FAM fluorescent signal tag, and the FAM tag sequence is: 5'-FAM-GAAGGTGACCAAGTTCATGCT-3';

[0019] The 5' end of the YNβc-H is a HEX fluorescent signal tag, and the HEX fluorescent signal tag sequence is 5'-HEX-GAAGGTCGGAGTCAACGGATT-3'.

[0020] A third objective of this invention is to provide a kit comprising the aforementioned primer pairs.

[0021] The fourth objective of this invention is to provide a method for identifying whether non-heading Chinese cabbage contains caryophyllene, the method comprising the following steps:

[0022] (1) Extract total genomic DNA from the non-heading Chinese cabbage to be tested;

[0023] (2) The total genomic DNA of the non-heading Chinese cabbage to be tested was amplified by PCR using the aforementioned primers;

[0024] (3) Genotyping the amplification products and determining whether caryophyllene is present in the sample material based on the genotyping results.

[0025] Furthermore, the PCR amplification reaction system in step (2) is as follows: the total PCR amplification system is 10 μl, including 5 μL of 2×KASP Master mix, 0.14 μL of KASP Primer mix, 1.0 μL of template DNA, and 3.86 μL of ddH2O;

[0026] The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 15 min; 95℃ denaturation for 20 s; 61-55℃ annealing and extension for 60 s, 10 cycles, with the temperature decreasing by 0.6℃ per cycle; 95℃ denaturation for 20 s; 55℃ annealing and extension for 60 s, 26 cycles.

[0027] Furthermore, the genotyping method in step (3) is to determine the genotype of the molecular marker based on the type of fluorescence signal, and then determine whether the sample material contains caryophyllene.

[0028] If the non-heading Chinese cabbage to be tested includes an allelic genotype with a HEX fluorescent tag sequence linked to it obtained by YNβc-H amplification, then the non-heading Chinese cabbage to be tested does not contain caryophyllene.

[0029] If the non-heading Chinese cabbage to be tested includes an allele with a FAM fluorescent tag sequence linked to YNβc-F amplification or is heterozygous, then the non-heading Chinese cabbage to be tested contains caryophyllene.

[0030] Furthermore, the genotyping method described in step (3) is as follows: after the PCR amplification reaction is completed, the PCR product is detected by an enzyme-linked immunosorbent assay (ELISA) reader, and the data is imported into KlusterCaller data processing software for analysis. Cluster analysis is performed, and the genotypes of the samples clustered near the X-axis are alleles of the FAM fluorescent tag sequence obtained by YNβc-F amplification, the genotypes of the samples clustered near the Y-axis are alleles of the HEX fluorescent tag sequence obtained by YNβc-H amplification, and the genotypes of the samples in the middle are heterozygous.

[0031] A fifth objective of this invention is to provide the application of the aforementioned KASP molecular markers, primer pairs, or kits that are closely linked to caryophyllene in non-heading Chinese cabbage in identifying whether non-heading Chinese cabbage contains caryophyllene.

[0032] The sixth objective of this invention is to provide the application of the aforementioned KASP molecular markers, primer pairs, or kits that are closely linked to caryophyllene in non-heading Chinese cabbage, in molecular marker-assisted breeding of non-heading Chinese cabbage.

[0033] The beneficial effects of this invention are as follows:

[0034] This invention provides a KASP molecular marker capable of accurately identifying the presence or absence of caryophyllene in non-heading Chinese cabbage, which can be used for flavor-related molecular breeding and germplasm resource analysis of non-heading Chinese cabbage. The molecular marker developed in this invention is used to detect the presence or absence of caryophyllene in non-heading Chinese cabbage. Genotyping is performed based on the Bcβc-KASP marker provided by this invention. After PCR amplification, no enzyme digestion or electrophoresis is required, allowing for high-throughput detection of multiple samples, significantly improving detection efficiency. It can be used to predict the presence or absence of caryophyllene in a large number of non-heading Chinese cabbage varieties at the seed stage. Compared with conventional breeding, the shorter the breeding time, the more accurate the identification. Attached Figure Description

[0035] Figure 1 This figure shows the results of Bcβc genotyping of 21 individuals from the F2 population using the Bcβc-KASP marker. Each dot in the figure represents a sample; red triangles indicate that the gene carries a HEX tag sequence (9 in total); blue triangles indicate that the gene carries a FAM tag sequence (4 in total); green triangles indicate heterozygous sequences (11 in total); and black squares represent the blank control (NTC). Detailed Implementation

[0036] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0038] Primers were developed by Jisihuiyuan Co., Ltd., and the non-heading Chinese cabbage varieties used in the following examples were all from the Chinese cabbage systematics biology laboratory of the College of Horticulture, Nanjing Agricultural University.

[0039] Example 1

[0040] 1. Non-heading cabbage ingredients

[0041] The materials used in this embodiment were a caryophyllene-containing varietal 'XQC' and a caryophyllene-free variety, Suzhou Green 'SZQ'. They were derived from an F2 population constructed using 'XQC' and 'SZQ' as parents. The tested materials were grown at the Baima Base of Nanjing Agricultural University.

[0042] 2. DNA extraction from non-heading Chinese cabbage leaves

[0043] Non-heading Chinese cabbage leaves were collected at 2 months of age. 100 mg of the leaves were added to liquid nitrogen and thoroughly ground. The ground powder was then used to extract DNA using a plant genomic DNA extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The DNA concentration was determined using a Thermo Fisher Scientific Nanodrop 2000 spectrophotometer and adjusted to 40 ng / μL.

[0044] 3. KASP molecular marker design

[0045] A KASP molecular marker YNβc was designed based on a polymorphic SNP site. The molecular marker was located on chromosome 6 of non-heading Chinese cabbage. The nucleotide sequence of YNβc is shown in SEQ ID NO.1, wherein a G→T mutation occurs at 151bp, and the base T is unique to non-heading Chinese cabbage material that does not contain caryophyllene.

[0046] Based on the sequences upstream and downstream of the SNP site, a reverse universal primer YNβc-C and two allele-specific primers YNβc-F and YNβc-H were designed. The primer sequences are as follows.

[0047] The YNβc-F sequence is shown in SEQ ID NO.2:

[0048] 5'-FAM- GAAGGTGACCAAGTTCAT GCTGCTTCACGTATCTATAACAGAGAATTG-3';

[0049] The YNβc-H sequence is shown in SEQ ID NO.3:

[0050] 5'-HEX- GAAGGTCGGAGTCAACGGATT GCTTCACGTATCTATAACAGAGAATTT-3';

[0051] The YNβc-C sequence is shown in SEQ ID NO.4:

[0052] 5'-AAAACTATGGAAAGAAAAAATGCCT-3'.

[0053] The underlined sequences in the forward primers YNβc-F and YNβc-H correspond to the FAM and HEX fluorescent tag sequences, respectively.

[0054] PCR amplification and KASP genotyping were performed by Jisihuiyuan Biotechnology Co., Ltd.

[0055] 4. Implementation of KASP molecular marker YNβc

[0056] (1) PCR amplification reaction

[0057] The extracted DNA was added to 96-well plates with full skirts to prepare the reaction system for PCR amplification.

[0058] PCR reaction system: The total volume of the reaction system is 10 μL, including 5 μL of 2×KASP Master mix, 0.14 μL of KASP Primer mix, 1 μL of template DNA, and 3.86 μL of ddH2O.

[0059] PCR reaction program: 95℃ pre-denaturation for 15 min; 95℃ denaturation for 20 s; 61-55℃ annealing and extension for 60 s, 10 cycles (decreasing by 0.6℃ per cycle); 95℃ denaturation for 20 s; 55℃ annealing and extension for 60 s, 26 cycles.

[0060] (2) Genotyping of KASP molecular marker YNβc

[0061] After the reaction was completed, the PCR products were detected using a BIO-RAD microplate reader, and the data were then imported into KlusterCaller software for cluster analysis.

[0062] like Figure 1 As shown, based on the color classification of the two detected fluorescences, the results of Ynβc genotyping were performed on 22 individual plants from the parental XQC, SZQ, and F1 populations, as well as 3 blank controls, totaling 28 samples, using the KASP molecular marker YNβc. Each dot in the figure represents one sample.

[0063] The yellow dots clustered near the X-axis indicate that the gene carries FAM tag sequences (4 in total), and the corresponding non-heading Chinese cabbage tested contains caryophyllene.

[0064] The blue squares clustered near the Y-axis indicate that the gene carries HEX tag sequences (10 in total), and the corresponding non-heading Chinese cabbage to be tested does not contain caryophyllene;

[0065] The green triangles represent heterozygous sequences (11 in total), corresponding to the presence of caryophyllene in the non-heading Chinese cabbage being tested.

[0066] The black squares (3 in total) are blank controls (NTC).

[0067] Table 1 shows the genotype sequencing and phenotypic analysis of the above non-heading Chinese cabbage samples. The results show that the genotype of the donor parent 'XQC' is consistent with the genotype of the donor parent 'SZQ', the genotype of the donor parent 'T' with a single peak is consistent with the genotype of the donor parent 'SZQ', and the genotype of the donor parent 'SZQ' with a double peak is heterozygous. The genotype sequencing and phenotypic analysis results correspond to the above cluster analysis results.

[0068] Table 1

[0069]

[0070]

[0071] In the table, S represents the allele of the HEX fluorescent tag sequence obtained by YNβc-H amplification; H represents the heterozygous sequence; X represents the allele of the FAM fluorescent tag sequence obtained by YNβc-F amplification; 0 represents the presence of caryophyllene; and 1 represents the presence of caryophyllene.

[0072] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer pair of a KASP molecular marker closely linked to the aroma trait caryophyllene in Brassica rapa subsp. pekinensis; the molecular marker is located on chromosome 6 of Brassica rapa subsp. pekinensis, named YNβc, and the nucleotide sequence of the YNβc is shown as SEQ ID NO. 1: TCTCTGCCCCAAACATTTCTTGGTTCAAGTGTCGCCTCTCACCATTTCAGTTTTGTTTTCATTAAAAAATCATTTTTATTAGTTATAACAAACTGTTTATTTCCAATTTCCTTCCTATATGAGTGCTTCACGTATCTATAACAGAGAATTGAAGGCATTTTTTCTTTCCATAGTTTTTTATTTACAGAGATTGTTCAATAAAATTTTATATACTTTTCAGTTGGTTAATTATTTTTAGAGTATAATTAGTTTTTTTTAATTATTTCTCCATTACATTTGTGTGTTTACATTATTTTGGTTG, wherein, A G→T mutation occurs at 151 bp, and the base T is unique to the Brassica chinensis material without caryophyllene. The primer pair consists of the upstream primer YNβc-F for the Brassica chinensis allele with caryophyllene, the upstream primer YNβc-H for the Brassica chinensis allele without caryophyllene, and the common downstream primer YNβc-C, The sequence of YNβc-F is shown in SEQ ID NO. 2: 5'-FAM-GAAGGTGACCAAGTTCATGCTGCTTCACGTATCTATAACAGAGAATTG-3'; The sequence of YNβc-H is shown in SEQ ID NO. 3: 5'-HEX-GAAGGTCGGAGTCAACGGATTGCTTCACGTATCTATAACAGAGAATTT-3'; The sequence of YNβc-C is shown in SEQ ID NO. 4: 5'-AAACTATGGAAAGAAAAAATGCCT-3'.

2. A kit comprising the primer pair of claim 1.

3. A method for identifying whether caryophyllene is contained in Brassica rapa, characterized by, The method comprises the following steps: (1) extracting the total genomic DNA of the Brassica chinensis to be tested; (2) performing PCR amplification on the total genomic DNA of the Brassica chinensis to be tested using the primer pair of claim 1; (3) performing genotyping detection on the amplification product, and determining whether the sample material has caryophyllene according to the genotyping result; The genotyping method of step (3) is to determine the genotype of the molecular marker according to the type of fluorescence signal, and then determine whether the sample material has caryophyllene; When the Brassica chinensis to be tested is the allele genotype connected with the HEX fluorescence tag sequence, the Brassica chinensis to be tested does not contain caryophyllene; When the Brassica chinensis to be tested is the allele genotype connected with the FAM fluorescence tag sequence or is a heterozygote, the Brassica chinensis to be tested contains caryophyllene.

4. The method of claim 3, wherein, The reaction system for PCR amplification of step (2) is as follows: the total system for PCR amplification is 10 μl, including 2×KASP Master mix 5 μL, KASP Primer mix 0.14 μL, total genomic DNA 1.0 μL, and ddH2O 3.86 μL; The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 15 min; 95℃ denaturation for 20 s; 61-55℃ annealing and extension for 60 s, 10 cycles, each cycle decreasing by 0.6℃; 95℃ denaturation for 20 s; 55℃ annealing and extension for 60 s, 26 cycles.

5. The method of claim 3, wherein, The genotyping method of step (3) is as follows: after the PCR amplification reaction is completed, the PCR product is detected using an enzyme marker, the data is imported into KlusterCaller data processing software for analysis, cluster analysis is performed, the genotype of the samples aggregated near the X axis is the allele genotype connected with the FAM fluorescence tag sequence based on YNβc-F amplification, the genotype of the samples aggregated near the Y axis is the allele genotype connected with the HEX fluorescence tag sequence based on YNβc-H amplification, and the genotype of the intermediate samples is a heterozygote.

6. Use of the primer pair of claim 1 or the kit of claim 2 or the method of any one of claims 3 to 5 for identifying whether Brassica rapa contains caryophyllene.

Images