Automatic design method and system for microbial gene editing scheme and storage medium

Abstract

The invention discloses an automatic design method and system for a microbial gene editing scheme and a storage medium. The method comprises the steps that design objects are selected according to different types of strains, and the design objects are bacteria or fungi; after a target gene is determined, target gene information is obtained from an NCBI database; the design scheme of the bacteria comprises the following steps: determining a gRNA design area; selecting an optimal gRNA (guide Ribonucleic Acid) sequence; carrying out sequence complexity and GC content analysis; the design scheme of the fungus uses a frame shift scheme: the gRNA of the frame shift scheme is arranged at any position, which is not overlapped with other genes, behind an initiation codon in a gene; a gRNA sequence is screened in the gRNA design area, and the optimal gRNA sequence is selected; designing two pairs of four primer sequences for homologous arm identification primers; according to the scheme, a complicated and time-consuming manual scheme can be replaced, a large amount of time is saved, and the problem that the cost of manually designing the optimal site for gene knockout and designing the sgRNA sequence scheme is high is solved.

Description

Technical Field

[0001] The present invention relates to the field of gene editing, and in particular to a method, system and storage medium for automatically designing a microbial gene editing program. Background Art

[0002] Gene editing refers to the process of modifying specific targets in the genome of an organism through gene editing technology. Gene insertion, deletion or replacement can be achieved efficiently and accurately, thereby changing its genetic information and phenotypic characteristics. However, currently, editing schemes are mainly designed manually, but the design steps are cumbersome and time-consuming, which will increase the design cost; at the same time, it is highly dependent on the experience of experimental technicians, and inaccurate results may occur after the design, resulting in a lower success rate of gene editing. Summary of the invention

[0003] The purpose of the present invention is to propose an automatic design method for microbial gene editing schemes, which provides a scheme design of sgRNA sequences and homology arm primer sequences for gene editing experiments of various strains. The sgRNA sequence design method comprehensively considers factors such as design region and specificity, so that the gene editing success rate is higher, which can replace complicated and time-consuming manual schemes and save a lot of time for scientific research users.

[0004] The present invention also proposes a system for automatically designing a microbial gene editing scheme, which is used to execute the above-mentioned method for automatically designing a microbial gene editing scheme.

[0005] To achieve this object, the present invention adopts the following technical solutions:

[0006] A method for automatically designing a microbial gene editing scheme comprises the following steps:

[0007] (1) Select design objects for different types of strains, such as bacteria or fungi; after determining the target gene, obtain the target gene information from the NCBI database;

[0008] (2) If the design object of step (1) is selected as bacteria, only step (2-1) is executed; if the design object of step (1) is selected as fungi, step (2-2) is executed;

[0009] (2-1) The design scheme of bacteria includes the following steps:

[0010] (2-1-1) Determine the gRNA design region: When the gene is ≤1000 bp, the two gRNAs are designed in the region between 1 / 4 and 3 / 4 of the gene; when the gene is larger than 1000 bp, the two gRNAs are designed at both ends of the gene, with the first gRNA designed in the range of 100 to 400 bp on one side and the second gRNA designed in the range of 100 to 400 bp on the other side;

[0011] (2-1-2) Select the optimal gRNA sequence: Use CRISPOR software to screen the gRNA sequence in the gRNA design region, and all of them must meet the following three conditions:

[0012] ①Specificity Score is 100;

[0013] ②Off-targets prediction: All Off-targets are 0;

[0014] ③Doench'16 score ≥ 40;

[0015] (2-1-3) Sequence complexity analysis: Dot matrix analysis and GC content analysis were performed on the gene and its upstream and downstream sequences within 1000 bp, and the location of potential hairpin structures was identified;

[0016] (2-2) The design scheme for fungi uses a frameshift scheme, which includes the following steps:

[0017] (2-2-1) The gRNA of the frameshift scheme is set at any position after the start codon within the gene that does not overlap with other genes;

[0018] (2-2-2) Use CRISPOR software to screen gRNA sequences in the gRNA design region and select the optimal gRNA sequence according to the following rules:

[0019] ① Specificity Score ≥ 80, all off-target predictions are 0, Lindel score ≥ 80, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions;

[0020] (2-2-3) Sequence complexity analysis: Dot matrix analysis and GC content analysis were performed on the gene and its upstream and downstream sequences within 1000 bp, and the location of potential hairpin structures was identified;

[0021] (3) Design two pairs of four primer sequences for homology arm identification primers. The selection conditions of the primer design region are:

[0022] Upstream homology arm - reverse primer up-R: Primers can be designed from the right 200bp of the first upstream coding gene to the first 1 / 3 of the target gene, and those close to the start codon or stop codon of the gene are preferred;

[0023] Upstream homology arm - forward primer up-F: If the target gene length is ≤2000bp, design primers in the region between 450 and 600bp from the up-R primer; if the target gene length is greater than 2000bp, design primers in the region between 950 and 1100bp from the up-R primer;

[0024] Downstream homology arm down-F: Primers can be designed within 200bp from the last 1 / 3 of the target gene to the left end of the first downstream coding gene, and primers close to the start codon or stop codon of the gene are preferred;

[0025] Downstream homology arm down-R: If the target gene length is ≤2000bp, design primers in the region between 450 and 600bp from the down-F primer; if the target gene length is greater than 2000bp, design primers in the region between 950 and 1100bp from the down-F primer;

[0026] (4) Output the design results of sgRNA sequence and homology arm primer sequence.

[0027] Preferably, in step (1), the target gene is determined based on three characteristic identifiers: gene name, gene ID or locus tag.

[0028] Optimally, in the step (2-1-2), among the gRNA sequences that simultaneously meet the three conditions, the gRNA with the highest Lindel score is selected.

[0029] Optimally, in step (3), the homology arm primers meet the following criteria:

[0030] ① The primer Tm value is between 58 and 62°C;

[0031] ② The GC content of the primers is between 35% and 65%;

[0032] ③The last base at the 3' end is G or C;

[0033] ④ There should not be continuous 6bp complementary pairing between primer pairs;

[0034] ⑤ Primer sequence length is 17 to 30 bp.

[0035] It can be optimized that in the step (2-2-2), if there is no sequence that meets rule ①, then continue to use rule ② for screening;

[0036] ②Specificity Score ≥ 80, Lindel ≥ 70, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets rule ②, continue to use rule ③ for screening;

[0037] ③Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the frameshift knockout solution cannot be designed for the gene.

[0038] Optimally, in the step (2-2), the design scheme of the fungus uses a full gene knockout scheme instead of a frameshift scheme;

[0039] (2-2-1) The gRNA is placed within the range of 100 to 400 bp on both sides of the gene, avoiding the overlapping areas with other genes;

[0040] (2-2-2) Use CRISPOR software to screen gRNA sequences in the gRNA design region and select the optimal gRNA sequence according to the following rules:

[0041] ①Specificity Score ≥ 80, Lindel ≥ 80, Off-targets is 0, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets this rule, filter according to rule ②;

[0042] ②Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the full gene knockout plan cannot be designed for this gene;

[0043] (2-2-3) Sequence complexity analysis: Perform dot matrix analysis and GC content analysis on the gene and its upstream and downstream sequences within 1000 bp, and identify the location of potential hairpin structures.

[0044] An automatic design system for microbial gene editing schemes, comprising: a gene acquisition module, a bacterial design strategy module, a fungal design strategy module and a homology arm identification primer design module;

[0045] The gene acquisition module is used to select design objects for different types of strains, and the design objects are bacteria or fungi; after determining the target gene, the target gene information is obtained from the NCBI database; and according to the design object selected as bacteria or fungi, the bacterial design strategy module or the fungal design strategy module is called;

[0046] The bacterial design strategy module is used to determine the gRNA design region: when the gene is ≤1000bp, the two gRNAs are designed in the region between 1 / 4 and 3 / 4 of the gene; when the gene is greater than 1000bp, the two gRNAs are designed at both ends of the gene, the first gRNA is designed in the range of 100 to 400bp on one side, and the second gRNA is designed in the range of 100 to 400bp on the other side; and the optimal gRNA sequence is selected: the gRNA sequence is screened in the gRNA design region using CRISPOR software, and the following three conditions must be met:

[0047] ①Specificity Score is 100;

[0048] ②Off-targets prediction: All Off-targets are 0;

[0049] ③Doench'16 score ≥ 40;

[0050] The bacterial design strategy module is also used for sequence complexity analysis: after performing dot matrix analysis and GC content analysis on the gene and its upstream and downstream sequences within 1000 bp, the location of the potential hairpin structure is found;

[0051] The fungal design strategy module is used to implement the frameshift scheme: it sets the gRNA at any position after the start codon in the gene that does not overlap with other genes; and uses CRISPOR software to screen the gRNA sequence in the gRNA design region, and selects the optimal gRNA sequence according to the following rules:

[0052] ① Specificity Score ≥ 80, all off-target predictions are 0, Lindel score ≥ 80, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions;

[0053] The fungal design strategy module is also used to perform sequence complexity analysis: dot matrix analysis and GC content analysis of the gene and its upstream and downstream sequences within 1000 bp, and find out the location of potential hairpin structures;

[0054] The homology arm identification primer design module is used to design two pairs of four primer sequences for homology arm identification primers. The selection conditions of the primer design region are:

[0055] ① Upstream homology arm - reverse primer up-R: Primers can be designed from the right end of the first upstream coding gene 200bp to the first 1 / 3 of the target gene, and those close to the start codon or stop codon of the gene are preferred;

[0056] ② Upstream homology arm - forward primer up-F: If the target gene length is ≤2000bp, design primers in the region between 450-600bp from the up-R primer; if the target gene length is greater than 2000bp, design primers in the region between 950-1100bp from the up-R primer;

[0057] ③ Downstream homology arm down-F: Primers can be designed within 200bp from the last 1 / 3 of the target gene to the left end of the first downstream coding gene, and primers close to the start codon or stop codon of the gene are preferred;

[0058] ④ Downstream homology arm down-R: If the target gene length is ≤2000bp, design primers in the region between 450 and 600bp away from the down-F primer; if the target gene length is greater than 2000bp, design primers in the region between 950 and 1100bp away from the down-F primer.

[0059] It can be optimized that if there is no sequence that meets rule ①, continue to use rule ② to screen;

[0060] ②Specificity Score ≥ 80, Lindel ≥ 70, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions. If there is no sequence that meets this condition, filter according to rule ③;

[0061] ③Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the frameshift knockout solution cannot be designed for the gene.

[0062] The fungal design strategy module can be optimized to execute the full gene knockout scheme, setting the gRNA within the range of 100 to 400 bp on both sides of the gene to avoid overlapping regions with other genes; using CRISPOR software to screen the gRNA sequence in the gRNA design region, and selecting the optimal gRNA sequence according to the following rules:

[0063] ①Specificity Score ≥ 80, Lindel ≥ 80, Off-targets is 0, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets this rule, filter according to rule ②;

[0064] ②Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the full gene knockout plan cannot be designed for this gene.

[0065] A storage medium stores a processor-executable program, which is used to execute the above-mentioned method for automatically designing a microbial gene editing scheme when executed by the processor.

[0066] Compared with the prior art, one of the above technical solutions has the following beneficial effects:

[0067] This scheme provides the design of sgRNA sequences and homology arm primer sequences for gene editing experiments in various strains. Its sgRNA sequence design method comprehensively considers factors such as design region and specificity, making the gene editing success rate higher. It can replace complicated and time-consuming manual schemes, save a lot of time for scientific research users, and solve the problems of artificially designing the best site for gene knockout and the high cost of designing sgRNA sequence schemes. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 is the GC content analysis chart of Example 1;

[0069] Figure 2 It is a dot matrix analysis diagram of the sequence of Example 1;

[0070] Figure 3 is the GC content analysis chart of Example 2;

[0071] Figure 4 The sequence of Example 2 is a dot matrix analysis diagram;

[0072] Figure 5 is the GC content analysis chart of Example 3;

[0073] Figure 6 This is a dot matrix analysis diagram of the sequence of Example 3. DETAILED DESCRIPTION

[0074] Embodiments of the present invention are described in detail below, examples of which are shown in the accompanying drawings, wherein the same or similar reference numerals throughout represent the same or similar elements or elements having the same or similar functions. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and cannot be understood as limiting the present invention.

[0075] A method for automatically designing a microbial gene editing scheme comprises the following steps:

[0076] (1) Select design objects for different types of strains, such as bacteria or fungi; after determining the target gene, obtain the target gene information from the NCBI database;

[0077] After selecting the target strain and determining the target gene, the location, sequence and other genetic information of the target gene can be obtained from the NCBI database; the genetic structure of bacteria and fungi is different, so this protocol has different design strategies for different types of strains; further, the obtained genetic information is used to analyze the gRNA sequence, mainly to evaluate its potential off-target sites in the genome. Because off-target effects may lead to non-specific editing, affecting the accuracy and reliability of experimental results.

[0078] (2) If the design object of step (1) is selected as bacteria, only step (2-1) is executed; if the design object of step (1) is selected as fungi, step (2-2) is executed;

[0079] For bacteria such as Escherichia coli, Salmonella, Shigella, etc., specifically, step (2-1) is performed;

[0080] For fungi such as yeast, follow step (2-2);

[0081] (2-1) The design scheme of bacteria includes the following steps:

[0082] (2-1-1) Determine the gRNA design region: When the gene is ≤1000bp, the two gRNAs are designed in the region between 1 / 4 and 3 / 4 of the gene; when the gene is greater than 1000bp, the two gRNAs are designed at both ends of the gene, with the first gRNA designed in the range of 100 to 400bp on one side and the second gRNA designed in the range of 100 to 400bp on the other side; according to this gRNA design region, position selection has a significant effect on improving the success rate of gene editing.

[0083] (2-1-2) Select the optimal gRNA sequence: Use CRISPOR software to screen the gRNA sequence in the gRNA design region, and all of them must meet the following three conditions:

[0084] ①Specificity Score is 100;

[0085] The gRNA specificity score ranges from 0 to 100. The larger the score, the higher the targeting specificity of the gRNA sequence.

[0086] ② Off-target prediction: All Off-targets are 0. When all Off-target predictions are 0, it means there is no risk of off-target. Off-target means that the target is in areas other than the target area, resulting in failure of gene editing of the target gene.

[0087] ③Doench'16 score ≥ 40;

[0088] Doench'16 is a prediction of cutting efficiency. When the Doench'16 score is greater than 40, the proportion of cutting effect is about 50%, so 40 points is the minimum value limited by this scheme, which can ensure the best cutting efficiency.

[0089] http: / / crispor.tefor.net / can be used as one of the embodiments of the above-mentioned CRISPOR software. The three conditions in step (2-1-2) fully consider factors such as gRNA specificity, cutting efficiency, and off-target conditions.

[0090] (2-1-3) Sequence complexity analysis: The gene and its upstream and downstream 1000bp sequences were subjected to dot matrix analysis and GC content analysis, and the potential location of the hairpin structure was identified. After the location of the potential hairpin structure was identified, it was convenient to avoid the location of the hairpin structure in the subsequent primer design, as the hairpin structure would make it difficult for the primer to amplify the sequence.

[0091] The system will analyze the complexity and GC content of the gene sequence within a certain range before and after the mutation site to ensure the feasibility and accuracy of the editing plan. If the two pairs of primers are not complementary in structure, a single primer cannot form a hairpin structure. If the two pairs of primers are complementary in structure, a single primer can form a hairpin structure. The hairpin structure generally refers to the DNA molecule folding back on itself, with some bases close to each other, and the bases in the folded area are complementary and paired, and the folded part forms a hairpin structure, that is, the single-stranded DNA molecule folds back on itself, so that the complementary base pairs meet and form a hydrogen bond structure.

[0092] When designing primers, it is necessary to avoid hairpin structures with a loop portion less than 17bp. If a certain sequence is the reverse complementary sequence of another sequence, the DNA single-stranded molecule folds back on itself to form a hairpin structure. A 4bp sequence is taken from the sequence in sequence (the subscript of the last base is recorded) for reverse complementary conversion (A becomes T, T becomes A, G becomes C, C becomes G, and then the sequence is reversed). This is then used as a pattern to search for the same sequence in the entire sequence, and the index subscript of the sequence that is the same as the pattern is obtained. If the subscript differs from the subscript of the pattern by less than 17, it is a hairpin structure with a loop portion less than 17bp. If such a structure appears twice, the iteration is terminated and the region is excluded.

[0093] (2-2) The design scheme for fungi uses a frameshift scheme, which includes the following steps:

[0094] (2-2-1) The gRNA of the frameshift scheme is set at any position after the start codon within the gene that does not overlap with other genes;

[0095] The gRNA of the frameshift scheme can be set inside the gene, mainly to avoid regions overlapping with other genes.

[0096] (2-2-2) Use CRISPOR software to screen gRNA sequences in the gRNA design region and select the optimal gRNA sequence according to the following rules:

[0097] ① Specificity Score ≥ 80, all off-target predictions are 0, Lindel score ≥ 80, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions;

[0098] (2-2-3) Sequence complexity analysis: Dot matrix analysis and GC content analysis were performed on the gene and its upstream and downstream 1000bp sequences, and the location of potential hairpin structures was found;

[0099] (3) Design two pairs of four primer sequences for homology arm identification primers. The selection conditions of the primer design region are:

[0100] Upstream homology arm - reverse primer up-R: Primers can be designed from the right 200bp of the first upstream coding gene to the first 1 / 3 of the target gene, and those close to the start codon or stop codon of the gene are preferred;

[0101] Upstream homology arm - forward primer up-F: If the target gene length is ≤2000bp, design primers in the region between 450 and 600bp from the up-R primer; if the target gene length is greater than 2000bp, design primers in the region between 950 and 1100bp from the up-R primer;

[0102] Downstream homology arm down-F: Primers can be designed within 200bp from the last 1 / 3 of the target gene to the left end of the first downstream coding gene, and primers close to the start codon or stop codon of the gene are preferred;

[0103] Downstream homology arm down-R: If the target gene length is ≤2000bp, design primers in the region between 450 and 600bp from the down-F primer; if the target gene length is greater than 2000bp, design primers in the region between 950 and 1100bp from the down-F primer;

[0104] Primers are used for PCR amplification reaction to identify the genotype after gene editing and confirm whether the gene editing is successful. This scheme designs two pairs of four primer sequences according to the above conditions. On the one hand, there are requirements for the length of primer PCR amplification (the longer the primer, the more difficult it is to amplify). On the other hand, considering the method of identifying the genotype, the primers are reasonably designed. After completing the PCR amplification, it is easier to judge whether the gene editing is successful based on the comparison of the genotype before and after.

[0105] (4) Output the design results of sgRNA sequence and homology arm primer sequence.

[0106] This scheme provides the design of sgRNA sequences and homology arm primer sequences for gene editing experiments in various strains. Its sgRNA sequence design method comprehensively considers factors such as design region and specificity, making the gene editing success rate higher. It can replace complicated and time-consuming manual schemes, save a lot of time for scientific research users, and solve the problems of artificially designing the best site for gene knockout and the high cost of designing sgRNA sequence schemes.

[0107] Preferably, in step (1), the target gene is determined based on three characteristic identifiers: gene name, gene ID or locus tag.

[0108] This solution only requires selecting a specific strain and target gene, and an optimal solution can be automatically obtained according to steps (2) and (3), saving a lot of time for scientific research users.

[0109] The gene name is a description of the gene's function and is usually composed of symbols that reflect the gene's function or characteristics.

[0110] Gene ID is the unique identifier of a gene in the database;

[0111] Locus tag is a unique identifier of a gene or gene sequence in a genome. It usually consists of two parts: a prefix and a suffix, separated by an underscore. The prefix is ​​the genome identifier, indicating that the gene belongs to a specific genome; the suffix is ​​a number that indicates the order or uniqueness of the gene in the genome.

[0112] Optimally, in the step (2-1-2), among the gRNA sequences that simultaneously meet the three conditions, the gRNA with the highest Lindel score is selected.

[0113] The Lindel score is the probability that the gRNA sequence can cause the insertion or deletion of the DNA sequence. The higher the score, the higher the success rate of the gRNA in causing the target gene to change.

[0114] Optimally, in step (3), the homology arm primers meet the following criteria:

[0115] ① The primer Tm value is between 58 and 62°C;

[0116] ② The GC content of the primers is between 35% and 65%;

[0117] ③The last base at the 3' end is G or C;

[0118] ④ There should not be continuous 6bp complementary pairing between primer pairs;

[0119] ⑤ Primer sequence length is 17 to 30 bp.

[0120] It can be optimized that in the step (2-2-2), if there is no sequence that meets rule ①, then continue to use rule ② for screening;

[0121] ②Specificity Score ≥ 80, Lindel ≥ 70, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets rule ②, continue to use rule ③ for screening;

[0122] ③Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the frameshift knockout solution cannot be designed for the gene.

[0123] Optimally, in the step (2-2), the design scheme of the fungus uses a full gene knockout scheme instead of a frameshift scheme;

[0124] (2-2-1) The gRNA is placed within the range of 100 to 400 bp on both sides of the gene, avoiding the overlapping areas with other genes;

[0125] (2-2-2) Use CRISPOR software to screen gRNA sequences in the gRNA design region and select the optimal gRNA sequence according to the following rules:

[0126] ①Specificity Score ≥ 80, Lindel ≥ 80, Off-targets is 0, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets this rule, filter according to rule ②;

[0127] ②Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the full gene knockout plan cannot be designed for this gene;

[0128] (2-2-3) Sequence complexity analysis: The gene and its upstream and downstream 1000bp sequences were subjected to dot matrix analysis and GC content analysis to identify the location of potential hairpin structures.

[0129] This scheme can choose the whole gene knockout or frameshift scheme according to the needs. The whole gene knockout is more difficult, but if the experiment is successful, the gene knockout is more thorough, and the gene frameshift may not affect the function of the gene. Each has its advantages and is feasible.

[0130] An automatic design system for microbial gene editing schemes, comprising: a gene acquisition module, a bacterial design strategy module, a fungal design strategy module and a homology arm identification primer design module;

[0131] The gene acquisition module is used to select design objects for different types of strains, and the design objects are bacteria or fungi; after determining the target gene, the target gene information is obtained from the NCBI database; and according to the design object selected as bacteria or fungi, the bacterial design strategy module or the fungal design strategy module is called;

[0132] The bacterial design strategy module is used to determine the gRNA design region: when the gene is ≤1000bp, the two gRNAs are designed in the region between 1 / 4 and 3 / 4 of the gene; when the gene is greater than 1000bp, the two gRNAs are designed at both ends of the gene, the first gRNA is designed in the range of 100 to 400bp on one side, and the second gRNA is designed in the range of 100 to 400bp on the other side; and the optimal gRNA sequence is selected: the gRNA sequence is screened in the gRNA design region using CRISPOR software, and the following three conditions must be met:

[0133] ①Specificity Score is 100;

[0134] ②Off-targets prediction: All Off-targets are 0;

[0135] ③Doench'16 score ≥ 40;

[0136] The bacterial design strategy module is also used for sequence complexity analysis: after performing dot matrix analysis and GC content analysis on the gene and its upstream and downstream 1000 bp sequences, the location of the potential hairpin structure is found;

[0137] The fungal design strategy module is used to implement the frameshift scheme: it sets the gRNA at any position after the start codon in the gene that does not overlap with other genes; and uses CRISPOR software to screen the gRNA sequence in the gRNA design region, and selects the optimal gRNA sequence according to the following rules:

[0138] ① Specificity Score ≥ 80, Off-targets prediction is all 0, Lindel score ≥ 80, and the gRNA with the highest Lindel score is selected from the gRNAs that meet the above conditions; the fungal design strategy module is also used to perform sequence complexity analysis: dot matrix analysis and GC content analysis of the gene and its upstream and downstream 1000bp sequence, and find the location of the potential hairpin structure;

[0139] The homology arm identification primer design module is used to design two pairs of four primer sequences for homology arm identification primers. The selection conditions of the primer design region are:

[0140] ① Upstream homology arm - reverse primer up-R: Primers can be designed from the right end of the first upstream coding gene 200bp to the first 1 / 3 of the target gene, and those close to the start codon or stop codon of the gene are preferred;

[0141] ② Upstream homology arm - forward primer up-F: If the target gene length is ≤2000bp, design primers in the region between 450-600bp from the up-R primer; if the target gene length is greater than 2000bp, design primers in the region between 950-1100bp from the up-R primer;

[0142] ③ Downstream homology arm down-F: Primers can be designed within 200bp from the last 1 / 3 of the target gene to the left end of the first downstream coding gene, and primers close to the start codon or stop codon of the gene are preferred;

[0143] ④ Downstream homology arm down-R: If the target gene length is ≤2000bp, design primers in the region between 450 and 600bp away from the down-F primer; if the target gene length is greater than 2000bp, design primers in the region between 950 and 1100bp away from the down-F primer.

[0144] It can be optimized that if there is no sequence that meets rule ①, continue to use rule ② to screen;

[0145] ②Specificity Score ≥ 80, Lindel ≥ 70, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions. If there is no sequence that meets this condition, filter according to rule ③;

[0146] ③Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the frameshift knockout solution cannot be designed for the gene.

[0147] The fungal design strategy module can be optimized to execute the full gene knockout scheme, setting the gRNA within the range of 100 to 400 bp on both sides of the gene to avoid overlapping regions with other genes; using CRISPOR software to screen the gRNA sequence in the gRNA design region, and selecting the optimal gRNA sequence according to the following rules:

[0148] ①Specificity Score ≥ 80, Lindel ≥ 80, Off-targets is 0, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets this rule, filter according to rule ②;

[0149] ②Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the full gene knockout plan cannot be designed for this gene.

[0150] A storage medium stores a processor-executable program, which is used to execute the above-mentioned method for automatically designing a microbial gene editing scheme when executed by the processor.

[0151] Embodiment 1:

[0152] A method for automatically designing a microbial gene editing scheme comprises the following steps:

[0153] (1) Select design objects for different types of strains. The design object is Escherichia coli, the strain is K-12 substr.MG1655, the gene ID is 944749, the gene name is yaaA, and the Locus tag is b0006. After determining the target gene, obtain the target gene information from the NCBI database;

[0154] (2) Select Escherichia coli as the design object and execute step (2-1);

[0155] (2-1) The design scheme of bacteria includes the following steps:

[0156] (2-1-1) Determine the gRNA design region: When the gene is 776 bp and is ≤1000 bp, the two gRNAs are designed in the region between 1 / 4 and 3 / 4 of the gene;

[0157] (2-1-2) Select the optimal gRNA sequence: Use CRISPOR software to screen the gRNA sequence in the gRNA design region, and all of them must meet the following three conditions:

[0158] ①Specificity Score is 100;

[0159] ②Off-targets prediction: All Off-targets are 0;

[0160] ③Doench'16 score ≥ 40;

[0161] For gRNA sequences that meet all three conditions, the gRNA with the highest Lindel score is selected.

[0162] The final screening results of gRNA sequences are:

[0163] ①gRNA1(rev) is CATCACCAACAAGCTGAACG AGG(100,85); the specificity score is 100 and the predicted cutting efficiency score is 85.

[0164] ②gRNA2 (rev) is TCCGTCTTGAGAATGCCCGA GGG (100,82); the specificity score is 100 and the cutting efficiency prediction score is 82.

[0165] (2-1-3) Sequence complexity analysis: The gene and its upstream and downstream 1000bp sequences were subjected to dot matrix analysis (such as Figure 2 and Table 1) and GC content analysis (e.g. Figure 1 ), and find out the position of potential hairpin structure, as shown in Table 2;

[0166] Table 1-Data of dot array analysis of genes and their upstream and downstream 1000bp sequences

[0167] Start 21 32 181 243 332 375 492 508 642 End 30 41 190 252 341 384 502 518 651 Start 677 777 869 977 1188 1201 1505 1538 1603 End 686 786 878 990 1198 1211 1515 1548 1613 Start 1701 1796 1894 2013 2163 2311 2396 2421 2498 End 1710 1806 1904 2022 2173 2321 2410 2437 2508 Start 2521 End 2530

[0168] ±1000 bp fragments of the target region were aligned to themselves to determine if there were any complex sequences. Figure 2 As shown in Table 1, the average GC content in the target region of ±1000 bp fragments is 50.41%. This region is suitable for PCR screening or sequencing analysis to find the location of potential hairpin structures, as shown in Table 2.

[0169] Table 2 - Location of hairpin structures

[0170] Start 26 41 76 90 201 231 264 319 362 End 40 75 88 131 221 256 318 349 389 Start 390 431 472 498 559 609 628 696 729 End 416 441 496 538 569 622 685 722 739 Start 740 753 804 855 923 997 1027 1050 1080 End 752 776 825 905 987 1025 1044 1072 1105 Start 1114 1146 1184 1209 1234 1259 1330 1395 1420 End 1135 1164 1202 1228 1254 1316 1376 1415 1432 Start 1446 1474 1532 1570 1593 1618 1728 1784 1796 End 1461 1525 1563 1580 1610 1700 1764 1794 1820 Start 1844 1897 1919 1969 1998 2059 2177 2218 2267 End 1865 1917 1953 1980 2058 2163 2185 2237 2309 Start 2310 2388 2407 2442 2476 2538 2591 2616 2660 End 2336 2406 2439 2471 2498 2557 2612 2636 2686 Start 2717 End 2738

[0171] (3) Upstream homology arm - reverse primer up-R: Primers can be designed from the right end of the first upstream coding gene 200 bp to the first 1 / 3 of the target gene, and those close to the start codon or stop codon of the gene are preferred;

[0172] Upstream homology arm - forward primer up-F: Design primers in the region between 450 and 600 bp from the up-R primer;

[0173] Downstream homology arm down-F: Primers can be designed within 200bp from the last 1 / 3 of the target gene to the left end of the first downstream coding gene, and primers close to the start codon or stop codon of the gene are preferred;

[0174] Downstream homology arm down-R: Design primers in the region between 450 and 600 bp from down-F primer;

[0175] The homology arm primers meet the following criteria:

[0176] ① The primer Tm value is between 58 and 62°C;

[0177] ② The GC content of the primers is between 35% and 65%;

[0178] ③The last base at the 3' end is G or C;

[0179] ④ There should not be continuous 6bp complementary pairing between primer pairs;

[0180] ⑤ Primer sequence length is 17 to 30 bp.

[0181] Thus, two pairs of four primer sequences were designed for homology arm identification primers, and the selection conditions of the primer design region were:

[0182] Upstream homology arm-reverse primer up-R: GTTGCAGTCAATGCCGGATG;

[0183] Upstream homology arm-forward primer up-F: CAGCCCGGCTTTTTTATGAAG;

[0184] Downstream homology arm down-F: CAGGTGAAATAAGAATCAGCATATC;

[0185] Downstream homology arm down-R: AATGGGTTCCTGGGGTGC.

[0186] (4) Output design results.

[0187] Embodiment 2:

[0188] A method for automatically designing a microbial gene editing scheme comprises the following steps:

[0189] (1) Select design objects for different types of strains. The design object is yeast, the strain is Saccharomyces cerevisiae S288c, the gene ID is 851839, the gene name is BTT1, the gene length is 449 bp, and the Locus tag is YDR252W. After determining the target gene, obtain the target gene information from the NCBI database;

[0190] (2) Select yeast as the design object and execute step (2-2);

[0191] (2-2) The design scheme for fungi uses a frameshift scheme, which includes the following steps:

[0192] (2-2-1) The gRNA of the frameshift scheme is set at any position after the start codon within the gene that does not overlap with other genes;

[0193] (2-2-2) Use CRISPOR software to screen gRNA sequences in the gRNA design region and select the optimal gRNA sequence according to the following rules:

[0194] ① Specificity Score ≥ 80, all off-target predictions are 0, Lindel score ≥ 80, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions;

[0195] ②Specificity Score ≥ 80, Lindel ≥ 70, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets rule ②, continue to use rule ③ for screening;

[0196] ③Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the frameshift knockout solution cannot be designed for the gene.

[0197] The gRNA1(rev) screened out was ATGAAGTTCAGCTTGTAACTTGG(100,90); the specificity score was 100 and the cutting efficiency prediction score was 90.

[0198] (2-2-3) Sequence complexity analysis: The gene and its upstream and downstream 500bp sequences were subjected to dot matrix analysis (such as Figure 4 and Table 3) and GC content analysis (e.g. Figure 3 ), and find out the position of potential hairpin structure, as shown in Table 4;

[0199] Table 3-Data of dot array analysis of genes and their upstream and downstream 500bp sequences

[0200] Start 13 147 180 257 274 391 429 554 1050 End 22 158 190 266 283 402 438 563 1059 Start 1311 1437 End 1320 1450

[0201] The ±500 bp fragment of the target region is aligned with itself to determine if there is a complex sequence. Figure 4 As shown in Table 3, in the target region of ±500bp fragment, the average GC content is 36.62%. This region is suitable for PCR screening or sequencing analysis. This region is suitable for PCR screening or sequencing analysis to find the location of potential hairpin structures, as shown in Table 4.

[0202] Table 4 - Location of hairpin structures

[0203] Start 36 65 153 225 247 275 297 316 390 End 60 98 214 241 272 286 311 376 416 Start 420 466 489 522 560 577 627 739 823 End 433 487 510 550 570 607 737 821 883 Start 899 939 1008 1035 1094 1204 1235 1291 1315 End 920 992 1026 1078 1104 1226 1286 1314 1385

[0204] (3) Design two pairs of four primer sequences for homology arm identification primers. The selection conditions of the primer design region are:

[0205] Upstream homology arm - reverse primer up-R: Primers can be designed from the right 200bp of the first upstream coding gene to the first 1 / 3 of the target gene, and those close to the start codon or stop codon of the gene are preferred;

[0206] Upstream homology arm - forward primer up-F: Design primers in the region between 450 and 600 bp from the up-R primer;

[0207] Downstream homology arm down-F: Primers can be designed within 200bp from the last 1 / 3 of the target gene to the left end of the first downstream coding gene, and primers close to the start codon or stop codon of the gene are preferred;

[0208] Downstream homology arm down-R: Design primers in the region between 450 and 600 bp from down-F primer;

[0209] The homology arm primers meet the following criteria:

[0210] ① The primer Tm value is between 58 and 62°C;

[0211] ② The GC content of the primers is between 35% and 65%;

[0212] ③The last base at the 3' end is G or C;

[0213] ④ There should not be continuous 6bp complementary pairing between primer pairs;

[0214] ⑤ Primer sequence length is 17 to 30 bp.

[0215] Thus, two pairs of four primer sequences were designed for homology arm identification primers, and the selection conditions of the primer design region were:

[0216] Upstream homology arm-reverse primer up-R: GGCATTTGATGTTGTAGGATTATG;

[0217] Upstream homology arm-forward primer up-F: TGCGGATTCTGCTCCGTG;

[0218] Downstream homology arm down-F: CAACAAGTGATGAATAGCTGAC;

[0219] Downstream homology arm down-R: CACCGAAGTCCAGCAAAAGC.

[0220] (4) Output design results.

[0221] Embodiment 3:

[0222] A method for automatically designing a microbial gene editing scheme comprises the following steps:

[0223] (1) Select design objects for different types of strains. The design object is yeast, the strain is Saccharomyces cerevisiae S288c, the gene ID is 851839, the gene name is BTT1, the gene length is 449 bp, and the Locus tag is YDR252W. After determining the target gene, obtain the target gene information from the NCBI database;

[0224] (2) Select yeast as the design object and execute step (2-2);

[0225] (2-2) The design scheme for fungi uses a full gene knockout scheme; the full gene knockout scheme includes the following steps:

[0226] (2-2-1) The gRNA is placed within the range of 100 to 400 bp on both sides of the gene, avoiding the overlapping areas with other genes;

[0227] (2-2-2) Use CRISPOR software to screen gRNA sequences in the gRNA design region and select the optimal gRNA sequence according to the following rules:

[0228] ①Specificity Score ≥ 80, Lindel ≥ 80, Off-targets is 0, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets this rule, filter according to rule ②;

[0229] ②Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the full gene knockout plan cannot be designed for this gene.

[0230] The gRNA1(fw) screened out was TTATCAGCAGCAAACAAAGTTGG(100,76); its specificity score was 100 and its cutting efficiency prediction score was 76.

[0231] The gRNA2 (fw) screened out was CAAGAACTTGAGTATTTGACAGG (100,79); the specificity score was 100 and the cutting efficiency prediction score was 79.

[0232] (2-2-3) Sequence complexity analysis: The gene and its upstream and downstream 1000bp sequences were subjected to dot matrix analysis (such as Figure 6 and Table 5) and GC content analysis (e.g. Figure 5 ), and find out the position of potential hairpin structure, as shown in Table 6;

[0233] Table 5-Data of dot array analysis of genes and their upstream and downstream 1000bp sequences

[0234] Start 262 513 548 647 680 757 774 891 929 End 272 522 557 658 690 766 783 902 938 Start 1054 1550 1636 1766 1811 1937 2092 2171 2184 End 1063 1559 1648 1776 1820 1950 2101 2180 2196 Start 2357 End 2381

[0235] ±1000 bp fragments of the target region were aligned to themselves to determine if there were any complex sequences. Figure 6 As shown in Table 5, in the target region of ±1000bp fragments, the average GC content is 36.12%. This region is suitable for PCR screening or sequencing analysis. This region is suitable for PCR screening or sequencing analysis to find the location of potential hairpin structures, as shown in Table 6.

[0236] Table 6 - Location of hairpin structures

[0237] Start 3 41 84 141 163 220 287 330 384 End 26 60 128 161 200 252 321 365 420 Start 426 536 565 653 725 747 775 797 816 End 448 560 598 714 741 772 786 811 876 Start 890 920 966 989 1022 1060 1077 1127 1239 End 916 933 987 1010 1050 1070 1107 1237 1321 Start 1323 1399 1439 1508 1535 1594 1704 1735 1791 End 1383 1420 1492 1526 1578 1604 1726 1786 1814 Start 1815 1947 1966 2009 2131 2231 2258 2352 2406 End 1885 1960 1982 2119 2172 2244 2351 2396 2430 Start 2433 End 2448

[0238] (3) Design two pairs of four primer sequences for homology arm identification primers. The selection conditions of the primer design region are:

[0239] Upstream homology arm - reverse primer up-R: Primers can be designed from the right 200bp of the first upstream coding gene to the first 1 / 3 of the target gene, and those close to the start codon or stop codon of the gene are preferred;

[0240] Upstream homology arm - forward primer up-F: Design primers in the region between 450 and 600 bp from the up-R primer;

[0241] Downstream homology arm down-F: Primers can be designed within 200bp from the last 1 / 3 of the target gene to the left end of the first downstream coding gene, and primers close to the start codon or stop codon of the gene are preferred;

[0242] Downstream homology arm down-R: Design primers in the region between 450 and 600 bp from down-F primer;

[0243] The homology arm primers meet the following criteria:

[0244] ① The primer Tm value is between 58 and 62°C;

[0245] ② The GC content of the primers is between 35% and 65%;

[0246] ③The last base at the 3' end is G or C;

[0247] ④ There should not be continuous 6bp complementary pairing between primer pairs;

[0248] ⑤ Primer sequence length is 17 to 30 bp.

[0249] Thus, two pairs of four primer sequences were designed for homology arm identification primers, and the selection conditions of the primer design region were:

[0250] Upstream homology arm-reverse primer up-R: GGCATTTGATGTTGTAGGATTATG;

[0251] Upstream homology arm-forward primer up-F: TGCGGATTCTGCTCCGTG;

[0252] Downstream homology arm down-F: CAACAAGTGATGAATAGCTGAC;

[0253] Downstream homology arm down-R: CACCGAAGTCCAGCAAAAGC.

[0254] (4) Output design results.

[0255] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A method for automatically designing a microbial gene editing scheme, characterized in that: The following steps are involved: (1) Select design objects for different types of strains, such as bacteria or fungi; after determining the target gene, obtain the target gene information from the NCBI database; (2) If the design object selected in step (1) is bacteria, only step (2-1) is performed; If the design object selected in step (1) is fungus, execute step (2-2); (2-1) The design scheme of bacteria includes the following steps: (2-1-1) Determine the gRNA design region: When the gene is ≤1000 bp, the two gRNAs are designed in the region between 1 / 4 and 3 / 4 of the gene; when the gene is larger than 1000 bp, the two gRNAs are designed at both ends of the gene, with the first gRNA designed in the range of 100 to 400 bp on one side and the second gRNA designed in the range of 100 to 400 bp on the other side; (2-1-2) Select the optimal gRNA sequence: Use CRISPOR software to screen the gRNA sequence in the gRNA design region, and all of them must meet the following three conditions: ①Specificity Score is 100; ②Off-targets prediction: All Off-targets are 0; ③Doench'16 score ≥ 40; (2-1-3) Sequence complexity analysis: Dot matrix analysis and GC content analysis were performed on the gene and its upstream and downstream sequences within 1000 bp, and the location of potential hairpin structures was identified; (2-2) The design scheme for fungi uses a frameshift scheme, which includes the following steps: (2-2-1) The gRNA of the frameshift scheme is set at any position after the start codon within the gene that does not overlap with other genes; (2-2-2) Use CRISPOR software to screen gRNA sequences in the gRNA design region and select the optimal gRNA sequence according to the following rules: ① Specificity Score ≥ 80, all off-target predictions are 0, Lindel score ≥ 80, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; (2-2-3) Sequence complexity analysis: Dot matrix analysis and GC content analysis were performed on the gene and its upstream and downstream sequences within 1000 bp, and the location of potential hairpin structures was identified; (3) Design two pairs of four primer sequences for homology arm identification primers. The selection conditions of the primer design region are: Upstream homology arm - reverse primer up-R: Primers can be designed from the right 200bp of the first upstream coding gene to the first 1 / 3 of the target gene, and those close to the start codon or stop codon of the gene are preferred; Upstream homology arm - forward primer up-F: If the target gene length is ≤2000bp, design primers in the region between 450 and 600bp from the up-R primer; if the target gene length is greater than 2000bp, design primers in the region between 950 and 1100bp from the up-R primer; Downstream homology arm down-F: Primers can be designed within 200bp from the last 1 / 3 of the target gene to the left end of the first downstream coding gene, and primers close to the start codon or stop codon of the gene are preferred; Downstream homology arm down-R: If the target gene length is ≤2000bp, design primers in the region between 450 and 600bp from the down-F primer; if the target gene length is greater than 2000bp, design primers in the region between 950 and 1100bp from the down-F primer; (4) Output the design results of sgRNA sequence and homology arm primer sequence.

2. The method for automatically designing a microbial gene editing scheme according to claim 1, characterized in that: In the step (1), the target gene is determined based on three characteristic identifiers: gene name, gene ID or locus tag.

3. The method for automatically designing a microbial gene editing scheme according to claim 1, characterized in that: In the step (2-1-2), among the gRNA sequences that simultaneously meet the three conditions, the gRNA with the highest Lindel score is selected.

4. The method for automatically designing a microbial gene editing scheme according to claim 1, characterized in that: In step (3), the homology arm primers meet the following criteria: ① The primer Tm value is between 58 and 62°C; ② The GC content of the primers is between 35% and 65%; ③The last base at the 3' end is G or C; ④ There should not be continuous 6bp complementary pairing between primer pairs; ⑤ Primer sequence length is 17 to 30 bp.

5. The method for automatically designing a microbial gene editing scheme according to claim 1, characterized in that: In the step (2-2-2), if there is no sequence that meets rule ①, continue to use rule ② to screen; ②Specificity Score ≥ 80, Lindel ≥ 70, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets rule ②, continue to use rule ③ for screening; ③Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the frameshift knockout solution cannot be designed for the gene.

6. A method for automatically designing a microbial gene editing scheme according to any one of claims 1 to 3, characterized in that: In the step (2-2), the fungal design scheme uses a full gene knockout scheme instead of a frameshift scheme; (2-2-1) The gRNA is placed within the range of 100 to 400 bp on both sides of the gene, avoiding the overlapping areas with other genes; (2-2-2) Use CRISPOR software to screen gRNA sequences in the gRNA design region and select the optimal gRNA sequence according to the following rules: ①Specificity Score ≥ 80, Lindel ≥ 80, Off-targets is 0, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets this rule, filter according to rule ②; ②Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the full gene knockout plan cannot be designed for this gene; (2-2-3) Sequence complexity analysis: Perform dot matrix analysis and GC content analysis on the gene and its upstream and downstream sequences within 1000 bp, and identify the location of potential hairpin structures.

7. A microbial gene editing program automatic design system, characterized in that: include: Gene acquisition module, bacterial design strategy module, fungal design strategy module and homology arm identification primer design module; The gene acquisition module is used to select design objects for different types of strains, and the design objects are bacteria or fungi; After determining the target gene, obtain the target gene information from the NCBI database; and according to the design object being selected as bacteria or fungi, calling the bacteria design strategy module or the fungus design strategy module; The bacterial design strategy module is used to determine the gRNA design region: when the gene is ≤1000bp, the two gRNAs are designed in the region between 1 / 4 and 3 / 4 of the gene; when the gene is greater than 1000bp, the two gRNAs are designed at both ends of the gene, the first gRNA is designed in the range of 100 to 400bp on one side, and the second gRNA is designed in the range of 100 to 400bp on the other side; and the optimal gRNA sequence is selected: the gRNA sequence is screened in the gRNA design region using CRISPOR software, and the following three conditions must be met: ①Specificity Score is 100; ②Off-targets prediction: All Off-targets are 0; ③Doench'16 score ≥ 40; The bacterial design strategy module is also used for sequence complexity analysis: after performing dot matrix analysis and GC content analysis on the gene and its upstream and downstream sequences within 1000 bp, the location of the potential hairpin structure is found; The fungal design strategy module is used to implement the frameshifting scheme: the gRNA is set at any position after the start codon in the gene that does not overlap with other genes; and the gRNA sequence is screened in the gRNA design region using CRISPOR software, and the optimal gRNA sequence is selected according to the following rules: ① Specificity Score ≥ 80, all off-target predictions are 0, Lindel score ≥ 80, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; The fungal design strategy module is also used to perform sequence complexity analysis: dot matrix analysis and GC content analysis of the gene and its upstream and downstream sequences within 1000 bp, and find out the location of potential hairpin structures; The homology arm identification primer design module is used to design two pairs of four primer sequences for homology arm identification primers. The selection conditions of the primer design region are: ① Upstream homology arm - reverse primer up-R: Primers can be designed from the right end of the first upstream coding gene 200bp to the first 1 / 3 of the target gene, and those close to the start codon or stop codon of the gene are preferred; ② Upstream homology arm - forward primer up-F: If the target gene length is ≤2000bp, design primers in the region between 450-600bp away from the up-R primer; If the target gene is longer than 2000 bp, design primers in the region between 950-1100 bp from the up-R primer; ③ Downstream homology arm down-F: Primers can be designed within 200bp from the last 1 / 3 of the target gene to the left end of the first downstream coding gene, and primers close to the start codon or stop codon of the gene are preferred; ④ Downstream homology arm down-R: If the target gene length is ≤2000bp, design primers in the region between 450 and 600bp from the down-F primer; If the target gene is longer than 2000 bp, design primers in the region between 950 and 1100 bp from the down-F primer.

8. The automatic design system for microbial gene editing scheme according to claim 7, characterized in that: If there is no sequence that meets rule ①, continue to use rule ② to filter; ②Specificity Score ≥ 80, Lindel ≥ 70, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, filter according to rule ③; ③Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the frameshift knockout solution cannot be designed for the gene.

9. The automatic design system for microbial gene editing scheme according to claim 7, characterized in that: The fungal design strategy module is also used to implement the full gene knockout scheme, setting the gRNA within the range of 100 to 400 bp on both sides of the gene to avoid overlapping areas with other genes; using CRISPOR software to screen the gRNA sequence in the gRNA design area, and selecting the optimal gRNA sequence according to the following rules: ①Specificity Score ≥ 80, Lindel ≥ 80, Off-targets is 0, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets this rule, filter according to rule ②; ②Specificity Score ≥ 70, Lindel ≥ 60, select the gRNA with the highest Lindel score from the gRNAs that meet the above conditions; if there is no sequence that meets the conditions, the full gene knockout plan cannot be designed for this gene.

10. A storage medium storing a program executable by a processor, characterized in that: The processor-executable program is used to execute a method for automatically designing a microbial gene editing scheme as described in any one of claims 1 to 6 when executed by the processor.

Images