Process for preparing golden flower and ginseng composition by solid-state fermentation method, golden flower and ginseng composition and application of golden flower and ginseng composition

Abstract

The invention relates to a process for preparing a golden flower and ginseng composition by a solid-state fermentation method, the golden flower and ginseng composition and application of the golden flower and ginseng composition. According to the process, ginseng slices are inoculated with golden flower fungi for fermentation, protein in ginseng is converted into polypeptide, the content of saponin in ginseng is increased, conversion of dry ginsenoside is achieved, and the content of the golden flower fungi is increased; the content of a rare saponin active component Rg3 in ginseng is remarkably increased, flavor substances of the product are increased, the product has richer flavor and taste, low-temperature superfine grinding is further adopted for manufacturing, the flavor and nutrient substances are locked, and the taste restorability is better. The golden flower and ginseng composition disclosed by the invention is rich in flavor, high in content of effective components, safe, non-toxic, smooth in taste and not dry, and can be used as a substitute tea or food material, a health-care food (blue hat) material and the like.

Description

Technical Field

[0001] The invention belongs to the field of food and health food, and particularly relates to a process for preparing a golden flower ginseng composition by a solid-state fermentation method, the golden flower ginseng composition and an application thereof. Background Art

[0002] Golden Flower, scientifically known as Eurotium cristatum, commonly known as "Golden Flower", is a fungus that plays an important role in the fermentation process of Fuzhuan tea and plays an important role in the quality of Fuzhuan tea. Golden Flower has many health benefits, including anti-oxidation, aiding digestion, regulating blood lipids, and promoting intestinal health.

[0003] Most of the existing Jinhua mushroom products are based on tea leaves, and are prepared into tea slices or substitute teas by combining other materials to play the corresponding health care functions. However, tea leaves and slices need to be dried and processed for preservation. The process will lose antioxidants and glycosides, so the products have problems such as short shelf life and poor taste recovery. Moreover, when preparing these tea slices or tea leaves, the fermentation process is usually through: a) using tea such as Fuzhuan tea containing Jinhua mushrooms and the target material for co-fermentation. Generally, after the tea leaves are fermented, they are mixed into the target material, and the golden flowers produced by the tea leaves are transferred to the material. In this process, the fermentation results of each batch cannot be unified, the Jinhua mushrooms cannot be completely fermented on the material, and the product is also mixed with the flavor of tea leaves. b) After the tea and the target material are all stirred and pulped, the strain is added for fermentation, and the fermentation is completely uniform. This method has uniform fermentation, and the product quality and flavor are relatively uniform, but it also brings in the flavor of tea leaves and other auxiliary materials that produce golden flowers, such as tea leaves, sucrose, etc., and the crushing methods such as stirring will cause the loss of nutrients and flavor substances. Moreover, in the above process, tea leaves and materials are fermented together, which cannot guarantee the prevention of the formation of other molds and has certain safety risks.

[0004] Ginseng is a traditional nourishing Chinese medicinal material, which can be used as both medicine and food. There are also many products such as ginseng health tea on the market, but most of these products are prepared by simply mixing ginseng with other materials, such as tea leaves, and cannot release the effective substances therein well. Summary of the invention

[0005] In view of the above technical deficiencies, the present invention provides a Jinhua ginseng composition, which adopts a solid-state fermentation method to inoculate ginseng slices with Jinhua bacteria for fermentation to obtain a tea beverage. The fermentation process uses a single raw material, and the product flavor is locked and the nutrients are retained.

[0006] The first aspect of the present invention provides a process for preparing a golden flower ginseng composition by solid-state fermentation, comprising the following steps: S1. preparing the raw material of golden flower fungus, extracting the golden flower strain from Fucha, culturing, screening, separating and purifying, and preparing the golden flower fungus; S2 Ginseng solid-state fermentation: inoculating the golden flower fungus onto ginseng slices for fermentation.

[0007] This process uses ginseng slices inoculated with golden flower fungus for fermentation, which can significantly increase the content of beneficial ingredients in ginseng, such as ginsenosides, especially the content of rare saponins in ginseng slices, such as Rg3. At the same time, the product introduces golden flower fungus ingredients, which has a richer flavor and more beneficial ingredients.

[0008] Preferably, the Fu tea complies with the standard DB43 / T657.4-2021 Anhua dark tea part 4: pressed Fu tea in Fu tea, with super quality and golden flower bacteria>20×10 4 The number of bacteria / gram of dry tea is used to ensure that the dominant bacteria during ginseng fermentation is golden flower bacteria, and the product is safe and meets food safety requirements.

[0009] Preferably, the step S1 is specifically as follows: weighing a Fucha tea sample, adding it to 0.85% sterile physiological saline, shaking it at 180 r / min in a constant temperature shaker at 28°C for 30-60min, diluting it after shaking, spreading it on a PDA plate, and then culturing it at a constant temperature of 28°C, screening colonies with good growth, and then separating and purifying it by the dilution and spreading plate method on the PDA culture medium; wherein, Fucha tea sample: 0.85% sterile physiological saline = 25-50g: 225-450mL.

[0010] Preferably, step S2 comprises: S21 Select the mycelium of golden flower fungus cultured on a plate for 5-7 days and add it to sterile water, shake it evenly, and obtain a single spore suspension of golden flower fungus. The concentration of the single spore suspension of golden flower fungus is 1×10 7 -10×10 7 CFU / mL; S22 Add 5-10% sterilized glucose water to the ginseng slices to control the water content of the material to 30%±5%, stir evenly and sterilize; S23 Spray the monospore suspension of golden flower mushroom onto the ginseng slices obtained in step S22 at an inoculation ratio of 10-20%, ferment at 28±5° C., control the moisture content of the material to 30%±5%, and culture for 8-10 days.

[0011] During the fermentation process, sucrose water is not added for fermentation. Instead, 5-10% glucose water is added and mixed with the golden flower mushroom spore suspension. The saponins, polysaccharides, and monosaccharides in ginseng are used for fermentation, which significantly increases the content of beneficial ingredients in the product and contains more nutrients than tea products.

[0012] Preferably, the ginseng slices are 1-3 mm thick and 10-20 mm long and wide by 10-20 mm.

[0013] Preferably, the method further comprises step S3 of crushing: the fermented ginseng slices are dried at low temperature, and then crushed by freezing to obtain golden flower ginseng powder. The low temperature ultrafine crushing can lock in the flavor and nutrients, and the powder has a smooth taste, is not dry, and has better taste recovery.

[0014] Preferably, in step S3, the moisture content of the material after low-temperature drying is 5-8%.

[0015] Preferably, in step S3, during freeze-crushing, the product is first coarsely crushed at -20°C to a product particle size of ≤2 mm, and then cell-level ultrafine grinding is performed to better retain the nutrients in the material.

[0016] The second aspect of the present invention provides a process for preparing the golden flower ginseng composition by the solid-state fermentation method, and the prepared golden flower ginseng composition. The golden flower ginseng composition of the present invention can be in the form of tablets, capsules, pills, granules, etc.

[0017] The third aspect of the present invention also provides the application of the golden flower ginseng composition. The golden flower ginseng composition of the present invention can be used to prepare food, health food, etc., such as a substitute tea, or a food material, a health food material.

[0018] Compared with the prior art, the present invention has the following beneficial effects: The present invention adopts ginseng slices to inoculate golden flower fungi for fermentation, converts proteins in ginseng into polypeptides, increases the saponin content in ginseng, realizes the conversion of dry ginsenosides, significantly increases the content of rare saponin active ingredient Rg3 in ginseng, and increases the flavor substances of the product, improves the flavor of the product, and has a richer flavor and taste. At the same time, low-temperature ultrafine grinding is used for production, which can lock the flavor and nutrients, and the taste recovery is better. The golden flower ginseng composition of the present invention has rich flavor, high content of effective ingredients, is safe and non-toxic, has a smooth taste, is not dry, and can be used for the production of food, especially health food. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the morphology of the golden flower fungus colony 1; Figure 2 This is the morphology of the second colony of the golden flower fungus; Figure 3 This is the morphology of the third colony of the golden flower fungus; Figure 4 This is an optical microscopic image of golden flower fungus; Figure 5 Record pictures of the sample fermentation process; Figure 6 Schematic diagram of fermentation samples after drying; Figure 7These are the results of HS-GC-MSMS analysis of unfermented and golden flower fungus fermented ginseng slices. DETAILED DESCRIPTION

[0020] The present invention is further described below with reference to specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0021] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0022] Example 1 Preparation of golden flower mushroom raw materials Select the pressed Fu tea produced in Anhua, Hunan, which meets the requirements of DB43 / T657.4-2021 Anhua Dark Tea Part 4: Fu Tea. The quality is super, and the golden flower fungus is >20×10 4 Bacteria count / g dry tea.

[0023] In a sterile laboratory, weigh 25 g of Fucha tea sample and add it to 225 mL of 0.85% sterile saline (with glass beads); shake it in a constant temperature shaker at 28°C and 180 r / min for 30 min. After shaking, dilute to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 For each of the six gradients, 100 µL of dilution was spread on a PDA plate and inverted in a 28°C constant temperature incubator for culture. After the colonies appeared, their growth was observed, and three colonies with better growth were selected for separation and purification using the dilution spread plate method on PDA medium.

[0024] Figure 1-3 The colony morphology of three selected golden flower fungus colonies with better growth was cultured on PDA medium at 28℃ for 4 d, 7 d, and 10 d. The upper picture shows the front morphology of the colony, and the lower picture shows the back morphology of the colony.

[0025] Optical microscopic identification Add 2-3 drops of lactic acid phenol cotton blue staining solution on the slide, pick up the hyphae cultured on the PDA plate for 4-5 days with a toothpick, mix with the staining solution, cover with a coverslip, absorb the excess staining solution around with filter paper, let it stand for 5 minutes, put it on the microscope stage, adjust the microscope, observe the morphology of hyphae, cleistothecia, spores, etc. of the colony under the eyepiece, and take pictures and record. Figure 4 Some examples are shown, in which the sporangium in Figure A is spherical, with a closed thecothecium structure, containing a large number of ascospores; in Figure B, the ascus ruptures after maturity, releasing a large number of ascospores, which are elliptical to round in shape.

[0026] Biological identification Extraction of Fungus DNA: Use Fungi Genomic DNA Extraction Kit to extract DNA samples (add appropriate amount of lytic enzyme to dissolve fungal cell wall or grind with liquid nitrogen) Universal primers and ITS fragment sequencing: Two universal primers were used: ITS1 (SEQ ID No.1: 5'-TCCGTAGGTGAACCTGCGG-3'), ITS4 (SEQ ID No. 2: 5'-TCCTCCGCTTATTGATATGC-3'); DNA fragment amplification. DNA purification: Universal DNA purification and recovery kit (Tiangen Biochemical Technology Co., Ltd.), ligation, transformation, and sequencing.

[0027] Sequence comparison: The measured sequence results were copied to NCBI Blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) for sequence comparison. The DNA sequence results of the three colonies of golden flower fungi were consistent, all of which were SEQ ID No.3: TTAAGTTCAGCGGGTATCCCTAACCTGATCCGAGGTCAACCTGGTTAAAAAGATTGGTTGCGAGGCTAGCTGCCAGCTGGACCTACGGGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCAGACATG GTGCCGCCACTGCCTTTTGGGCCCGTCCCCGTTGCCAGGGACGGAAGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCG TTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAATTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACGATTGTTTAACTAAAAACTC AGACTGCAAACTTCAGACAGCGTTCAAATGTTAGTCTCCGGCGGGCCGTGGCCACGCCGAAGCACAGGGTACAGATAGACACGGATGGGAGGTTGGACCCAGAGGGCCCGCACTCGGTAATGATCCTT The sequence was submitted to NCBI for BLAST comparison analysis, and it was found that the sequence to be tested after ITS amplification had a 100% similarity with the golden flower fungus.

[0028] Example 2 Ginseng solid state fermentation 2.1 Preparation of golden flower fungus suspension In a sterile workroom, the mycelium of the golden flower fungus cultured on a plate for 6 days in Example 1 was picked up and placed in sterile water, and the spore suspension was obtained by shaking evenly. The spores were counted with a hemocytometer and the concentration of the spore suspension was adjusted to 1×10 7 CFU / mL.

[0029] 2.2 Ginseng processing Cut ginseng into slices of 1-3mm thickness and 10-20mm×10-20mm size, spray with sterilized 10% glucose water, and then stir evenly to control the moisture content of the material: 30%±5%, and sterilize at 121℃ for 20min after stirring evenly.

[0030] 2.3 Inoculation and fermentation According to the inoculation ratio of 15%, the spore suspension obtained in step 2.1 was sprayed on the ginseng slices obtained in step 2.2, and the moisture content of the material was controlled to 30%±5%, and the fermentation temperature was 28±5℃. The samples ① and ② were cultured in conical flasks, and the sample without the addition of the golden flower fungus suspension was used as a negative control. The changes in the spore suspension with the number of culture days were observed. Figure 5 As shown, it can be seen that with the change of time, the ginseng slices added with golden flower fungi in samples ① and ② continued to ferment and produce golden flowers, while the negative samples without golden flower fungi did not produce golden flower fungi.

[0031] Example 3 Crushing 3.1 Low-temperature drying. The three groups of samples in Example 2 were dried in a low-temperature drying oven to a dryness (water content) of 5%-8%. Figure 6 shown.

[0032] 3.2 Pre-coarse powder: Use a freezer crusher to process at -20℃ to make the particle size of the coarse powder ≤2mm.

[0033] 3.3 Cell-level ultrafine grinding. Use with a low-temperature refrigerator, and the material and the refrigerator cool down at the same time. After putting the material into the barrel and setting the refrigerator, wait until the specified temperature is set to -20℃ before starting to grind. After the grinding is completed, it can be vibrated for 40-60 seconds, and all samples can be taken to obtain the golden flower ginseng powder.

[0034] Example 4: Testing of Golden Flower Ginseng Powder 4.1 Determination of the content of effective substances in ginseng.

[0035] According to the Pharmacopoeia, the saponin and protein content in the samples No. ①, No. ② and the negative control sample obtained in Example 3 were determined; according to "GB 5009.8-2016 Determination of fructose, glucose, sucrose, maltose and lactose in food Method 1", fructose, sucrose and glucose were determined, and the results are shown in Table 1. It can be seen that in the embodiment of the present invention, no sucrose water fermentation or culture medium was added to the material, but the ginseng slices were supplemented with a glucose aqueous solution, and then the golden flower fungus spore suspension was added and mixed. During the fermentation process, part of the glycosides and polysaccharides, monosaccharides, etc. in the ginseng were used for fermentation, and the protein content was reduced due to the conversion of protein into polypeptides, and the ginsenoside content was increased. The ginsenoside Rg1 and ginsenoside Rb1 in the obtained product were increased by more than 10%.

[0036] Table 1 Determination of ginsenoside and protein content

[0037] Note: Blank refers to reagent blank, which is the value of the standard drug measured directly; negative sample refers to the ginseng material that is the same as the fermentation sample except that it is not fermented.

[0038] 4.2 Determination of rare saponin content.

[0039] The content of rare ginsenosides in ginseng and ginseng after fermentation with golden flower fungus was compared. The test results are shown in Table 2. Among them, the amount of Rg3 component increased by 230% after comparison. This shows that the addition of golden flower fungus can realize the conversion of dry ginsenosides in ginseng into rare ginsenosides that are more easily absorbed, thereby significantly increasing the content of rare ginsenosides.

[0040] Table 2 Determination of rare saponin content in ginseng

[0041] 4.3 Flavor analysis.

[0042] Solid phase microextraction combined with gas chromatography-mass spectrometry SPME-HS-GCMSMS was used for identification. Figure 7 As shown, compared with the unfermented ginseng slices (black line), the ginseng fermented with golden flower fungus of the present invention has increased alcohols, aldehydes, esters, ketones, ethers, alkenes and acid compounds, and has a unique aroma, which indicates that the introduction of golden flower fungus enriches the flavor of the product and increases the relevant beneficial ingredients.

[0043] 4.4 Taste and reconstitution.

[0044] The sensory laboratory was used to conduct experiments, and 9 tea tasters were hired to conduct blind sample tests. The appearance of the tea soup was the same as that of the samples before low-temperature ultrafine powder and direct slicing, but the taste was scored higher. It can be seen that the low-temperature ultrafine grinding treatment after the fermentation of golden flower fungus and ginseng slices can improve the taste. The product has a smooth taste and is not dry, which is accepted by consumers.

[0045] 4.5 Security.

[0046] The contents of aflatoxin B1, G1, G2, and B2 in samples ① and ② were tested and were found to be in compliance with the food safety requirements of GB 2761-2017 National Food Safety Standard Limits of Mycotoxins in Foods, and therefore are safe and non-toxic.

[0047] In summary, it can be seen that the Jinhua ginseng composition prepared in the embodiment of the present invention is fermented by inoculating Jinhua fungi with ginseng slices. No sucrose water is added during the fermentation process. Only appropriate glucose is added to the ginseng slices, and then the Jinhua fungi spore suspension is used for mixing. During the fermentation process, some glycosides, polysaccharides, monosaccharides, etc. in ginseng are used for fermentation, and the ginsenoside content in the obtained product is increased. In addition, the conversion of dry ginsenosides in ginseng is solved, and it is converted into rare ginsenosides that are more easily absorbed, thereby increasing the efficacy. Moreover, after being compounded with Jinhua fungi, the product has a rich flavor, a smooth taste, and is not dry, and can be used for food, health food, etc.

[0048] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0049] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A process for preparing a golden ginseng composition by solid-state fermentation, characterized in that: The steps include: S1. preparing the raw material of golden flower fungus, extracting the golden flower strain from Fucha, culturing, screening, separating and purifying, and preparing the golden flower fungus; S2 Ginseng solid-state fermentation: inoculating the golden flower fungus onto ginseng slices for fermentation.

2. The process for preparing the golden flower ginseng composition by solid-state fermentation according to claim 1, characterized in that: The Pu'er tea is in accordance with the standard DB43 / T657.4-2021 Anhua dark tea part 4: pressed Pu'er tea in Pu'er tea, the quality is super, the golden flower fungus is greater than 20×10 4 Bacteria count / g dry tea.

3. The process for preparing the golden flower ginseng composition by solid-state fermentation according to claim 1, characterized in that: The step S1 is specifically as follows: weighing a Fucha tea sample, adding it to 0.85% sterile physiological saline, shaking it at 180 r / min for 30-60 min in a constant temperature shaker at 28°C, diluting it after shaking, spreading it on a PDA plate, and then culturing it at a constant temperature of 28°C to screen colonies with better growth, and then separating and purifying it by the dilution and spreading plate method on the PDA culture medium; wherein, Fucha tea sample: 0.85% sterile physiological saline = 25-50 g: 225-450 mL.

4. The process for preparing the golden flower ginseng composition by solid-state fermentation according to claim 1, characterized in that: The step S2 comprises: S21 Select the mycelium of golden flower fungus cultured on a plate for 5-7 days and add it to sterile water, shake it evenly, and obtain a single spore suspension of golden flower fungus. The concentration of the single spore suspension of golden flower fungus is 1×10 7 -10×10 7 CFU / mL; S22 Add 5-10% sterilized glucose water to the ginseng slices to control the water content of the material to 30%±5%, stir evenly and sterilize; S23 Spray the monospore suspension of golden flower mushroom onto the ginseng slices obtained in step S22 at a ratio of 10% to 20% of the inoculation amount, ferment at 28±5° C., control the moisture content of the material to 30%±5%, and culture for 8-10 days.

5. The process for producing golden flower ginseng powder by solid-state fermentation according to claim 4, characterized in that: The ginseng slices are 1-3 mm thick and 10-20 mm long and wide by 10-20 mm.

6. The process for preparing the golden flower ginseng composition by solid-state fermentation according to any one of claims 1 to 5, characterized in that: The step S3 is also included: the fermented ginseng slices are low-temperature dried, and freeze-crushed to obtain golden flower ginseng powder.

7. The process for preparing the golden flower ginseng composition by solid-state fermentation according to claim 6, characterized in that: In step S3, the moisture content of the material after low-temperature drying is 5-8%.

8. The process for preparing the golden flower ginseng composition by solid-state fermentation according to claim 6, characterized in that: When freezing and grinding, first grind coarsely at -20℃ to a product particle size of ≤2mm, and then perform cell-level ultrafine grinding.

9. The golden flower ginseng composition obtained by the process for preparing the golden flower ginseng composition by solid-state fermentation as described in any one of claims 1 to 8.

10. A product, characterized in that The product comprises the golden flower ginseng composition as claimed in claim 9, and the product is a food or a health food.

Images