DNA ligase III inhibitor and application thereof

Abstract

The invention relates to the field of biological medicine, in particular to a DNA ligase III (LIG3) inhibitor and application thereof. The inhibitor contains bitter apricot glycoside, the chemical formula of the inhibitor is C29H30O13, the inhibitor with the structural formula being # imgabs0 can cause DNA damage and apoptosis of tumor cells, and the inhibitor can be used for treating breast cancer, but not limited to breast cancer tumors and related diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a DNA ligase III (LIG3) inhibitor and application thereof. Background Art

[0002] Breast cancer is the most common malignant tumor in women, accounting for about 30% of tumor incidence in women and 15% of all tumor deaths. Triple-negative breast cancer (TNBC) refers to the lack of expression of estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor 2 receptor (HER-2). Among all breast cancer subtypes, triple-negative breast cancer has the worst prognosis and is most likely to metastasize. Currently, there are limited treatments and drugs for triple-negative breast cancer.

[0003] DNA ligase is essential in various DNA repair and replication processes, and the lack or inhibition of its activity can lead to the accumulation of DNA damage and strand breaks. DNA ligation defects lead to severe cell lethality and increase genomic instability. Therefore, targeting DNA ligase will become an effective target for cancer treatment.

[0004] DNA ligases are divided into two families based on the cofactors required for ligase adenylate formation, namely ATP-dependent ligases and NAD+-dependent ligases. Bacterial NAD+-dependent DNA ligases belong to a highly conserved phylogenetic cluster of enzymes that have only been described in eubacteria. ATP-dependent DNA ligases are present in all three domains of life, namely eubacteria, archaea, and eukaryotes, and mammalian DNA ligases belong to this class.

[0005] There are three main types of ATP-dependent DNA ligases encoded by mammalian ligase genes: DNA ligase I (LIG1), DNA ligase III (LIG3) and DNA ligase IV (LIG4). LIG1 is mainly responsible for connecting Okazaki fragments during nuclear DNA replication. LIG1 and LIG3 have important functions in base excision repair and single-strand break repair, and LIG4 is mainly responsible for non-homologous end joining (NHEJ) repair of nuclear DNA double-strand breaks.

[0006] There are no reports on DNA ligase III inhibitors in existing studies. Summary of the invention

[0007] The purpose of the present invention is to provide an application of DNA ligase III (LIG3).

[0008] To achieve the above purpose, the present invention adopts the following technical solution:

[0009] A DNA ligase III inhibitor, the inhibitor contains amygdalin, the chemical formula of which is C 29 H 30 O 13 , the structural formula is

[0010] The inhibitor amygdalin inhibits the activity of DNA ligase III; wherein the concentration of amygdalin is 40-100 μM.

[0011] An application of the DNA ligase III inhibitor, and an application of the DNA ligase III inhibitor in regulating a DNA damage repair pathway.

[0012] The DNA ligase III inhibitor is used in regulating the activity of DNA ligase III in vivo and in vitro.

[0013] The DNA ligase III inhibitor is used in regulating the expression of DNA ligase III protein in triple-negative breast cancer.

[0014] The DNA ligase III inhibitor is used in regulating apoptosis and DNA damage of triple-negative breast cancer cells.

[0015] Application of the DNA ligase III inhibitor in regulating the proliferation of triple-negative breast cancer cells.

[0016] The application of the DNA ligase III inhibitor in regulating migration in triple-negative breast cancer cells.

[0017] Application of the DNA ligase III inhibitor in the preparation of triple-negative breast cancer immunotherapy and / or prevention drugs.

[0018] Principle of the invention:

[0019] The application of the DNA ligase III inhibitor in the treatment of triple-negative breast cancer of the present invention is to inhibit the DNA ligase III-mediated DNA damage repair pathway by inhibiting the expression and activity of DNA ligase III, and then the DNA ligase III inhibitor can be used to inhibit tumor growth and metastasis, while causing tumor cell apoptosis and DNA damage. Therefore, the DNA ligase III inhibitor can be used to treat and / or prevent the application of breast cancer immunotherapy drugs; specifically:

[0020] The compound amygdalin of the present invention as a natural medicine can specifically inhibit DNA ligase III and has the ability to inhibit the activity of DNA ligase III in a targeted manner. Further, it has the ability to inhibit the expression of DNA ligase III and kill breast cancer cells, thereby exploring new drug effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a quantitative MTT curve of the killing of tumor cells by amygdalin, a DNA ligase III inhibitor, according to an embodiment of the present invention. After the human breast cancer BT-549 cells and MDA-MB-231 cell line were treated with amygdalin at different final concentrations for 48 hours, the cell numbers were detected after staining.

[0022] Figure 2 This is a protein immunoblot image of the DNA ligase III inhibitor amygdalin mentioned in the examples of the present invention inhibiting DNA ligase III in human breast cancer BT549 cells and MDA-MB-231 cell lines.

[0023] Figure 2 A is a protein blot image of the changes in the protein level of LIG3 detected by Western Blot after BT-549 cells were treated with amygdalin at a concentration of 40uM for 48h. Figure 2 B is the quantization graph. Figure 2 C is a protein blot image of the changes in the protein level of LIG3 detected by Western Blot after MDA-MB-231 cells were treated with 40uM amygdalin for 48h. Figure 2 D is its quantized graph.

[0024] Figure 3 This is a comet assay diagram showing DNA damage caused by amygdalin, a DNA ligase III inhibitor, in human breast cancer BT-549 cells and MDA-MB-231 cell lines according to an embodiment of the present invention. Figure 3 A is the BT-549 cells treated with 40uM amygdalin for 48h, and the comet assay was used to detect the degree of DNA damage. Figure 3 B is the MDA-MB-231 cells treated with 40uM amygdalin for 48h, and the degree of DNA damage was detected by comet assay.

[0025] Figure 4 This is a scratch test diagram of the DNA ligase III inhibitor amygdalin inhibiting the migration function of human breast cancer BT-549 cells and MDA-MB-231 cell lines mentioned in the examples of the present invention. The cell scratch test was used to detect the migration changes of BT-549 cells and MDA-MB-231 cell lines at different concentrations (0uM, 20uM, 40uM).

[0026] Figure 5This is a clone formation experiment diagram of the DNA ligase III inhibitor amygdalin inhibiting the proliferation function of human breast cancer BT-549 cells and MDA-MB-231 cell lines. The number of BT-549 cells and MDA-MB-231 cell lines treated with different concentrations for 48 hours was detected, and the effect of amygdalin on breast cancer cell proliferation was observed through clone formation experiments.

[0027] Figure 6 The DNA ligase III inhibitor amygdalin mentioned in the embodiment of the present invention increases apoptosis of human breast cancer BT-549 cells and MDA-MB-231 cell lines. After human breast cancer BT-549 cells and MDA-MB-231 cell lines were treated with culture medium added with different concentrations of amygdalin (0uM, 20uM, 40uM) for 48 hours, flow cytometry was performed to observe cell apoptosis. Figure 6 A shows that in BT549 cells, as the drug concentration increases, the cell apoptosis rate increases significantly. At a drug concentration of 40uM, the cell apoptosis rate is about 18%. Figure 6 B is the MDA-MB-231 cell line, which also shows that as the concentration of amygdalin increases, cell apoptosis also increases.

[0028] Figure 7 The present invention is a DNA ligase III inhibitor amygdalin in vitro inhibiting the activity of DNA ligase III, and the SDS-PAGE gel electrophoresis diagram of DNA ligase III expressed and purified in vitro. To further study the inhibitory effect of amygdalin on LIG3, LIG3 was first expressed and purified in vitro using a Ni column, and the purified protein was subjected to SDS-PAGE electrophoresis. The results showed that the purified protein was around 100KDa and the band position was correct. LIG3 protein is provided for subsequent experiments to verify whether amygdalin can affect the enzymatic activity of LIG3 in vitro.

[0029] Figure 8 This is a deformed gradient gel image of the DNA ligase III inhibitor amygdalin mentioned in the embodiment of the present invention inhibiting the activity of DNA ligase III in vitro. We artificially synthesized three sequences, and these three sequences are complementary sequences. An excitation fluorescent marker was added to the 5' end of one of the sequences. When the ligase is present, the three sequences are connected into a complete complementary sequence, and the labeled DNA becomes longer than before. When the inhibitor is present, the fluorescent marker is present on the shorter DNA. Through the denaturing gradient gel electrophoresis experiment, the inhibitory effect of the inhibitor can be judged according to the height of the band excited by the fluorescent marker. Figure 7As shown, the first band is the oligonucleotide without the addition of ligase and inhibitor, the second band is the oligonucleotide with the addition of purified LIG3, and the third band is the oligonucleotide with the addition of purified LIG3 and 100 μM amygdalin. When no ligase is added, the position of the fluorescent marker is lower, and after the addition of purified ligase, the position of the fluorescent marker becomes higher, indicating that the ligase works, and when 100 μM amygdalin is added, the fluorescent marker at the high position becomes lighter than the second lane, and the fluorescent marker at the low position becomes darker than the second lane, indicating that amygdalin inhibits the activity of the ligase to connect the substrate, indicating that amygdalin can inhibit the activity of LIG3 protein in vitro.

[0030] Fig. 9 This is a molecular simulation diagram showing that the DNA ligase III inhibitor amygdalin mentioned in the embodiment of the present invention can stably bind to LIG3. Fig. 9 A is a conformational diagram of amygdalin stably bound to LIG3. Fig. 9 B is a graph showing the change in the binding stability of amygdalin and LIG3. DETAILED DESCRIPTION

[0031] The present invention is described in detail below in conjunction with the embodiments, and the following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, several adjustments and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention.

[0032] The present invention uses a DNA ligase III inhibitor (amygdalin) to inhibit the activity of ligase III in vitro, inhibit the expression level of LIG3 in cells, and inhibit the DNA damage repair process, thereby providing the application of the DNA ligase III inhibitor in virus therapy and tumor immunotherapy; the application of the DNA ligase III inhibitor in tumor immunotherapy by inhibiting cell proliferation and migration. The application of the DNA ligase III inhibitor in tumor immunotherapy by increasing DNA damage and cell apoptosis.

[0033] In the following examples, the DNA ligase III inhibitor amygdalin was obtained from Shanghai Taoshu Biotechnology Co., Ltd., and the cells used were human breast cancer cell lines BT549 and MDA-MB-231 from the American type culture collection.

[0034] Example 1: DNA ligase III inhibitor amygdalin inhibits the expression of DNA ligase III in breast cancer cells to impair the DNA damage repair pathway and inhibit the proliferation of triple-negative breast cancer cells. The following technical means and experimental steps are included:

[0035] 1. Cell culture:

[0036] Human breast cancer BT-549 cells were adherently grown in RPMI-1640 medium containing 10% fetal bovine serum and 1% penicillin-streptomycin solution, and human breast cancer MDA-MB-231 cell line was adherently grown in DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin solution, both of which were cultured in a cell culture incubator at 37°C with 5% carbon dioxide.

[0037] 2. MTT cell viability analysis

[0038] MDA-MB-231 cells and BT549 cells were cultured for 48 h and 5 × 10 3 Cells were added to a 96-well plate. After the cells adhered to the plate, drugs (amygdalin) were added according to the experimental drug concentration. After 48 h, the culture medium was removed and fresh culture medium containing 0.5% MTT was added. The culture medium was incubated at 37°C, 5% CO 2 Culture for 4 hours. Discard the culture medium, add 150 μL DMSO and incubate in a 37°C incubator for 15 minutes, and detect the absorbance of the sample with an ELISA reader. Analyze the data to obtain the cell viability curves and IC50 values ​​of BT549 cells and MDA-MB-231 cells at different drug concentrations (see Figure 1 ).

[0039] Depend on Figure 1 It can be seen that amygdalin has a significant killing effect on two breast cancer cells, BT549 and MDA-MB-231, with IC50 values ​​around 50uM.

[0040] 3. Immunoblotting analysis

[0041] (1) Digest BT549 cells and MDA-MB-231 cells that have reached 70-80% confluence with trypsin, terminate digestion, and then use a pipette to blow off the cells and collect them. After collection, wash them twice with PBS buffer. Extract the protein with cell lysis buffer and other reagents. Use Qubit2.0 to measure the protein concentration, add 25μL 5*loading buffer, and boil it in a water bath for 10 minutes. In order to avoid repeated freezing and storage affecting the quality of the protein, the protein needs to be packaged and stored in a -80℃ refrigerator.

[0042] (2) Polyacrylamide gel electrophoresis: Based on the measured concentration, approximately 60 μg of protein is loaded into each well. The protein needs to be boiled before loading. 3 μL of marker is added and electrophoresis is started.

[0043] (3) Cut the gel and transfer the membrane semi-dry with PVDF membrane at 200 mA. Place the membrane in blocking solution (3% skim milk powder, 0.5% Triton-100) and block for 2 hours. After adding the primary antibody in proportion, incubate at 4°C overnight. After recovering the primary antibody, wash the membrane with TBST and shake it on a shaker at room temperature for 15 minutes. Repeat three times. Dilute the corresponding secondary antibody in the prescribed proportion and incubate at room temperature for 2 hours. Wash the membrane with TBST and shake it on a shaker at room temperature for 10 minutes. Repeat three times. Then use the ECL chemiluminescence method to develop and analyze the gel using a gel imager. Use Image lab to analyze the bands and perform statistical data (see Figure 2 ).

[0044] Depend on Figure 2 It can be seen that when BT549 and MDA-MB-231 cells were treated with 40uM amygdalin, the expression of LIG3 was significantly decreased. The results show that amygdalin can inhibit the expression of LIG3 in breast cancer cells.

[0045] 4. Comet Experiment

[0046] (1) Before use, clean the slide with ethanol and wipe it dry with paper.

[0047] (2) For the bottom layer, prepare 1% normal melting point agarose (10 mg, dissolved in 1 mL PBS) and boil it in boiling water for 5 minutes. Place the frosted surface of the slide upward, drop 100 μL of 1% normal melting point agarose onto the slide and cover the slide. Place at 4°C for about 10 minutes.

[0048] (3) Prepare 0.7% low melting point agarose (14 mg in 1 mL PBS). Heat in a 70°C water bath until the agarose dissolves. Place the low melting point agarose in a 70°C water bath.

[0049] (4) Gently remove the coverslip, mix 10 μL of BT549 and MDA-MB-231 cells (about 104 cells) with 75 μL of 0.7% low-melting-point agarose respectively, drop them on the first layer of gel, and place them at 4°C for about 30 min.

[0050] (5) Gently remove the coverslip, add 75 μL of 0.7% low-melting-point agarose on the second layer of gel, gently cover with a coverslip, and place at 4°C for about 30 min.

[0051] (6) Remove the coverslip and place at 4°C for 2 hours. Slides can be stored in cold lysis solution for a long time (but usually not more than 4 weeks). If precipitation of the lysis solution is observed, carefully rinse the slides with distilled water before electrophoresis.

[0052] (7) Gently remove the slide from the lysate. Place the slide in the gel box near the anode (+) end, as close as possible. Pour electrophoresis buffer (4°C) until the slide is completely covered (avoid bubbles in the agarose). Let the slide stand in alkaline buffer for 30 minutes to allow DNA release and expression of alkaline instability damage.

[0053] (8) Turn on the power supply to 25V and run the electrophoresis for 50 minutes. Turn off the power supply. Gently remove the slide from the buffer and place it in the neutralization buffer for 10 minutes. Repeat twice. Carefully rinse off the neutralization solution with distilled water, add ethidium bromide staining solution (2.5ug / mL), and stain for 3 minutes before testing immediately (see Figure 3 ).

[0054] Depend on Figure 3 It can be seen that in BT549 cells ( Figure 3 A) and MDA-MB-231 cells ( Figure 3 In B), when 40uM amygdalin was added, compared with the control group, obvious band tailing phenomenon, namely DNA damage comet tail, was produced, proving that amygdalin can cause DNA damage in breast cancer cells.

[0055] 5. Cell scratch test

[0056] Take BT549 and MDA-MB-231 cells in good logarithmic growth phase and spread them in 6-well plates, and culture them in a 37℃ constant temperature incubator. After the cells adhere to the wall and the density reaches about 80%, perform the scratch test. Use the same 200μL pipette tip to cross-scratch along the ruler, clean with PBS, and remove the fallen cells. Set different drug concentrations (both the drug group and the control group are treated with low-concentration serum), take pictures and record them at 24h and 48h (see Figure 4 ).

[0057] Depend on Figure 4 It can be seen that in BT549 cells ( Figure 4 A, 4B) and MDA-MB-231 cells ( Figure 4 C, 4D) The degree of wound healing slowed down with the increase of drug concentration, and the wound healing speed slowed down with the increase of time. It proved that amygdalin can inhibit the normal migration function of breast cancer cells.

[0058] 6. Clone formation experiment

[0059] Freshly cultured BT549 and MDA-MB-231 cells were digested with trypsin and plated in a 24-well plate, with 200 cells plated in each well. The cells were mixed and treated with drugs for 48 hours after the cells adhered to the wall. 500 μL of complete culture medium was replaced every two days and the culture was continued for 7 days. The cells were taken out and fixed. During fixation, 500 μL of 4% paraformaldehyde solution was added to each well and fixed at room temperature for 20 minutes. Then 500 μL of 0.1% crystal violet staining solution was added to each well and placed at room temperature for 30 minutes. The crystal violet was aspirated and stained with ddH 2 O Carefully wash off the crystal violet and place in an oven for 1 hour. When there are no water droplets, take a photo (see Figure 5 ).

[0060] Depend on Figure 5 It can be seen that in BT549 cells ( Figure 5 A, 5B) in which the inhibitory efficiency was about 50% at a concentration of 40uM. In MDA-MB-231 cells ( Figure 5 C, 5D), the inhibition efficiency of 40uM concentration exceeded 70%, proving that amygdalin can inhibit the normal proliferation of breast cancer cells.

[0061] 7. Detection of cell apoptosis by flow cytometry

[0062] (1) When BT549 cells and MDA-MB-231 cells were in the logarithmic growth phase, medium containing the experimental concentration of drugs was added and cultured in a 37°C incubator for 48 h.

[0063] (2) Add 500 μL PBS to each well and wash once (before this, aspirate the cell culture medium to terminate digestion).

[0064] (3) Aspirate PBS and treat the cells with EDTA-free trypsin.

[0065] (4) Add the previously collected cell culture fluid to the wells, transfer to a 5 mL centrifuge tube, and centrifuge.

[0066] (5) After resuspending the cells, transfer them to a 1.5 ml L centrifuge tube and centrifuge, removing as much supernatant as possible.

[0067] (6) 5*binding buffer dilution, add 100μL 1*binding buffer to each sample, set up double negative group, single PI staining group, single AV staining group, double staining experimental group, add 2μL AV and 1μL PI dye according to different groups and mix well. Except for the PI well and AV-binding negative control group, add 10μL PI to each well and flick the bottom of the EP tube by hand.

[0068] (7) Incubate in a clean bench in the dark for about 20 min, and then add 200 μL of 1*binding buffer to each sample.

[0069] (8) Place in ice, filter and filter away from light, and test on a machine (see Figure 6 ).

[0070] Depend on Figure 6 It can be seen that in BT549 cells, as the drug concentration increases, the cell apoptosis rate increases significantly ( Figure 6 A), the apoptosis rate was about 18% at a drug concentration of 40uM. Similar results were obtained in MDA-MB-231 cells ( Figure 6 B), the cell apoptosis rate was about 15% at a drug concentration of 40uM, which proved that amygdalin can promote apoptosis of breast cancer cells.

[0071] According to Example 1, it was found that the DNA ligase III inhibitor amygdalin can have a strong killing effect on tumor cells ( Figure 1 ) and inhibited LIG3 expression in breast cancer cells ( Figure 2 ).

[0072] According to Example 1, it can be concluded that amygdalin can inhibit the migration and proliferation of breast cancer cells ( Figure 4 , 5 ).

[0073] Example 1 demonstrates that amygdalin can cause DNA damage in breast cancer cells and promote apoptosis of breast cancer cells. Figure 3 , 6 ). Therefore, the present invention finds that amygdalin, an inhibitor of DNA ligase III, can inhibit the expression of DNA ligase III, thereby affecting the DNA damage repair pathway, and through the above process, it can affect the normal growth and metabolic activities of breast cancer cells, thereby damaging breast cancer cells to achieve an anti-tumor effect.

[0074] Example 2: After the in vitro purified DNA ligase III was treated with amygdalin, the enzyme activity was inhibited.

[0075] 1. Main reagent configuration

[0076] (1) LB liquid medium:

[0077] Weigh 1 g NaCl, 1 g tryptone, and 0.5 g yeast, pour into a conical flask, add 100 mL deionized water, sterilize under high pressure, add kanamycin when the temperature is suitable, and store at 4°C for later use.

[0078] (2) LB solid medium

[0079] Weigh 1g Nacl, 1g tryptone, 0.5g yeast, and 2g agarose and place them in a conical flask. Add 100mL deionized water and sterilize under high pressure. When the temperature is appropriate, add kanamycin and divide the mixture into culture dishes after high pressure treatment. After the culture medium solidifies, wrap it with sealing film and store it at 4°C for later use.

[0080] (3) Lysis solution

[0081] 7.8 g NaH 2 PO 4 ·2H 2 O, 17.54 g NaCl, 0.68 g imidazole, adjust the pH to 8.0 with NaOH, and add water to make up to 1 L.

[0082] (4) Washing liquid

[0083] 7.8 g NaH 2 PO 4 ·2H 2 O, 17.54 g NaCl, 1.36 g imidazole, adjust the pH to 8.0 with NaOH, and add water to make up to 1 L.

[0084] (5) Eluent

[0085] 7.8 g NaH 2 PO 4 ·2H 2 O, 17.54 g NaCl, 17.0 g imidazole, adjust the pH to 8.0 with NaOH, and add water to make up to 1 L.

[0086] 2. Plasmid construction

[0087] Construction of expression plasmids containing full-length mammalian LIG3

[0088] Plasmid empty vector selection pET-28a(+)

[0089] (1) PCR to obtain the full-length sequence of LIG3

[0090] The PCR reaction system was as follows: 50 μL: 1 μL upstream primer, 1 μL downstream primer, 5 ng plasmid template containing LIG3 cDNA (sino biologica, Cat: HG18305-U), Prime star Max Premix 25 ul, ddH 2 O 22μL. Primer sequences are shown in Table 2

[0091] The PCR reaction conditions were: 98°C for 2 min; 30 cycles of 98°C for 10 s, 55°C for 5 s, and 72°C for 2 min; and 72°C for 10 min.

[0092] (2) The vector pET-28a(+) and the PCR fragment were digested with restriction endonucleases SalI and BamHI in a 37°C water bath overnight.

[0093] (3) 1.5% agarose gel electrophoresis, 100 v, 45 min. Use the Transgene gel recovery kit to recover the vector and target fragment, and measure the concentration using nanodrop.

[0094] (4) Recover the fragments using the Transgene gel excision recovery kit and measure the concentration using nanodrop.

[0095] (5) Use T4 ligase to connect the vector and the target fragment at 16°C for 30 min.

[0096] (6) Transform the ligation product into DH5α competent cells. Add 5uL of ligation product to 50uL of competent cells, gently tap the tube wall to mix, and place on ice for 30min. Incubate at 42℃ for 45s, then incubate on ice for 2min, and then add 350uL of LB liquid culture medium without antibiotics. Incubate at 37℃, 200rpm, for 1h. Take 200uL and spread it on a solid culture medium plate containing the corresponding resistance, and place at 37℃ for 14-16h.

[0097] (7) Pick a single colony grown on the solid culture medium and place it in LB liquid culture medium, add kanamycin, and shake at 120 rpm for 12-16 h.

[0098] (8) Double enzyme digestion was performed for identification and sequencing. The bacterial solution with the correct sequence was selected and preserved with 50% glycerol.

[0099] Table 2. Primer sequences

[0100]

[0101] 3. Purification of recombinant protein

[0102] (1) The successfully constructed plasmid was shaken overnight.

[0103] (2) Take 2 mL of the shaken bacterial solution and add it to 400 mL of LB liquid medium. Add the corresponding amount of kanamycin and shake at 37°C and 120 rpm until the OD600 of the bacterial solution is about 0.6. Then add IPTG with a final concentration of 0.5 mM for induction at 30°C for 4 h.

[0104] (3) Collect the bacterial culture and transfer the culture medium to a 50 mL centrifuge tube. Centrifuge at 7000 rpm for 15 min. Collect the cells and then add lysis buffer (1 / 10 of the volume of the bacterial culture) and PMSF at an appropriate concentration.

[0105] (4) Mix the cells by blowing them up and down, and use an ultrasonic disruptor on ice until the cells become clear. Then end the ultrasonication.

[0106] (5) The protein solution after sonication was collected, centrifuged at 10,000 rpm and 4°C for 20 min, and then filtered using a 0.45 μm filter membrane.

[0107] (6) To purify the protein using a nickel column, first install the column.

[0108] (7) Rinse the nickel column with 5 volumes of deionized water.

[0109] (8) Equilibrate the nickel column with 5 volumes of lysate.

[0110] (9) Pass the protein sample through the nickel column at a relatively slow speed.

[0111] (10) Wash the column with 15 volumes of washing buffer.

[0112] (11) Elute the protein with 10 times the volume of elution buffer.

[0113] (12) Wash the nickel column with 3 volumes of lysis buffer and 5 volumes of deionized water.

[0114] (13) The nickel column was equilibrated with 5 volumes of 20% ethanol and then stored in a 20% ethanol-PBS solution at 4°C.

[0115] (14) The collected liquid was subjected to SDS-PAGE verification (see Figure 7 ).

[0116] 4. DNA ligation experiment

[0117] Three DNA fragments were artificially synthesized, and the three fragments were base complementary sequences. The sequences are shown in Table 3. One of the chains was labeled with cy3. When ligase is present, the three single-stranded chains will be repaired into complementary double-stranded chains. The reaction conditions are as follows: the reaction mixture (20 μL) contains 1 pmol of labeled DNA substrate (the substrate is described in Table 3, the volume ratio is 1:1:1, and the final concentration is 0.5 pmol / ml) and 0.2 pmol of purified recombinant protein LIG3, and the ligation buffer contains Tris-Cl (50 mM, pH 7.5), MgCl2 (10 mM), BSA (0.25 mg / mL), NaCl (100 mM) and ATP (500 μM). The double-stranded gap DNA was incubated with the purified ligase at 37°C for 30 min, and 10 μL of stop buffer (90% formamide + 10% 50 mM EDTA) was added to stop the reaction. After the reaction, denaturing gradient gel electrophoresis was performed (see Figure 8 ).

[0118] Table 3. Nucleotide sequences

[0119] 52-mer GTACGTCGATCGATTGGTAGATCAGTGTCTATGTATGTCAGTGAGATAGTAC 25-mer CTGATCTACCAATCGATCGACGTAC 27-mer Cy3 / GTACTATCTCACTGACATACATAGACA

[0120] Depend on Figure 8 It can be seen that the first band is the oligonucleotide without the addition of ligase and inhibitor. When the ligase is not added, the mark is displayed at a lower position; the second band is the oligonucleotide with the addition of purified LIG3. After the purified ligase is added, most of the oligonucleotide is repaired by LIG3, and the position of the C mark becomes higher, indicating that the ligase is working; the third band is the oligonucleotide with the addition of purified LIG3 and 100 μM amygdalin. It is found that after the addition of 100 μM amygdalin, the mark at the high position becomes lighter than that in the second lane, and the mark at the low position becomes darker than that in the second lane, indicating that amygdalin inhibits the activity of the ligase to connect the substrate and can inhibit the activity of the LIG3 protein in vitro.

[0121] According to Example 2, it is demonstrated that amygdalin can inhibit the activity of LIG3 in vitro ( Figure 8 ). Therefore, the present invention found that amygdalin, an inhibitor of DNA ligase III, can bind tightly to LIG3 both inside and outside cells, thereby causing a change in the conformation of LIG3, making it unable to play a role in connecting nucleotide chains, resulting in a decrease in enzyme activity.

[0122] 5. Molecular dynamics simulation

[0123] The optimal conformation of amygdalin was used to perform hydrogenation and charge treatment on the optimal conformation through the UCSF Chimera tool, and the output was the Mol2 format required for dynamics simulation. The molecular dynamics simulation process was performed using the Gromacs5.1.2 tool. The specific process is as follows:

[0124] (1) Amber99sb Force Field was used to input the protein force field, and the TIP3P model of water molecules was added to the protein PDB structure to generate atomic files and topological files. The minimum distance between each solute molecule and the box boundary was And add appropriate amount of ions to neutralize the electrical properties of the simulation system. The molecular force field parameter file is generated using acpype in ANTECHAMBER. After the pretreatment of proteins and small molecules, the complex.pdb composite file is generated for proteins and small molecules, and then .top and .itp files are generated to limit the molecular position during equilibrium. Then, water and charge operations are added to simulate the state of proteins in ionic solutions in vivo.

[0125] (2) All systems were subjected to energy minimization and molecular dynamics equilibrium. First, the steepest descent method12 was used to perform 2000 steps of energy minimization to avoid unreasonable contact between the added solvent and the solute system; then 2000 steps of conjugate gradient method (Fletcher-Reeves) optimization were performed. After the equilibrium was stabilized, the temperature of the protein-small molecule system was increased from 0K to 300K within 100 picoseconds (ps). The system was maintained at 300K for 500ps of NVT ensemble dynamics equilibrium, and then the composite system was allowed to undergo 1ns of NPT (constant temperature and constant pressure) ensemble dynamics equilibrium at a constant temperature of 300K and a pressure of 1atm (see Fig. 9 ).

[0126] Depend on Fig. 9 A shows that amygdalin has multiple binding sites with LIG3 and forms multiple hydrogen bonds and π bonds with LIG3, indicating that amygdalin can form a strong intermolecular force with LIG3 and can exert an inhibitory effect. Fig. 9 As shown in B, the blue line represents the LIG3 protein receptor, and the black line represents the amygdalin small molecule ligand. It can be seen that at the moment when the small molecule is first added, the protein fluctuates violently, but then tends to stabilize, indicating that amygdalin has little effect on the binding stability of LIG3 and can form a better stable structure with LIG3.

[0127] According to Example 2, it was found that the DNA ligase III inhibitor amygdalin can stably bind to DNA ligase III ( Fig. 9 ).

[0128] In summary, the results of the present invention have discovered for the first time amygdalin, an inhibitor targeting DNA ligase III, which has opened up new uses for amygdalin. Amygdalin can reduce the expression and activity of DNA ligase III in breast cancer cells, thereby hindering the DNA damage repair process, leading to slower proliferation and migration of breast cancer cells, increased DNA damage and cell apoptosis, thereby playing a role in killing breast cancer cells, providing a new strategy for the treatment of breast cancer; thus, amygdalin can be used as a drug for inhibiting the expression and activity of DNA ligase III; at the same time, it can also be used as a drug for killing breast cancer cells; further, it can be used as a drug for inhibiting the proliferation and migration of breast cancer cells, and a drug for increasing breast cancer cell apoptosis and DNA damage, and thus can be further used as a tumor immunotherapy drug.

Claims

1. A DNA ligase III inhibitor, characterized in that: The inhibitor contains amygdalin, whose chemical formula is C 29 H 30 O 13 , the structural formula is 2. The DNA ligase III inhibitor according to claim 1, characterized in that: The inhibitor amygdalin inhibits the activity of DNA ligase III; wherein the concentration of amygdalin is 40-100 μM.

3. A use of the DNA ligase III inhibitor according to claim 1, characterized in that: The application of the DNA ligase III inhibitor in regulating the DNA damage repair pathway.

4. The use of the DNA ligase III inhibitor according to claim 3, characterized in that: The DNA ligase III inhibitor is used in regulating the activity of DNA ligase III in vivo and in vitro.

5. Use of the DNA ligase III inhibitor according to claim 3 or 4, characterized in that: The DNA ligase III inhibitor is used in regulating the expression of DNA ligase III protein in triple-negative breast cancer.

6. Use of the DNA ligase III inhibitor according to claim 5, characterized in that: The DNA ligase III inhibitor is used in regulating apoptosis and DNA damage of triple-negative breast cancer cells.

7. Use of the DNA ligase III inhibitor according to claim 6, characterized in that: Application of the DNA ligase III inhibitor in regulating the proliferation of triple-negative breast cancer cells.

8. Use of the DNA ligase III inhibitor according to claim 7, characterized in that: The application of the DNA ligase III inhibitor in regulating migration in triple-negative breast cancer cells.

9. Use of a DNA ligase III inhibitor according to claim 7 or 8, characterized in that: Application of the DNA ligase III inhibitor in the preparation of triple-negative breast cancer immunotherapy and / or prevention drugs.

Images