A DNA ligase iii inhibitor and uses thereof

Abstract

This invention relates to the field of biomedicine, specifically to a DNA ligase III (LIG3) inhibitor and its applications. The inhibitor contains amygdalin, with the chemical formula C0. 29 H 30 O 13 The structure is that of an inhibitor that can cause DNA damage and apoptosis in tumor cells and can be used to treat breast cancer, but not limited to breast cancer tumors and related diseases.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to a DNA ligase III (LIG3) inhibitor and its application. Background Technology

[0002] Breast cancer is the most common malignant tumor in women, accounting for approximately 30% of all female cancer cases and 15% of all cancer deaths. Triple-negative breast cancer (TNBC) is characterized by the absence of expression of the estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor 2 receptor (HER-2). Among all subtypes of breast cancer, TNBC has the worst prognosis and is most prone to metastasis. Currently, treatment options and drugs for TNBC are limited.

[0003] DNA ligases are essential in various DNA repair and replication processes; a lack of or inhibition of their activity leads to the accumulation of DNA damage and strand breaks. Defective DNA ligation results in severe cellular lethality and increases genomic instability. Therefore, targeting DNA ligases could be an effective target for cancer therapy.

[0004] DNA ligases are classified into two families based on the cofactors required for adenosine nucleotide formation: ATP-dependent ligases and NAD+-dependent ligases. Bacterial NAD+-dependent DNA ligases belong to a highly conserved phylogenetic enzyme cluster and have only been described in eubacteria. ATP-dependent DNA ligases are present in all three domains of life: eubacteria, archaea, and eukaryotes; mammalian DNA ligases belong to this category.

[0005] Mammalian ligase genes encode three main ATP-dependent DNA ligases: DNA ligase I (LIG1), DNA ligase III (LIG3), and DNA ligase IV (LIG4). LIG1 is primarily responsible for ligating Okazaki fragments during nuclear DNA replication. LIG1 and LIG3 play important roles in base excision repair and single-strand break repair, while LIG4 is mainly responsible for non-homologous end joining (NHEJ) to repair double-strand breaks in nuclear DNA.

[0006] There are currently no reports on inhibitors of DNA ligase III. Summary of the Invention

[0007] The purpose of this invention is to provide an application of DNA ligase III (LIG3).

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A DNA ligase III inhibitor containing amygdalin, with the chemical formula C0. 29 H 30 O 13 The structural formula is

[0010] The inhibitor, amygdalin, inhibits DNA ligase III activity; wherein the concentration of amygdalin is 40-100 μM.

[0011] An application of the aforementioned DNA ligase III inhibitor, specifically its application in regulating DNA damage repair pathways.

[0012] The application of the DNA ligase III inhibitor in regulating the in vitro and in vivo activity of DNA ligase III.

[0013] Application of the DNA ligase III inhibitor in regulating DNA ligase III protein expression in triple-negative breast cancer.

[0014] The application of the DNA ligase III inhibitor in regulating apoptosis and DNA damage in triple-negative breast cancer cells.

[0015] The application of the DNA ligase III inhibitor in regulating the proliferation of triple-negative breast cancer cells.

[0016] The application of the DNA ligase III inhibitor in regulating migration in triple-negative breast cancer cells.

[0017] The application of the DNA ligase III inhibitor in the preparation of immunotherapy and / or preventive drugs for triple-negative breast cancer.

[0018] Principle of this invention:

[0019] The application of DNA ligase III inhibitors in the treatment of triple-negative breast cancer in this invention inhibits the expression and activity of DNA ligase III, thereby suppressing the DNA ligase III-mediated DNA damage repair pathway. This allows the DNA ligase III inhibitor to inhibit tumor growth and metastasis, while simultaneously inducing tumor cell apoptosis and DNA damage. Therefore, DNA ligase III inhibitors can be used in the treatment and / or prevention of breast cancer immunotherapy; specifically:

[0020] The compound amygdalin of this invention, as a natural drug, has a specific inhibitory effect on DNA ligase III and the ability to target and inhibit DNA ligase III activity. Furthermore, it has the ability to inhibit DNA ligase III expression and kill breast cancer cells, thus unlocking new drug efficacy. Attached Figure Description

[0021] Figure 1 This is an MTT quantitative curve of the killing effect of amygdalin, a DNA ligase III inhibitor, on tumor cells, as proposed in this embodiment of the invention. Human breast cancer BT-549 cells and MDA-MB-231 cell lines were treated with different final concentrations of amygdalin for 48 hours, and cell numbers were detected after staining.

[0022] Figure 2 This is a Western blot image of the DNA ligase III inhibitor, amygdalin, inhibiting DNA ligase III in human breast cancer BT549 cells and MDA-MB-231 cell lines, as described in this embodiment of the invention.

[0023] Figure 2 A is a Western blot image showing the changes in LIG3 protein levels in BT-549 cells after treatment with 40 μM amygdalin for 48 h. Figure 2 B is the quantification graph. Figure 2 C is a Western blot image showing the changes in LIG3 protein levels in MDA-MB-231 cells after treatment with 40 μM amygdalin for 48 h. Figure 2 D is its quantization plot.

[0024] Figure 3 This is a comet-shaped experimental diagram showing the DNA damage caused by the DNA ligase III inhibitor amygdalin in human breast cancer BT-549 cells and MDA-MB-231 cell lines, as described in this embodiment of the invention. Figure 3 A involves treating BT-549 cells with 40 μM amygdalin for 48 hours, and then using a comet assay to detect the degree of DNA damage. Figure 3 B involves treating MDA-MB-231 cells with 40 μM amygdalin for 48 hours, and then using a comet assay to detect the degree of DNA damage.

[0025] Figure 4 This is a scratch assay diagram illustrating the inhibition of migration function of human breast cancer BT-549 cells and MDA-MB-231 cell lines by amygdalin, a DNA ligase III inhibitor proposed in this invention. The migration changes of BT-549 and MDA-MB-231 cell lines at different concentrations (0 μM, 20 μM, 40 μM) were detected using the cell scratch assay.

[0026] Figure 5This is a colony formation assay diagram illustrating the inhibition of proliferation of human breast cancer BT-549 and MDA-MB-231 cell lines by amygdalin, a DNA ligase III inhibitor, as described in this invention. The cell counts of BT-549 and MDA-MB-231 cell lines treated with different concentrations for 48 hours were measured, and the effect of amygdalin on breast cancer cell proliferation was observed through the colony formation assay.

[0027] Figure 6 The DNA ligase III inhibitor amygdalin proposed in this embodiment of the invention increases apoptosis in human breast cancer BT-549 cells and MDA-MB-231 cell lines. After treating human breast cancer BT-549 cells and MDA-MB-231 cell lines with culture medium containing different concentrations of amygdalin (0 μM, 20 μM, 40 μM) for 48 h, flow cytometry was performed to observe cell apoptosis. Figure 6 As shown in Figure A, the apoptosis rate in BT549 cells increased significantly with increasing drug concentration. At a drug concentration of 40 μM, the apoptosis rate was approximately 18%. Figure 6 B is the MDA-MB-231 cell line, which also showed that apoptosis increased with increasing amygdalin concentration.

[0028] Figure 7 This image shows an SDS-PAGE gel electrophoresis image of purified DNA ligase III (LIG3) after in vitro expression, demonstrating the effect of amygdalin, a DNA ligase III inhibitor, on LIG3 activity in vitro. To further investigate the inhibitory effect of amygdalin on LIG3, LIG3 was first purified in vitro using a Ni column. SDS-PAGE electrophoresis of the purified protein showed that the purified protein was approximately 100 kDa, and the band position was correct. This provides LIG3 protein for subsequent experiments to verify whether amygdalin can affect LIG3 activity in vitro.

[0029] Figure 8 This is a denaturing gradient gel electrophoresis image showing the in vitro inhibition of DNA ligase III activity by amygdalin, a DNA ligase III inhibitor proposed in this invention. We artificially synthesized three complementary sequences. A fluorescent marker was added to the 5' end of one of these sequences. In the presence of ligase, the three sequences were ligated into a complete complementary sequence, and the labeled DNA became longer. In the presence of the inhibitor, the fluorescent marker was present on the shorter DNA segment. The inhibitory effect could be determined by the position of the fluorescently excited bands using denaturing gradient gel electrophoresis. Figure 7As shown, the first band represents oligonucleotides without ligase and inhibitors, the second band represents oligonucleotides with purified LIG3, and the third band represents oligonucleotides with purified LIG3 and 100 μM amygdalin. Without ligase, the fluorescent marker is located lower; with the addition of purified ligase, the fluorescent marker is located higher, indicating that the ligase is active. With the addition of 100 μM amygdalin, the fluorescent markers at higher positions are fainter than in the second lane, while those at lower positions are darker than in the second lane, indicating that amygdalin inhibits the activity of the ligase in ligating the substrate. This suggests that amygdalin can inhibit LIG3 protein activity in vitro.

[0030] Figure 9 This is a molecular simulation diagram showing that the DNA ligase III inhibitor amygdalin proposed in this embodiment of the invention can stably bind to LIG3. Figure 9 A is the conformation diagram of amygdalin stably bound to LIG3. Figure 9 B is a graph showing the change in the stability of amygdalin binding to LIG3. Detailed Implementation

[0031] The present invention will be described in detail below with reference to embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any way. It should be noted that those skilled in the art can make several adjustments and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention.

[0032] This invention utilizes a DNA ligase III inhibitor (almondin) that can inhibit ligase III activity in vitro and suppress LIG3 expression levels intracellularly, thereby inhibiting the DNA damage repair process. This provides an application for DNA ligase III inhibitors in viral therapy and tumor immunotherapy. Furthermore, DNA ligase III inhibitors can be used in tumor immunotherapy by inhibiting cell proliferation and migration. They can also be used in tumor immunotherapy by increasing DNA damage and apoptosis.

[0033] The DNA ligase III inhibitor amygdalin used in the following examples was obtained from Shanghai Taoshu Biotechnology Co., Ltd., and the human breast cancer cell lines BT549 and MDA-MB-231 were obtained from the American Type Culture Collection.

[0034] Example 1: Amygdalin, a DNA ligase III inhibitor, inhibits the expression of DNA ligase III in breast cancer cells, thereby impairing the DNA damage repair pathway and inhibiting the proliferation of triple-negative breast cancer cells. The techniques and experimental steps include the following:

[0035] 1. Cell culture:

[0036] Human breast cancer BT-549 cells adhered and grew in RPMI-1640 medium containing 10% fetal bovine serum and 1% penicillin-streptomycin solution, while human breast cancer MDA-MB-231 cell line adhered and grew in DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin solution. Both were cultured at a constant temperature of 37°C with 5% carbon dioxide.

[0037] 2. MTT cell viability analysis

[0038] Using MDA-MB-231 and BT549 cells cultured for 48 hours, 5 x 10⁻⁶ cells were taken from each well. 3 Cells were added to 96-well plates. After cell adhesion, the drug (amycin) was added at the experimental concentration. After 48 hours, the medium was removed and fresh medium containing 0.5% MTT was added. The cells were cultured at 37°C and 5% CO2 for 4 hours. The medium was then discarded, and 150 μL of DMSO was added. The cells were incubated at 37°C for 15 minutes. The absorbance of the samples was measured using a microplate reader. The data were analyzed to obtain cell viability curves and IC50 values ​​of BT549 and MDA-MB-231 cells at different drug concentrations (see [link to microplate reading]). Figure 1 ).

[0039] Depend on Figure 1 It is evident that amygdalin exhibits significant killing effects on both BT549 and MDA-MB-231 breast cancer cell lines, with IC50 values ​​around 50 μM.

[0040] 3. Immunoblot analysis

[0041] (1) BT549 cells and MDA-MB-231 cells with a confluence of 70-80% were digested with trypsin. After digestion was terminated, the cells were collected by pipetting and washed twice with PBS buffer. Proteins were extracted using cell lysis buffer and other reagents. The protein concentration was determined using Qubit 2.0. 25 μL of 5*loading buffer was added and the mixture was boiled in a water bath for 10 min. To avoid repeated freezing and storage affecting the quality of the protein, the protein was aliquoted and stored in a -80°C freezer.

[0042] (2) Polyacrylamide gel electrophoresis: Based on the measured concentration, approximately 60 μg of protein is loaded into each well. The protein needs to be boiled before loading. Add 3 μL of marker and start electrophoresis.

[0043] (3) Cut the gel and perform semi-dry transfer on a PVDF membrane at 200 mA. Place the membrane in blocking buffer (3% skim milk powder, 0.5% Triton-100) for 2 hours, add primary antibody as directed, and incubate overnight at 4°C. After recovering the primary antibody, wash the membrane with TBST and shake on a shaker at room temperature for 15 minutes, repeating three times. Dilute the corresponding secondary antibody according to the specified ratio and incubate at room temperature for 2 hours. Wash the membrane with TBST and shake on a shaker at room temperature for 10 minutes, repeating three times. Then, use ECL chemiluminescence to perform development and analysis using a gel imaging system. Analyze the bands using ImageLab and collect statistical data (see [link to data]). Figure 2 ).

[0044] Depend on Figure 2 As can be seen, the expression level of LIG3 was significantly decreased after treatment of BT549 and MDA-MB-231 cells with 40 μM amygdalin. The results indicate that amygdalin can inhibit LIG3 expression in breast cancer cells.

[0045] 4. Comet Experiment

[0046] (1) Clean the glass slide with ethanol before use and wipe it dry with paper.

[0047] (2) For the bottom layer, prepare 1% normally dissolved agarose (10 mg, dissolved in 1 mL PBS) and boil it in water for 5 minutes. Place the glass slide with the frosted side facing up, drop 100 μL of 1% normally melting agarose onto the glass slide, and cover it with the glass slide. Incubate at 4°C for about 10 minutes.

[0048] (3) Prepare 0.7% low melting point agarose (14 mg in 1 mL PBS). Heat in a 70°C water bath until the agarose dissolves. Place the low melting point agarose in a 70°C water bath.

[0049] (4) Gently remove the coverslip, mix 10 μL of BT549 and MDA-MB-231 cells (about 104 cells) with 75 μL of 0.7% low melting point agarose, drop the mixture onto the first layer of gel, and place at 4°C for about 30 min.

[0050] (5) Gently remove the coverslip, add 75 μL of 0.7% low melting point agarose to the second layer of gel, gently cover with the coverslip, and place at 4°C for about 30 minutes.

[0051] (6) Remove the coverslip and place at 4°C for 2 hours. The slide can be stored in the cold lysis solution for a long time (but usually not more than 4 weeks). If precipitation of the lysis solution is observed, carefully rinse the slide with distilled water before electrophoresis.

[0052] (7) Gently remove the slide from the lysis buffer. Place the slide in the gel cassette near the anode (+) end, as close as possible. Pour in electrophoresis buffer (4°C) until it completely covers the slide (avoid air bubbles on the agarose). Allow the slide to sit in alkaline buffer for 30 minutes to allow DNA release and alkaline instability to impair expression.

[0053] (8) Turn on the power to 25V and perform electrophoresis for 50 minutes. Turn off the power. Gently remove the slide from the buffer solution and place it in the neutralization buffer, letting it stand for 10 minutes. Repeat twice. Carefully rinse off the neutralization buffer with distilled water, add ethidium bromide staining solution (2.5 μg / mL), stain for 3 minutes, and then immediately detect the stain (see [link to relevant documentation]). Figure 3 ).

[0054] Depend on Figure 3 It can be seen that in BT549 cells ( Figure 3 A) and MDA-MB-231 cells ( Figure 3 In B), when 40 μM of amygdalin was added, compared with the control group, obvious band tailing phenomenon, i.e., DNA damage comet tail, was produced, which proved that amygdalin can cause DNA damage in breast cancer cells.

[0055] 5. Cell scratch test

[0056] BT549 and MDA-MB-231 cells in good logarithmic growth phase were seeded into 6-well plates and incubated at 37°C. Once the cells had adhered and reached approximately 80% confluence, a scratch assay was performed. Using the same 200 μL pipette tip, cross-hatching was performed along a ruler. Cells were cleaned with PBS to remove any detached cells. Different drug concentrations were set (both the drug group and the control group were treated with low-concentration serum). Photos were taken and recorded at 24 h and 48 h (see [reference]). Figure 4 ).

[0057] Depend on Figure 4 It can be seen that in BT549 cells ( Figure 4 A, 4B) and MDA-MB-231 cells ( Figure 4 In C, 4D), the healing rate of the scratches decreased with increasing drug concentration and over time. This demonstrates that amygdalin can inhibit the normal migration function of breast cancer cells.

[0058] 6. Cloning experiment

[0059] Freshly cultured BT549 and MDA-MB-231 cells were digested with trypsin and seeded into 24-well plates at 200 cells per well. After mixing, and once the cells adhered, they were treated with the drug for 48 hours, then replaced with 500 μL of complete culture medium. The medium was changed every two days, and the cells were cultured for another 7 days. The cells were then fixed. For fixation, 500 μL of 4% paraformaldehyde solution was added to each well, and the cells were fixed at room temperature for 20 minutes. Then, 500 μL of 0.1% crystal violet staining solution was added to each well, and the cells were incubated at room temperature for 30 minutes. The crystal violet was aspirated, and the cells were carefully washed away with ddH2O. The cells were then placed in an oven for 1 hour. After all water droplets had cleared, the cells were photographed (see [link to image]). Figure 5 ).

[0060] Depend on Figure 5 It can be seen that in BT549 cells ( Figure 5 In A, 5B) at a concentration of 40 μM, the inhibitory efficiency was approximately 50%, and in MDA-MB-231 cells ( Figure 5 In C, 5D), the inhibition efficiency at a concentration of 40 μM exceeded 70%. This demonstrates that amygdalin can inhibit the normal proliferation of breast cancer cells.

[0061] 7. Flow cytometry detection of apoptosis

[0062] (1) When BT549 cells and MDA-MB-231 cells were in the logarithmic growth phase, culture medium containing the experimental concentration of the drug was added and cultured in an incubator at 37°C for 48 hours.

[0063] (2) Add 500 μL of PBS to each well and wash once (before this, aspirate the cell culture medium to stop digestion).

[0064] (3) Remove the PBS and treat the cells with EDTA-free trypsin.

[0065] (4) Add the previously collected cell culture medium to the well, transfer it to a 5mL centrifuge tube, and centrifuge.

[0066] (5) After resuspending the cells, transfer them to a 1.5 ml / L centrifuge tube and centrifuge to remove as much supernatant as possible.

[0067] (6) Dilute with 5*binding buffer. Add 100 μL of 1*binding buffer to each sample. Set up double-negative groups, single PI staining groups, single AV staining groups, and double-staining experimental groups. Add 2 μL of AV and 1 μL of PI dye to each group and mix well. Except for the PI well and the AV-binding negative control group, add 10 μL of PI to each well and gently tap the bottom of the EP tube with your hand.

[0068] (7) Incubate in a clean bench in the dark for about 20 minutes, and then add 200 μL of 1*binding buffer to each sample.

[0069] (8) Place in ice, filter out of light, and test on the machine (see...). Figure 6 ).

[0070] Depend on Figure 6 It is evident that in BT549 cells, the apoptosis rate significantly increased with increasing drug concentration. Figure 6 A) At a drug concentration of 40 μM, the apoptosis rate was approximately 18%. Similar results were obtained in MDA-MB-231 cells. Figure 6 B) At a drug concentration of 40 μM, the apoptosis rate was approximately 15%. This demonstrates that amygdalin can promote apoptosis in breast cancer cells.

[0071] According to Example 1, the DNA ligase III inhibitor amygdalin exhibits a strong killing effect on tumor cells. Figure 1 ), and inhibits LIG3 expression in breast cancer cells ( Figure 2 ).

[0072] According to Example 1, it can be concluded that amygdalin can inhibit the migration and proliferation of breast cancer cells. Figure 4 , 5 ).

[0073] Example 1 demonstrates that amygdalin can cause DNA damage in breast cancer cells and promote apoptosis in breast cancer cells. Figure 3 , 6 Therefore, this invention has discovered that amygdalin—an inhibitor of DNA ligase III—can inhibit the expression of DNA ligase III, thereby affecting the DNA damage repair pathway. Through the above process, it can affect the normal growth and metabolic activities of breast cancer cells, thereby damaging breast cancer cells and achieving an anti-tumor effect.

[0074] Example 2: In vitro purification of DNA ligase III showed that its activity was inhibited after treatment with amygdalin.

[0075] 1. Preparation of main reagents

[0076] (1) LB liquid medium:

[0077] Weigh 1g NaCl, 1g tryptone, and 0.5g yeast, pour them into an Erlenmeyer flask, add 100mL deionized water, autoclave, add kanamycin when the temperature is suitable, and store at 4℃ for later use.

[0078] (2) LB solid culture medium

[0079] Weigh 1g NaCl, 1g tryptone, 0.5g yeast, and 2g agarose into an Erlenmeyer flask, add 100mL deionized water, autoclave, and add kanamycin when the temperature is suitable. Dispense the mixture into autoclaved petri dishes, and after the culture medium has solidified, seal it with sealing film and store it at 4℃ for later use.

[0080] (3) Pyrolysis solution

[0081] 7.8g NaH2PO4·2H2O, 17.54g NaCl, 0.68g imidazole, adjust pH to 8.0 with NaOH, and add water to a final volume of 1L.

[0082] (4) Washing liquid

[0083] 7.8g NaH2PO4·2H2O, 17.54g NaCl, 1.36g imidazole, adjust the pH to 8.0 with NaOH, and add water to a final volume of 1L.

[0084] (5) Elution solution

[0085] 7.8g NaH2PO4·2H2O, 17.54g NaCl, 17.0g imidazole, adjust the pH to 8.0 with NaOH, and add water to a final volume of 1L.

[0086] 2. Plasmid construction

[0087] Construct expression plasmids containing full-length mammalian LIG3

[0088] The empty plasmid vector selected was pET-28a(+).

[0089] (1) Obtain the full-length LIG3 sequence by PCR

[0090] The PCR reaction mixture consisted of: 50 μL of 1 μL upstream primer, 1 μL downstream primer, 5 ng of plasmid template containing LIG3 cDNA (Sino Biologica, Cat: HG18305-U), 25 μL Prime Star Max Premix, and 22 μL ddH2O. Primer sequences are shown in Table 2.

[0091] The PCR reaction conditions were: 98℃ for 2 min; 98℃ for 10 s, 55℃ for 5 s, 72℃ for 2 min for 30 cycles; 72℃ for 10 min.

[0092] (2) The vector pET-28a(+) and PCR fragment were digested overnight at 37°C using restriction endonucleases SalI and BamHI.

[0093] (3) 1.5% agarose gel electrophoresis, 100V, 45min. The vector and target fragment were recovered using the Transgene gel extraction kit, and the concentration was measured using Nanodrop.

[0094] (4) The fragments were recovered using the Transgene gel extraction kit and the concentration was measured using Nanodrop.

[0095] (5) Use T4 ligase to ligate the vector and the target fragment at 16°C for 30 min.

[0096] (6) Transform the ligation product using DH5α competent cells. Add 5 μL of ligation product to 50 μL of competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min. After incubating at 42℃ for 45 s and on ice for 2 min, add 350 μL of antibiotic-free LB liquid medium. Incubate at 37℃, 200 rpm, for 1 h using a shaker. Spread 200 μL onto a solid medium plate containing the corresponding antibiotic and incubate at 37℃ for 14-16 h.

[0097] (7) Pick a single colony that has grown on the solid culture medium and put it into LB liquid culture medium, add kanamycin, and shake at 120 rpm for 12-16 hours.

[0098] (8) Double enzyme digestion identification and sequencing were performed. The bacterial culture with the correct sequence was preserved with 50% glycerol.

[0099] Table 2. Primer Sequences

[0100]

[0101] 3. Purification of recombinant proteins

[0102] (1) The successfully constructed plasmid was shaken overnight.

[0103] (2) Take 2 mL of the shaken bacterial solution and add it to 400 mL of LB liquid medium. Add the corresponding amount of kanamycin and shake at 37℃ and 120 rpm until the bacterial solution OD600 is about 0.6. Then add IPTG with a final concentration of 0.5 mM for induction at 30℃ for 4 h.

[0104] (3) Collect the bacterial culture, transfer the culture medium to a 50 mL centrifuge tube, centrifuge at 7000 rpm for 15 min, collect the bacterial cells, and then add 1 / 10 of the bacterial culture volume of lysis buffer and appropriate concentration of PMSF.

[0105] (4) Mix the bacteria by blowing them up, and use an ultrasonic disruptor on ice until the bacteria become clear, then stop the ultrasonication.

[0106] (5) Collect the sonicated protein solution, centrifuge at 10,000 rpm and 4°C for 20 min, and then filter it using a 0.45 μm filter membrane.

[0107] (6) For protein purification using nickel columns, first pack the column.

[0108] (7) Rinse the nickel column with 5 times its volume of deionized water.

[0109] (8) Equilibrate the nickel column with 5 times the volume of pyrolysis solution.

[0110] (9) Pass the protein sample through the nickel column at a relatively slow speed.

[0111] (10) Clean the column with 15 times its volume of washing solution.

[0112] (11) Elute the protein with 10 times the volume of elution buffer.

[0113] (12) Rinse the nickel column with 3 times the volume of lysis buffer and 5 times the volume of deionized water.

[0114] (13) Equilibrate the nickel column with 5 times the volume of 20% ethanol, and then store it in PBS solution of 20% ethanol at 4°C.

[0115] (14) Perform SDS-PAGE verification on the collected liquid (participate in the process). Figure 7 ).

[0116] 4. DNA ligation experiment

[0117] Three DNA fragments were artificially synthesized, with complementary base sequences (see Table 3). One strand was labeled with cy3. In the presence of ligase, the three single strands were repaired into complementary double strands. The reaction conditions were as follows: the reaction mixture (20 μL) contained 1 pmol of labeled DNA substrate (substrate listed in Table 3, volume ratio 1:1:1, final concentration 0.5 pmol / mL) and 0.2 pmol of purified recombinant protein LIG3; the ligation buffer contained Tris-Cl (50 mM, pH 7.5), MgCl2 (10 mM), BSA (0.25 mg / mL), NaCl (100 mM), and ATP (500 μM). The double-stranded gap DNA was incubated with the purified ligase at 37°C for 30 min, and the reaction was stopped by adding 10 μL of stop buffer (90% formamide + 10% 50 mM EDTA). After the reaction, denaturing gradient gel electrophoresis was performed (see...). Figure 8 ).

[0118] Table 3. Nucleotide sequences

[0119] 52-mer GTACGTCGATCGATTGGTAGATCAGTGTCTATGTATGTCAGTGAGATAGTAC 25-mer CTGATCTACCAATCGATCGACGTAC 27-mer Cy3 / GTACTATCTCACTGACATACATAGACA

[0120] Depend on Figure 8 As can be seen, the first band represents oligonucleotides without the addition of ligase and inhibitors, with the markers appearing at lower positions. The second band represents oligonucleotides with the addition of purified LIG3. After the addition of purified ligase, most oligonucleotides were repaired by LIG3, and the C markers appeared at higher positions, indicating that the ligase was functioning. The third band represents oligonucleotides with the addition of purified LIG3 and 100 μM amygdalin. It was found that after the addition of 100 μM amygdalin, the markers at higher positions were lighter than those in the second lane, while the markers at lower positions were darker than those in the second lane, indicating that amygdalin inhibited the activity of the ligase in ligating the substrate and could inhibit the activity of LIG3 protein in vitro.

[0121] According to Example 2, it was demonstrated that amygdalin can inhibit the activity of LIG3 in vitro. Figure 8 Therefore, this invention has found that amygdalin—an inhibitor of DNA ligase III—can bind tightly to LIG3 both intracellularly and extracellularly, thereby causing a conformational change in LIG3, preventing it from functioning as a linker of nucleotide chains, and resulting in reduced enzyme activity.

[0122] 5. Molecular dynamics simulation

[0123] The optimal conformation of amygdalin was used, and hydrogenation and charge addition were performed on the optimal conformation using the UCSFChimera tool. The output was in the Mol2 format required for molecular dynamics simulations. The molecular dynamics simulation was performed using Gromacs 5.1.2. The specific process is as follows:

[0124] (1) Using the Amber99sb Force Field to input the protein force field, the protein PDB structure was augmented with a TIP3P model of water molecules, generating atomic and topological files. The minimum distance of each solute molecule from the box boundary was... Appropriate amounts of ions were added to neutralize the simulated system's electrical properties. The molecular force field parameter file was generated using acpype in ANTECHAMBER. After protein and small molecule pretreatment, a complex.pdb file was generated from the proteins and small molecules, followed by .top and .itp files to constrain molecular positions during equilibrium. Water and charge addition operations were then performed to simulate the state of the protein in an in vivo ionic solution.

[0125] (2) All systems underwent energy minimization and molecular dynamics equilibrium. First, the steepest descent method (12) was used for 2000 steps of energy minimization to avoid potential unwanted contact between the added solvent and solute system; then, the Fletcher-Reeves method was used for 2000 steps of optimization. The protein-small molecule system after equilibrium was stabilized was heated from 0 K to 300 K within 100 picoseconds (ps). The system was then held at 300 K for 500 ps of NVT ensemble kinetic equilibrium, followed by 1 ns of NPT (isothermal-isobaric) ensemble kinetic equilibrium at an isothermal temperature of 300 K and a normal pressure of 1 atm (see [reference]). Figure 9 ).

[0126] Depend on Figure 9 As can be seen from A, amygdalin has multiple binding sites with LIG3, forming multiple hydrogen bonds and π bonds with LIG3, indicating that amygdalin can form strong intermolecular forces with LIG3 and exert an inhibitory effect. Figure 9 As shown in Figure B, the blue line represents the LIG3 protein receptor, and the black line represents the amygdalin small molecule ligand. It can be seen that the protein fluctuates violently at the moment the small molecule is added, but then tends to stabilize. This indicates that amygdalin has little effect on the binding stability of LIG3 and can form a relatively stable structure with LIG3.

[0127] According to Example 2, it was found that amygdalin, a DNA ligase III inhibitor, can stably bind to DNA ligase III. Figure 9 ).

[0128] In summary, these results of the present invention represent the first discovery of amygdalin, an inhibitor targeting DNA ligase III. This opens up new applications for amygdalin, which can inhibit DNA damage repair by reducing the expression and activity of DNA ligase III in breast cancer cells. This leads to slower proliferation and migration of breast cancer cells, increased DNA damage and apoptosis, and ultimately kills breast cancer cells, providing a new strategy for breast cancer treatment. Therefore, amygdalin can be used as a drug to inhibit the expression and activity of DNA ligase III; it can also be used as a drug to kill breast cancer cells; furthermore, it can be used as a drug to inhibit the proliferation and migration of breast cancer cells, increase apoptosis and DNA damage in breast cancer cells, and thus further as a tumor immunotherapy drug.

Claims

1. The application of a DNA ligase III inhibitor, characterized in that: The application of the DNA ligase III inhibitor in the preparation of drugs for the treatment and / or prevention of triple-negative breast cancer; The DNA ligase III inhibitor is amygdalin, with the chemical formula C. 29 H 30 O 13 The structural formula is .

Images