Application of ackermania kwangsiensis in preparation of medicine for preventing and / or treating Alzheimer's disease

Abstract

The invention provides application of ackermania kwangsiensis in preparation of a medicine for preventing and / or treating Alzheimer's disease, and belongs to the technical field of biological medicines. The invention provides application of ackermania kwangsiensis or a probiotic agent containing the ackermania kwangsiensis in preparation of a medicine for preventing and / or treating the Alzheimer's disease. According to the present invention, the pharmacological experiment is performed by using the D-galactose induced mouse cognitive impairment model as the experiment, and the result shows that the ackermania kwangsiensis not only can effectively improve the autonomous exploration ability and the learning cognitive ability, but also can improve the expression level of the BDNF in the hippocampus, such that the ackermania kwangsiensis can be used for developing or preparing the Alzheimer's disease treatment drug.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological medicines, and specifically relates to an application of Akkermansia guangxiensis in the preparation of medicines for preventing and / or treating Alzheimer's disease. Background Art

[0002] Alzheimer's disease (AD) is a neurodegenerative disease that develops slowly and progresses. It is one of the common diseases that causes the elderly to lose their ability to take care of themselves. Alzheimer's patients have a certain degree of cognitive impairment, which seriously affects their lives. Common drug treatments can treat Alzheimer's patients with drugs such as donepezil, rivastigmine, huperzine A, fluoxetine, etc., which can alleviate symptoms or delay the progression of the disease, but these chemical drugs all have certain side effects.

[0003] A large number of studies have revealed a close relationship between intestinal microbiota and AD, and the "microbe-gut-brain axis" may have the potential to become an effective way to treat AD. Akkermansia muciniphila (AKK) is a "potential stock" among the next generation of probiotics and is at the forefront of translational application research. Akkermansia guangxiensis has excellent anti-aging, antioxidant, tumor cell growth inhibition and weight loss and lipid-lowering effects. However, there are currently no reports on the application of Akkermansia guangxiensis in the treatment of Alzheimer's disease. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a use of Akkermansia guangxiensis in the preparation of a drug for preventing and / or treating Alzheimer's disease.

[0005] The present invention provides an application of Akkermansia Guangxi or a probiotic agent containing Akkermansia Guangxi in preparing a medicine for preventing and / or treating Alzheimer's disease.

[0006] Preferably, the Akkermansia Guangxi includes the Akkermansia Guangxi strain N21116;

[0007] The deposit number of the Guangxi Akkermansia strain N21116 is GDMCC No: 62888.

[0008] Preferably, the Akkermansia guangxiensis includes the following forms: bacterial body, bacterial suspension and fermentation broth.

[0009] Preferably, the dosage form of the probiotic containing Akkermansia guangxi comprises at least one of the following solutions, lyophilized powders, capsules, tablets and granules.

[0010] Preferably, the preparation method of the lyophilized powder comprises isolating bacterial cells from the fermentation broth of Akkermansia guangxiensis, mixing the bacterial cells with a lyophilization protective agent, and freeze-drying to obtain the lyophilized powder.

[0011] Preferably, the lyoprotectant is 10-12% by mass of skim milk, 8%-10% by mass of trehalose, 0.5-1% by volume of sorbitol and 2%-5% by mass of vitamin C.

[0012] Preferably, the mass ratio of the bacterial cells to the lyophilization protective agent is 1-2:1-2.

[0013] Preferably, the manifestations of Alzheimer's disease include at least one of the following behaviors: decreased autonomous exploratory behavior, cognitive impairment, decreased learning ability and memory loss.

[0014] Preferably, the drug comprises at least one of the following dosage forms: powder, tablet, capsule, oral solution and drops.

[0015] Preferably, the effective live bacterial concentration of Akkermansia guangxiensis in the drug is not less than 1×10 8 CFU / mL or 1×10 8 CFU / g.

[0016] The present invention provides an application of Guangxi Akkermansia or a probiotic containing Guangxi Akkermansia in the preparation of a drug for preventing and / or treating Alzheimer's disease. The present invention uses a D-galactose-induced mouse cognitive impairment model as an experimental subject to investigate whether Guangxi Akkermansia has an improvement effect on Alzheimer's disease. Experiments show that the intervention of Guangxi Akkermansia can significantly increase the activity time, activity distance in the central area and activity distance in the marginal area, significantly shorten the escape latency, and increase the number of crossing the target quadrant. It can be seen that Guangxi Akkermansia can effectively improve autonomous exploration ability and learning and cognitive ability, increase the expression level of BDNF in the hippocampus, and has an improvement effect on Alzheimer's disease, and the effect is better than that of the AKK model strain ATCC BAA-835. The present invention not only expands the scope of application of Guangxi Akkermansia, but also increases the treatment approach for Alzheimer's disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The results of the effect of Akkermansia guangxiensis on autonomous exploration ability; (A) is the result of central area movement time, (B) is the result of central area movement distance, and (C) is the result of peripheral area movement distance;

[0018] Figure 2 Behavioral trajectory results of open field test for each group of mice;

[0019] Figure 3The results of the effects of Akkermansia guangxiensis on learning and cognitive abilities; (A) is the result of escape latency; (B) is the number of times of crossing the platform;

[0020] Figure 4 The behavioral trajectory results of Morris water maze behavior test were performed for each group of mice;

[0021] Figure 5 This is the result of the effect of Akkermansia guangxiensis on the expression level of BDNF in the hippocampus. DETAILED DESCRIPTION

[0022] The present invention provides an application of Akkermansia Guangxi or a probiotic agent containing Akkermansia Guangxi in preparing a medicine for preventing and / or treating Alzheimer's disease.

[0023] In the present invention, the Guangxi Akkermansia preferably includes Guangxi Akkermansia strain N21116. The deposit number of the Guangxi Akkermansia strain N21116 is GDMCC No: 62888. The Guangxi Akkermansia strain N21116 is isolated from feces of a centenarian and is disclosed and deposited in the patent publication number CN116200312A.

[0024] In the present invention, the Guangxi Akkermansia preferably includes the following forms: bacterial cells, bacterial suspensions and fermentation broth. The method for preparing the bacterial cells of the Guangxi Akkermansia is preferably to inoculate the activated Guangxi Akkermansia seed liquid into a liquid synthetic culture medium replacing the mucin component, anaerobically culture at 37°C for 48 hours, obtain a fermentation broth, separate the solid and liquid, collect the precipitate, and obtain the bacterial cells. The liquid composite culture medium replacing the mucin component is an aqueous solution containing the following components: glucose 7.2g / L, yeast extract powder 9.0g / L, soy peptone 6.0g / L, L-cysteine ​​0.5g / L, sodium nitrate 0.425g / L, N-acetylglucosamine 2.0g / L, sodium chloride 4.5g / L, disodium hydrogen phosphate 5.0g / L and threonine 8.0g / L. The bacterial suspension is obtained by resuspending the bacterial cells in a solution.

[0025] In the present invention, the dosage form of the probiotic containing Akkermansia Guangxi preferably includes at least one of the following solutions, freeze-dried powders, capsules, tablets and granules. The preparation method of the freeze-dried powder preferably separates the bacteria from the fermentation broth of Akkermansia Guangxi, mixes the bacteria with a freeze-dried protective agent, and freeze-dries to obtain a freeze-dried powder. The freeze-dried protective agent is 10% skim milk, 10% trehalose, 1% sorbitol, and 5% vitamin C. The mass ratio of the bacteria and the freeze-dried protective agent is preferably 1-2:1-2, and can be 1:1.

[0026] In the present invention, the manifestations of Alzheimer's disease include the following behaviors: decreased autonomous exploratory behavior, cognitive impairment, decreased learning ability and decreased memory. In an embodiment of the present invention, a mouse cognitive impairment model induced by D-galactose is used as an experimental subject to carry out the efficacy of Guangxi Akkermansia or its probiotics. The daily injection dose of the D-galactose is preferably 200 mg / kg, and the injection time of the D-galactose lasts for 8 weeks. The mine experiment showed that compared with the normal group, the activity time, activity distance and activity distance of the D-galactose-induced mice in the central area were significantly reduced, indicating that the autonomous exploratory behavior and cognitive ability of mice in an unfamiliar environment were reduced; at the same time, the Morris water maze experiment showed that the escape latency of mice was significantly increased, and the number of times they crossed the target quadrant was significantly reduced, indicating that the learning and cognitive ability of mice induced by D-galactose was reduced.

[0027] In the present invention, in the mine field experiment, the intragastric administration of the probiotic agent containing Guangxi Akkermansia can effectively increase the activity time and activity distance of mice in the central area and the activity distance in the edge area, indicating that the Guangxi Akkermansia can effectively improve the autonomous exploration behavior and cognitive ability of mice in an unfamiliar environment, and the effect is better than that of the AKK model strain ATCC BAA-835. In the Morris water maze experiment, the intragastric administration of the probiotic agent containing Guangxi Akkermansia can effectively shorten the arm selection latency and increase the number of crossing the target quadrant, which indicates that the Guangxi Akkermansia restores the learning ability of mice and improves memory, and the effect is better than that of the AKK model strain ATCC BAA-835.

[0028] In the present invention, in order to further understand the pharmacodynamic mechanism of Akkermansia guangxi, the hippocampal tissues of the D-galactose-induced mouse cognitive impairment model and the mice treated with the drug were dissected and isolated, and the expression level of BDNF was detected by qPCR. The results showed that compared with normal mice, the expression level of BDNF in the hippocampus of the model mice was significantly reduced, while the administration of Akkermansia guangxi could restore the expression level of BDNF in the hippocampus of the model mice, and the degree of increasing the expression of BDNF was better than that of the AKK model strain ATCC BAA-835.

[0029] In the present invention, the drug preferably includes at least one of the following dosage forms: powder, tablet, capsule, oral solution and drops. The effective live bacterial concentration of Akkermansia guangxiensis in the drug is not less than 1×10 8 CFU / mL or 1×10 8 CFU / g, or 5×10 8 CFU / mL, 1×10 9 CFU / mL, 5×10 9 CFU / mL, 1×10 10CFU / mL, 5×10 10 CFU / mL, 1×10 11 CFU / mL or 5×10 8 CFU / g, 1×10 9 CFU / g, 5×10 9 CFU / g, 1×10 10 CFU / g, 5×10 10 CFU / g, 1×10 11 The present invention does not impose any particular limitation on the preparation method of the drug, and any drug preparation method known in the art may be used.

[0030] The application of Akkermansia guangxiensis provided by the present invention in the preparation of a drug for preventing and / or treating Alzheimer's disease is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0031] Example 1

[0032] Preparation method of Guangxi Akkermansia freeze-dried powder

[0033] After the Guangxi Akkermansia strain N21116 was activated by streaking, a single colony was picked and placed in a liquid composite culture medium replacing the mucin component for anaerobically culture at 37°C for 10 hours to obtain a seed solution, and the seed solution was inoculated again in a liquid composite culture medium replacing the mucin component at a 10% inoculation amount for expansion culture. The liquid composite culture medium replacing the mucin component is an aqueous solution containing the following components: 7.2 g / L glucose, 9.0 g / L yeast extract, 6.0 g / L soy peptone, 0.5 g / L L-cysteine, 0.425 g / L sodium nitrate, 2.0 g / L N-acetylglucosamine, 4.5 g / L sodium chloride, 5.0 g / L disodium hydrogen phosphate and 8.0 g / L threonine. The bacterial solution was collected and centrifuged at 8000 rpm for 20 minutes at 4°C, the supernatant was discarded, the bacteria were washed with saline, and centrifuged again. The wet weight of the bacteria was weighed, and the whole process was operated under anaerobic conditions.

[0034] The bacteria and the freeze-drying protective agent (formulated as 10% skim milk, 10% trehalose, 1% sorbitol and 5% vitamin C) are mixed in a mass ratio of 1:1, and the mixture is freeze-dried. The freeze-drying procedure is as follows: the pre-freezing temperature is 50°C, the time is maintained for 4 hours, the primary drying temperature is -20°C, the time is 18 hours, and the secondary drying temperature is 25°C, the time is 10 hours. Finally, the freeze-dried powder is obtained. The freeze-dried powder is stored at -80°C. When used, the freeze-dried powder is resuspended with physiological saline, and counted by the plate counting method to obtain a concentration of 1×10 8 CFU / mL bacterial suspension.

[0035] Example 2

[0036] Construction of D-galactose-induced cognitive impairment model in mice and validation of the efficacy of Akkermansia guangxiensis

[0037] 1. Animal experiments

[0038] A total of 40 8-week-old SPF female C57BL / 6J mice were selected and raised in a controlled environment to ensure normal food and water intake. After 1 week of adaptive feeding, the mice were randomly divided into 4 groups, 10 in each group, and D-galactose (Shanghai Haoyuan Biopharmaceutical Technology Co., Ltd.) was used for intervention.

[0039] Animal modeling and intervention methods are as follows:

[0040] Normal group (Con): daily intragastric administration of normal saline and subcutaneous injection of the same volume of normal saline once a day; continuous intervention for 8 weeks;

[0041] Model group (D-gal): daily intragastric administration of normal saline and subcutaneous injection of D-galactose (200 mg / kg) dissolved in normal saline for 8 consecutive weeks;

[0042] AKK model strain ATCC BAA-835 intervention group: 200 μL of ATCC BAA-835 (1×10 8 CFU / mL), and subcutaneous injection of D-galactose (200 mg / kg) dissolved in normal saline once a day for 8 consecutive weeks;

[0043] N21116 intervention group: N21116 (1×10 8 CFU / mL), and subcutaneous injection of D-galactose (200 mg / kg) dissolved in normal saline once a day for 8 consecutive weeks.

[0044] 2. Open field experiment

[0045] The open field test was used to test the autonomous behavior of the experimental mice in the new environment in the 8th week. The experiment was conducted in a quiet environment. The test box was 50 cm long, 50 cm wide, and 40 cm high, and the inside was white. The camera was placed above the center of the test box so that the shooting angle could cover the entire test area. After the adaptation test, the mice were placed in the box from the designated corner, and the movement trajectory of the mice was recorded 10 minutes after entering the box. The test box was cleaned before each mouse was tested to avoid interference with the experimental results caused by the excrement and odor of the previous mouse.

[0046] Results Figure 1 and 2 .Depend on Figure 1 and Figure 2It can be seen that the activity time, activity distance in the central area and activity distance in the edge area of ​​the control group mice were significantly reduced compared with the blank group mice. The intervention of BAA-835 slightly improved this behavior, but the effect was not obvious, while the intervention of N21116 effectively restored the above behaviors, indicating that the intervention of 21116 can effectively improve the autonomous exploratory behavior and cognitive ability of mice in unfamiliar environments.

[0047] 3. Morris water maze test

[0048] The learning and memory abilities of the experimental mice were tested using the Morris water maze at the 8th week.

[0049] The test pool has a diameter of 1.2m and a height of 40-50cm. Pour water into the pool to make the water depth reach 30cm. The pool is divided into 4 quadrants. A circular platform with a diameter of 9cm and a height of 28cm is fixed in the third quadrant. Add food-grade white pigment to the water to hide the platform in the water. Set the photography equipment vertically above the center of the water maze pool so that the shooting angle can cover the entire test area. The water temperature is maintained at 22±1℃.

[0050] During the test, the experimental venue was kept bright and without obvious noise. The mice were placed in the water from the east, south, west, and north directions facing the pool wall. The first day was for adaptive training. From the second to the fifth day, the time it took for the mice to find the underwater platform was recorded (i.e., the escape latency). If the mice did not find the platform within 60 seconds, it was recorded as 60 seconds. On the sixth day, the platform was removed, and the mice were placed in the water from the first quadrant facing the pool wall, and the number of times the mice crossed the third quadrant was recorded.

[0051] Results Figure 3 and 4 .Depend on Figure 3 and 4 It can be seen that compared with the blank group mice, the escape latency of the control group mice was significantly increased, and the number of crossing the target quadrant was significantly decreased. The intervention of N21116 and BAA-835 can significantly shorten the escape latency and increase the number of crossing the target quadrant, but the intervention effect of N21116 is more obvious, indicating that the intervention of N21116 can restore the learning and cognitive impairment of mice.

[0052] Example 3

[0053] The experimental mice in Example 2 were dissected at the 8th week, and the hippocampal tissues of the mice were collected, immediately frozen in liquid nitrogen, and then transferred to -80°C for storage. Weigh 0.02 g of tissue, and use the Trizol method to extract total RNA from brain and hippocampal tissues according to the instructions of R001 BetterZolReagent reagent (Beijing Jinbaite Biotechnology Co., Ltd.). cDNA synthesis was performed according to the reverse transcription kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). Reference qPCR primers (doi: 10.1007 / s10126-022-10192-2) qPCR primers (see Table 1), using relative C T (△△C T ) method to detect the expression of target genes. qPCR reaction was performed in QuantStudioTM System, and the fluorescence quantitative program was as follows: amplification curve: 94℃30s, 94℃15s, 58℃30s, 40 cycles; melting curve: 95℃15s, 60℃1min, 95℃15s. The housekeeping gene β-actin was used as the internal reference, and 2 ﹣△△Ct The target gene was quantitatively analyzed.

[0054] Table 1 Fluorescence quantitative primers

[0055] Primer name Sequence information (5'-3') BDNFF AGAGCTGTTGGATGAGGACCAG(SEQ ID NO:1) BDNFR CAAAGGCACTTGACTACTGAGCA(SEQ ID NO:2) β-actinF GGCTGTATTCCCCTCCATCG(SEQ ID NO:3) β-actinR CCAGTTGGTAACAATGCCATGT(SEQ ID NO:4)

[0056] Results Figure 5 .Depend on Figure 5 It can be seen that the expression level of BDNF in the hippocampus of the control group mice was significantly lower than that of the blank group, the expression level of BDNF in the BAA-835 intervention group was improved, and the expression level of BDNF in the N21116 intervention group was significantly increased, indicating that N21116 intervention can effectively restore the expression of BDNF in the hippocampus. At the same time, the expression of BDNF in the hippocampus was positively correlated with the exploration ability in the open field test and the learning and cognitive ability of the water maze test reaction.

[0057] From the results of the above examples, it can be seen that Akkermansia guangxiensis can effectively improve autonomous exploration ability and learning cognitive ability, increase the expression level of BDNF in the hippocampus, and is expected to develop functional products for improving Alzheimer's disease.

[0058] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of Akkermansia guangxiensis or a probiotic comprising Akkermansia guangxiensis in the preparation of a medicament for preventing and / or treating Alzheimer's disease.

2. The application according to claim 1, characterized in that: The Guangxi Akkermansia includes the Guangxi Akkermansia strain N21116; The deposit number of the Guangxi Akkermansia strain N21116 is GDMCC No: 62888.

3. The use according to claim 1 or 2, characterized in that: The Guangxi Akkermansia includes the following forms: bacterial body, bacterial suspension and fermentation liquid.

4. The use according to claim 1, characterized in that: The dosage form of the probiotic containing Akkermansia guangxi includes at least one of the following solutions, freeze-dried powders, capsules, tablets and granules.

5. The application according to claim 4, characterized in that: The preparation method of the freeze-dried powder comprises the following steps: separating bacterial bodies from fermentation liquid of Akkermansia guangxiensis, mixing the bacterial bodies with a freeze-drying protective agent, and freeze-drying to obtain the freeze-dried powder.

6. The use according to claim 5, characterized in that: The freeze-drying protective agent is 10-12% by weight of skim milk, 8%-10% by weight of trehalose, 0.5-1% by volume of sorbitol and 2%-5% by weight of vitamin C.

7. The use according to claim 5 or 6, characterized in that: The mass ratio of the bacterial cells to the freeze-drying protective agent is (1-2): (1-2).

8. The use according to claim 1, characterized in that: The manifestations of Alzheimer's disease include at least one of the following behaviors: decreased independent exploratory behavior, cognitive impairment, decreased learning ability and memory loss.

9. The use according to claim 1, characterized in that: The medicine comprises at least one of the following dosage forms: powder, tablet, capsule, oral solution and drops.

10. The use according to claim 1 or 9, characterized in that: The effective live bacterial concentration of Akkermansia guangxiensis in the drug is not less than 1×10 8 CFU / mL or 1×10 8 CFU / g.

Images