Application of Tomato SlbHLH36 Gene in Regulating Tomato Pollen Development

Abstract

The present invention belongs to the technical field of plant genetic engineering, and specifically relates to SlbHLH36 the application of a gene in regulating tomato pollen development. The present invention uses a gene editing technology based on the CRISPR-Cas9 system to obtain SlbHLH36 a transgenic tomato plant with a gene mutation slbhlh36-cr , where protein translation is prematurely terminated, resulting in a significant reduction in the content of L-proline in anthers, leading to pollen malformation and abortion; in the overexpressing plants SlbHLH36-OE the content of L-proline in anthers is increased, and pollen development is normal, further verifying SlbHLH36 the key role of the gene in regulating pollen development. The present invention not only provides new ideas and experimental basis for the study of the molecular mechanism of tomato pollen development, but also provides important technical means and theoretical support for creating tomato male sterile lines using gene editing technology, and has important breeding application value.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and particularly relates to tomatoes SlbHLH36 The application of genes in regulating tomato pollen development. Background Art

[0002] Tomato ( Solanum lycopersicum L . ) is an annual herbaceous plant of the Solanaceae family. It is a widely popular fruit and vegetable crop globally and plays an important role in the diet with its unique flavor and rich nutrition. Its genome is relatively simple, and it has rich genetic variations and a mature genetic transformation system, making it an important model plant for plant biology research. During the entire growth and development process of tomatoes, pollen development is crucial as it directly determines whether tomatoes can successfully complete pollination and fertilization, thereby affecting fruit formation and yield. Therefore, it is of great significance to identify genes regulating pollen development in tomatoes and deeply analyze the molecular mechanism of tomato pollen development regulation.

[0003] L-proline plays a key role in plant pollen development. The accumulation of L-proline in pollen is closely related to pollen fertility. L-proline is not only an energy source for pollen development but also provides necessary osmoregulatory substances for pollen tube elongation. It has also been found in plants such as rice and Arabidopsis that abnormal expression of genes related to L-proline metabolism (such as P5CS, ProDH, etc.) affects pollen development and function.

[0004] In view of this, identifying genes regulating pollen development in tomatoes can provide a new theoretical basis for analyzing the molecular mechanism of tomato pollen development, lay a foundation for further studying the effect of L-proline on plant fertility, and also provide important gene resources and technical means for the creation of tomato male sterile lines. Summary of the Invention

[0005] The object of the present invention is to use the L-proline content as a metabolic phenotype and combine genome-wide association analysis to locate a gene or protein capable of regulating tomato pollen development for application in tomato molecular breeding.

[0006] Based on the above object, the present invention provides the following technical solutions:

[0007] The first aspect of the present invention provides the application of the protein SlbHLH36 in increasing the pollen malformation rate of plants, and the protein is any one of the following:

[0008] A1) A protein with an amino acid sequence of SEQ ID No.2;

[0009] A2) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in A1).

[0010] In the second aspect of the present invention, there is provided the use of a gene encoding the above-mentioned protein SlbHLH36 in the preparation of a plant with an increased pollen malformation rate.

[0011] In the third aspect of the present invention, there is provided the use of a gene encoding the above-mentioned protein SlbHLH36 in the preparation of a male sterile plant.

[0012] In the examples, the technical personnel of the present invention used the PCR technology to amplify the CDS sequence of the gene encoding the above-mentioned protein SlbHLH36 from tomato cDNA, as shown in SEQ ID NO. 1.

[0013] In the fourth aspect of the present invention, there is provided a method for cultivating a plant with an increased pollen malformation rate or male sterility. By means of gene editing, the SlbHLH36 gene in the plant is weakened or knocked out, and the SlbHLH36 CDS sequence of the gene is as shown in SEQ ID NO. 1. The specific operation steps are as follows:

[0014] (1) Using the SlbHLH36 gene as the target gene, design a sgRNA sequence based on CRISPR / Cas9, and the nucleotide sequence of the sgRNA action site is 5'-CAAGCTTCCATGATGAACC-3';

[0015] (2) Connect the DNA fragment containing the encoding sgRNA sequence to the vector carrying CRISPR / Cas9;

[0016] (3) Transfer the vector into the plant to obtain a SlbHLH36 plant with a loss-of-function of the gene.

[0017] In the examples, the technical personnel of the present invention constructed an overexpression vector SlbHLH36-OE and a CRISPR-Cas9 vector and both were genetically transformed. SlbHLH36 The transgenic tomato plants with gene mutations slbhlh36-cr , where protein translation terminated prematurely, and the content of L-proline in the anthers decreased significantly, resulting in malformed and aborted pollen; in the overexpression plants SlbHLH36-OE , the content of L-proline in the anthers increased, and pollen development was normal. Through semi-thin section observation, stamen staining, scanning electron microscopy observation of pollen, and pollen germination experiments, it was proved that slbhlh36-cr the pollen grains in the material were shrunken, the activity decreased, and the fertility weakened. SlbHLH36-OE The pollen was not significantly different from that of the wild type.

[0018] The fifth aspect of the present invention provides a plant breeding method, which includes the following steps: reducing the content of the above-mentioned protein SlbHLH36 in the target plant, resulting in a significant decrease in the content of L-proline in the anthers, thereby increasing the malformation rate of plant pollen or making the plant male sterile.

[0019] Any of the above-mentioned plants may be a plant of the genus Solanum lycopersicum.

[0020] Advantages of the present invention:

[0021] With the content of L-proline as a metabolic trait and combined with genome-wide association analysis, the present invention locates in the tomato genome SlbHLH36 genes, and finds that they affect the content of L-proline in tomato anthers and are involved in pollen development. By studying the effect of L-proline on tomato fertility, it can provide a scientific basis for increasing tomato yield, improving fruit quality, and enhancing stress resistance, such as developing practical agricultural technologies based on L-proline foliar fertilizers or growth regulators to solve the problem of yield loss caused by low pollen fertility. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Localization of genes related to L-proline (L-Pro): Figure 1 In A, it is a GWAS result graph associated with the content of L-proline, and the red dotted line represents the significance threshold (P = 6.87E-7); Figure 1 In B, it is SlbHLH36 ( Solyc05g006650 ) LD linkage heat map analysis.

[0023] Figure 2 For SlbHLH36 tissue expression profile analysis: Figure 2 In A, it shows that SlbHLH36 is expressed in roots, stems, leaves, flowers and fruits, and has the highest expression level in flowers; Figure 2 In B, GUS staining shows SlbHLH36 the tissue expression pattern in flowers, scale bar = 25 μm.

[0024] Figure 3 For overexpression plants SlbHLH36-OE and gene-edited plants slbhlh36-cr material construction: Figure 3 In A, it is SlbHLH36 the position of gene editing and the resulting mutation types; Figure 3 In B, it is the wild-type plant WT, overexpression plant SlbHLH36-OE and gene-edited plant slbhlh36-cr in SlbHLH36 relative expression levels; using Student t test to compare genotypes: ****, P < 0.0001.

[0025] Figure 4 were the wild-type plants WT, overexpression plants SlbHLH36-OE and gene-edited plants slbhlh36-cr in terms of L-proline content and pollen development phenotypes. Figure 4 In [reference], A was the L-proline content in the pollen of different transgenic materials; Figure 4 In [reference], B-D were the flowering phenotypes of the wild-type plants WT, overexpression plants SlbHLH36-OE and gene-edited plants slbhlh36-cr during normal growth; Figure 4 In [reference], E-G were the wild-type plants WT, overexpression plants SlbHLH36-OE and gene-edited plants slbhlh36- cr in the semi-thin section images of anthers, showing the anther development phenotypes, scale bar = 50 μm; Figure 4 In [reference], H-J were the scanning electron microscope (TEM) images of the pollen structural characteristics of the wild-type plants WT, overexpression plants SlbHLH36-OE and gene-edited plants slbhlh36-cr scale bar = 10 μm; Figure 4 In [reference], K-M were the pollen germination phenotypes of the wild-type plants WT, overexpression plants SlbHLH36-OE and gene-edited plants slbhlh36-cr scale bar = 100 μm; Student's t test was used to compare genotypes: ****, P < 0.0001.

[0026] Figure 5 was the entry vector pDonr207- SlbHLH36 required for constructing the SlbHLH36 gene using the Gateway system.

[0027] Figure 6 was the plasmid map of the GUS staining vector pJC029-pHGWFS7- SlbHLH36 -Pro.

[0028] Figure 7 was the plasmid map of the overexpression vector PBI121- SlbHLH36 .

[0029] Figure 8 was the plasmid map of the CRISPR-Cas9 vector pTX041- SlbHLH36 . Specific implementation manners

[0030] The following examples define the present invention and describe the present invention in the isolation and cloning of SlbHLH36DNA fragments of the complete coding region of the gene were obtained through genetic transformation to generate gene-edited and overexpressing plants, and it was verified that SlbHLH36 regulated the accumulation of L-proline in pollen. Subsequently, through amino acid content detection, semi-thin section observation of anthers, stamen staining, pollen scanning electron microscopy observation, and pollen germination experiments, it was verified that SlbHLH36 the mutation would cause a significant decrease in L-proline content, pollen shrinkage and malformation, reduced fertility, and affect pollen development. Based on the following descriptions and these examples, those skilled in the art can determine the basic features of the present invention, and without departing from the spirit and scope of the present invention, various changes and modifications can be made to the present invention to adapt it to different uses and conditions. The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all obtained from commercial channels unless otherwise specified.

[0031] By means of a genome-wide association study (mGWAS), the tomato SlbHLH36 gene was mapped, and by overexpressing SlbHLH36-OE and CRISPR-Cas9 editing expression in tomato plants slbhlh36-cr , it was found that after the SlbHLH36 gene mutation in tomato, the accumulation of L-proline in anthers was significantly reduced, pollen shrank, and fertility decreased, confirming the application of this gene in regulating tomato pollen development.

[0032] Example 1: SlbHLH36 Discovery and mapping of

[0033] The technical personnel of the present invention measured the metabolic profiles of 398 tomato materials from all over the world, statistically analyzed the measurement data, and selected varieties with significant differences in L-proline biosynthesis for genome-wide association analysis. The results showed that there was a significant association between L-proline content and a loci on chromosome 5 ( Figure 1 A in Figure 1 ), and the SNPs near the lead SNP locus were in a region of high linkage disequilibrium (LD) ( Figure 1 B in SlbHLH36 ), indicating that there were candidate genes regulating L-proline in this region. Among these genes, the technical personnel of the present invention found SlbHLH36 ( Solyc05g006650 ), and speculated that the SlbHLH36 gene might affect the L-proline content ( Figure 1 A in

[0034] Example 2: SlbHLH36 Isolation, cloning and expression pattern analysis

[0035] For SlbHLH36For tissue expression profile analysis, total RNA was extracted from the roots, stems, leaves, flowers, green-ripe fruits, and red-ripe fruits of normally growing tomatoes using TRIzol reagent (purchased from Invitrogen). The RNA was reverse transcribed into cDNA using the reverse transcription kit ToloScript All-in-one RT EasyMix for qPCR (purchased from Shanghai Tulugang Biotechnology Co., Ltd.). qPCR detection was performed using 2xQ3 SYBR qPCR Master mix (Universal) (purchased from Shanghai Tulugang Biotechnology Co., Ltd.). SlbHLH36 Expression levels were measured using primers SlbHLH36 -qF: AGTTTCCACTAGCGGCAATG and SlbHLH36 -qR: AGGCTTTGCAGGTTGTTCTG, and it was found that SlbHLH36 it was expressed in roots, stems, leaves, flowers, and fruits, with the highest expression level in flowers ( Figure 2 A in ).

[0036] SlbHLH36 For the promoter sequence, tomato DNA was used as a template, SlbHLH36 and the gene promoter sequence is shown in SEQ ID NO.3. The DNA extraction method was as follows: Take about 1 cm 2 of leaves, and extract DNA by the CTAB method. First, heat and extract with 1.5×CTAB extraction solution, add chloroform and isoamyl alcohol to separate the organic phase, then precipitate DNA with absolute ethanol, wash with 75% ethanol, and dissolve with ddH2O to obtain a DNA solution; Use primers SlbHLH36 -Pro-F: AAAAAGCAGGCTTATGAATTCATATTCGTTCGATGTG, SlbHLH36 -Pro-R: AGAAAGCTGGGTACGGAGGGTCCAGTTACAGCT for PCR amplification. PCR reaction conditions: Pre-denaturation at 94°C for 5 min; Denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 1 min, 35 cycles; Final extension at 72°C for 5 min. After agarose gel electrophoresis, the fragment was recovered.

[0037] Through the Gateway system, the SlbHLH36 promoter sequence was constructed into pJC29-pHGWFS7 ( Figure 6), construct GUS transgenic materials by Agrobacterium-mediated leaf disc transformation method. Prepare x-Gluc staining solution (Solarbio, G3061) according to the instructions. Take tissues such as leaves to be stained and add an appropriate amount of staining solution to completely immerse the tissues in the GUS staining solution. Incubate at 37 °C for 24 h. The parts or sites with GUS activity will show blue or blue spots. Subsequently, remove the chlorophyll of the samples with 70% ethanol. Store the samples in ethanol and observe with the naked eye or an ordinary optical microscope for GUS staining analysis. SlbHLH36 The highest expression level is in flowers ( Figure 2 B in).

[0038] Example 3: Construction SlbHLH36 Overexpression and gene editing vectors

[0039] Using the cDNA in Example 2 as a template, use primers SlbHLH36 -F: AAAAAGCAGGCTTAATGGATCCACAAGCTTCCATGATG and SlbHLH36 -R: AGAAAGCTGGGTATTATGTTGTTCTTTCAAAGCCTCCACC for PCR amplification to obtain SlbHLH36 the CDS sequence of the gene. PCR reaction conditions: pre-denaturation at 94 °C for 5 min; denaturation at 98 °C for 10 sec, annealing at 60 °C for 30 sec, extension at 68 °C for 2 min, 35 cycles; final extension at 68 °C for 5 min. Connect the amplified PCR product into the pDonr207 entry vector through the BP reaction of Gateway cloning technology, transform Escherichia coli DH5α competent cells, and verify by colony PCR to obtain positive clones. Sequence to obtain the correct clones without mutations containing the candidate gene (Haikou Qingke Biotechnology Company). Subsequently, through the LR reaction of Gateway cloning technology, connect pDonr207- SlbHLH36 ( Figure 5 ) into the final vector PBI121 ( Figure 7 ).

[0040] At the same time, construct a gene editing slbhlh36-cr vector ( Figure 8). First, search for the target site in the exon region of the reference genome sequence. The target site sequence is: 5’-CAAGCTTCCATGATGAACC-3’. Design primers for the selected target site. The forward primer is the first 19-base sequence 19-nt N before PAM (NGG), and the reverse primer is the reverse complement of the first 19-nt N before the target site. Then, use pCBC-DT1T2 as a template for fragment amplification. The target gene identification band is 568 bp. Use Bsa Ⅰ-HFv2 and T4 ligase to perform digestion and ligation simultaneously (Golden Gate method) on the obtained 100 ng PCR product and 50 ng pTX041. The total reaction system is 15 μL. Then, transfer the reaction product into Escherichia coli DH5α. Finally, use primers pTX41-F: AGCGGATAACAATTTCACACAGGA and pTX41-R: GCAGGCATGCAAGCTTATTGG for identification: the band size is 1198 bp, and sequence with pTX41-F.

[0041] Example 4: SlbHLH36 Genetic transformation of gene editing vector and overexpression vector

[0042] Introduce it into the tomato variety MicroTom through the Agrobacterium-mediated tomato genetic transformation system. After pre-culture, infection, co-culture, screening for kanamycin-resistant callus, differentiation, rooting, transplanting, and identification, transgenic plants are obtained. The genetic transformation is carried out by Wuhan Boyuan Biotechnology Co., Ltd.

[0043] Specific steps for positive identification of gene editing transgenic materials are as follows: (1) DNA extraction: Cut a leaf about 1 cm 2 in size, and extract DNA by the CTAB method in Example 2. Then, perform agarose gel electrophoresis. After there is a band, send it to Haikou Qingke Biotechnology Company for sequencing. Compare the sequencing results with the reference genome. Insertion, deletion, or mutation at the target site indicates successful editing ( Figure 3 A in

[0044] Identification of overexpression transgenic materials: For the extracted DNA, use primers NPTⅡ-F: GGTGCCCTGAATGAACTCC, NPTⅡ-R: AATATCACGGGTAGCCAACG of the screening marker gene NPTⅡ to amplify the fragment. If there is a band in agarose gel electrophoresis, it indicates that the vector has been transferred; then, perform transcriptional level detection. Extract total plant RNA and perform reverse transcription. Use the RNA extraction, reverse transcription, and qPCR in Example 1 to measure the expression level change. Use the real-time fluorescence quantitative PCR software Quant studio TM, with the tomato Ubiquitin3 gene as an internal reference, and the primer sequences for detection are SlUBI-qRT-F: GCCAAAGAAGATCAAGCACA, SlUBI -qRT-R: TCAGCATTAGGGCACTCCTT, and the relative expression levels in transgenic plants were calculated using the ΔΔCt method. A significant upregulation of the expression level indicates the successful generation of overexpressing plants, and the identification is completed ( SlbHLH36 as shown in B of Figure 3 ).

[0045] Example 5: slbhlh36-cr and SlbHLH36-OE Metabolite Detection and Pollen Phenotype Analysis of Transgenic Materials

[0046] LC-MS targeted metabolite analysis was performed on the anthers of wild-type (WT) bHLH36-OE , bhlh36-cr mutants, and it was found that the content of L-proline was significantly increased in the overexpressing lines, while it was significantly decreased in the mutants ( Figure 4 as shown in A of SlbHLH36 ). The expression of

[0047] is crucial for tomato pollen morphogenesis and male fertility development, and it may be involved in regulating the accumulation of L-proline in tomato anthers. The extraction and detection methods of amino acids were carried out according to the following protocol:

[0048] By observing the phenotypes of transgenic materials and wild-type pollen, the methods including semi-thin section observation and stamen staining, scanning electron microscopy observation of pollen, and pollen germination analysis, it was found that slbhlh36-cr the anthers of the mutant were significantly smaller ( Figure 4 B in Figure 4 C in Figure 4 D in Figure 4 E in Figure 4 F in Figure 4 G in slbhlh36-cr ), semi-thin section showed that a large number of pollen grains collapsed ( Figure 4 H in Figure 4 I in Figure 4 J in Figure 4 K in Figure 4 L in Figure 4 M in SlbHLH36-OE ), scanning electron microscopy further confirmed that SlbHLH36 the frequency of deformed and / or collapsed pollen grains in the mutant was higher (

[0049] The specific experimental operations are as follows:

[0050] Semi-thin section observation and stamen staining: Take the inflorescences of wild-type (WT), bHLH36-OE , bhlh36-cr and transgenic plants, and fix them in FAA solution (50% ethanol: 38% formaldehyde: acetic acid = 18:1:1). After dehydration of the samples in gradients of 70%, 95% and 100% ethanol, they were embedded in Technovit resin, and the section thickness was 0.2 - 0.6 μm. After staining the sections with toluidine blue, they were observed and photographed using an AxioScope A1 microscope (Zeiss, Germany).

[0051] Scanning electron microscopy observation: Take the pollen of wild-type (WT), bHLH36-OE , bhlh36-cr and transgenic plants, evenly adhere it to the conductive tape, and take high-resolution images using a Verios G4 UC scanning electron microscope (Thermo Scientific, USA).

[0052] Pollen germination analysis: Take the pollen of wild-type (WT), bHLH36-OE , bhlh36-cr and transgenic plants, inoculate it on a low melting point agar medium containing 5 mM Ca²⁺, observe the pollen germination after culturing at 25°C for 6 h, and conduct statistical analysis of the germination rate.

[0053] The present invention has been described in detail above. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0054] The term "protein" is used interchangeably herein to mean a polymer of amino acid residues. The term applies to both naturally occurring amino acid polymers and amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked by covalent peptide bonds.

[0055] The term "transformation" refers to a method of introducing a heterologous DNA sequence into a host cell or organism.

[0056] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0057] For those skilled in the art, without departing from the spirit and scope of the present invention and without unnecessary experiments, the present invention can be practiced within a wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In general, according to the principles of the present invention, this application intends to cover any modifications, uses, or improvements of the present invention, including those that depart from the scope disclosed in this application but are made by conventional techniques known in the art.

Claims

1. Use of protein SlbHLH36 in increasing the pollen malformation rate of plants, characterized in that, The protein satisfies the following conditions: A1) The protein with the amino acid sequence of SEQ ID No.2; A2) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in A1); The plant is a plant of the genus Solanum.

2. Use of the gene encoding the protein SlbHLH36 in the preparation of a transgenic plant with an increased pollen malformation rate; the protein SlbHLH36 is the protein SlbHLH36 described in claim 1; the plant is a plant of the genus Solanum.

3. The application according to claim 2, characterized in that, The CDS sequence of the gene encoding the protein SlbHLH36 is as shown in SEQ ID NO.

1.

4. Use of the gene encoding the protein SlbHLH36 in the preparation of a transgenic plant with male sterility; the protein SlbHLH36 is the protein SlbHLH36 described in claim 1; the plant is a plant of the genus Solanum.

5. The application according to claim 4, characterized in that The CDS sequence of the gene encoding the protein SlbHLH36 is as shown in SEQ ID NO.

1.

6. A method for cultivating a transgenic plant with an increased pollen malformation rate or male sterility, characterized in that, By means of gene editing, weaken or knockout the SlbHLH36 gene in plants to obtain plants with increased pollen malformation rate or male sterility; the SlbHLH36 CDS sequence of the gene is as shown in SEQ ID NO. 1; the plant is a plant of the genus Solanum.

7. The method according to claim 6, wherein The method comprises the following steps: Using SlbHLH36 the gene as the target gene, design the sgRNA sequence based on CRISPR / Cas9; Connect the DNA fragment containing the encoding sgRNA sequence to the vector carrying CRISPR / Cas9; Transfer the vector into a plant to obtain SlbHLH36 a plant with a gene function deficiency.

8. The method according to claim 7, wherein The nucleotide sequence of the sgRNA action site is 5’-CAAGCTTCCATGATGAACC-3’.

9. A plant breeding method, characterized in that, Comprising the following steps: reducing the content of the protein SlbHLH36 in the target plant, so as to increase the pollen malformation rate of the plant; the protein SlbHLH36 is the protein SlbHLH36 described in claim 1; the plant is a plant of the genus Solanum.

10. A plant breeding method, characterized in that, Comprising the following steps: reducing the content of the protein SlbHLH36 in the target plant, so as to make the plant male sterile; the protein SlbHLH36 is the protein SlbHLH36 described in claim 1; the plant is a plant of the genus Solanum.

Images