Construction and application of novel double-target T cell receptor fusion construct (TRuC)-T cell added with 4-1BB costimulatory structural domain

Abstract

The invention discloses a construction method and application of a double-target TRuC-T cell which is added with a 4-1BB costimulatory structural domain and aims at multiple myeloma BCMA / CS1 and breast cancer Nectin-4 / B7-H3. According to the invention, a dual-targeting expression framework is constructed by utilizing the action between different subunits of a natural T cell receptor (TCR)-CD3 compound. The scFvs aiming at two target spots of multiple myeloma BCMA / CS1 and breast cancer Nectin-4 / B7-H3 are integrated into different subunits of a TCR-CD3 compound, and the recognition and killing effects of natural T cells are simulated. According to the engineering T cell treatment technology, the natural regulation mechanism of the T cells is reserved, the toxic and side effects are low, and the curative effect is good and lasting.

Description

Technical Field

[0001] This patent belongs to the field of biotechnology engineering, and specifically involves the construction and application of a new dual-target T cell receptor fusion structure T (T cell receptor fusion constructs T, TRuC-T) cell containing a 4-1BB co-stimulatory domain, targeting two targets of multiple myeloma BCMA / CS1 and two targets of breast cancer Nectin-4 / B7-H3. The scFvs molecules targeting the two targets of BCMA / CS1 or Nectin-4 / B7-H3 are integrated into different subunits of the T cell receptor (TCR)-CD3 complex, and the natural TCR-CD3 signal transduction system is used to exert a specific killing effect. Background Art

[0002] Chimeric antigen receptor T (CAR-T) cell therapy can reprogram the host's immune system to attack tumor cells in a manner that is independent of human leukocyte antigen (HLA) presentation. CAR is a chimeric protein obtained through genetic engineering technology, which mainly consists of three parts: an extracellular antigen recognition domain (such as a single-chain variable fragment (scFv) of a monoclonal antibody), a hinge region, a CD8 transmembrane domain, and an intracellular signal transduction domain (including a CD3ζ chain and zero (first-generation CAR) or one (second-generation and fourth-generation CAR) or two (third-generation CAR) co-stimulatory molecules, such as CD28, 4-1BB). Severe cytokine release syndrome (CRS) and / or neurotoxicity (ICANS) mediated by proinflammatory cytokines after CAR-T cell activation are the current challenges facing CAR-T therapy.

[0003] The TCR-CD3 complex is mainly composed of a peptide-MHC ligand binding domain composed of a TCRα chain and a TCRβ chain, and a CD3 signaling domain. The CD3 signaling domain mainly includes dimers of CD3ε and CD3γ, dimers of CD3ε and CD3δ, and CD3ζ homodimers. TRuC-T cells are T cells that are directed to target cells in an MHC-independent manner by genetically engineering the natural TCR-CD3 complex and utilizing the complete signal transduction mechanism of the TCR-CD3 complex. TRuC-T cells show superior anti-tumor activity than CAR-T, accompanied by lower levels of cytokine release.

[0004] Due to the heterogeneity of tumors, single-target CAR-T cannot completely eliminate tumors. In order to reduce the recurrence rate of tumors after CAR-T cell therapy, current strategies often develop CAR-T cells targeting multiple antigens.

[0005] The full activation of T cells requires the participation of a dual signal system. In addition to the initial binding of the T cell receptor to the MHC-peptide complex, it must also receive a co-stimulatory signal. Because the co-stimulatory signal can amplify the TCR signal, it can lower the TCR threshold for cross-linking with the MHC-peptide complex. The lack of co-stimulatory signals is one of the important reasons why tumor cells evade the surveillance of the body's immune system.

[0006] Therefore, the present invention constructs a dual-target TRuC structure for tumors, and the structure contains a 4-1BB co-stimulatory domain, thereby providing a new strategy for the effective treatment of blood tumors (such as multiple myeloma) and solid tumors (such as breast cancer). Summary of the invention

[0007] The present invention provides a construction method and application of dual-target TRuC-T cells based on the problem of antigen escape and cytokine side effects in single-target CAR-T cell therapy for tumors. The present invention mainly involves the optimization of dual-target TRuC molecules, hoping to find the optimal structure (taking the two targets BCMA / CS1 for multiple myeloma and Nectin-4 / B7-H3 for breast cancer as examples).

[0008] Based on the fact that full activation of T cells requires at least two signals, the present invention constructs a novel dual-target TRuC-T cell containing a 4-1BB costimulatory domain.

[0009] Lentiviral expression vectors of anti-BCMA / CS1 and anti-Nectin-4 / B7-H3 were constructed by genetic engineering technology and then transduced into activated T cells. After five days of culture, the expression of dual-target TRuC molecules was detected by flow cytometry; the in vitro killing effect of anti-BCMA / CS1 and anti-Nectin-4 / B7-H3 cells on BCMA / CS1 and Nectin-4 / B7-H3 positive cells was verified in vitro; and the efficacy of the NSG mouse model of human transplanted tumors (such as multiple myeloma and breast cancer) was tested.

[0010] Compared with the prior art, the present invention has the following advantages.

[0011] 1. The dual-target TRuC molecule design scheme involved in the present invention is to use a linker to connect two scFvs molecules to two different subunits of the TCR-CD3 complex and co-express the dual-target TRuC molecule through a 2A connecting peptide. Utilizing the natural regulatory mechanism of TCR-CD3, it has low toxicity and side effects, good and long-lasting efficacy.

[0012] Second, the dual-target TRuC-T cells used in the present invention can effectively identify tumor cells, thereby reducing the immune escape phenomenon during the treatment of multiple myeloma or breast cancer. Among them, the killing effect of B-3G-C-3E and N-3G-B-3E dual-target TRuC-T cells is better than that of B-3D-C-3E and N-3D-B-3E dual-target TRuC-T cells.

[0013] 3. The present invention comprises a 4-1BB co-stimulatory domain, which adds a second signal to TRuC-T cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a schematic diagram of the lentiviral vector plasmid structure of the dual-target TRuC molecule involved in the patent of this invention. Flow cytometry was used to detect the expression of dual-target TRuC molecules on the surface of T cells, including anti-BCMA&CS1 and anti-Nectin-4 / B7-H3.

[0015] Figure 2 Flow cytometry was used to detect the expression of dual-target TRuC molecules on the surface of T cells, including anti-BCMA&CS1.

[0016] Figure 3 Flow cytometry was used to detect the expression of dual-target TRuC molecules on the surface of T cells, anti-Nectin-4 / B7-H3.

[0017] Figure 4 This is the detection of the in vitro killing activity of anti-BCMA&CS1 dual-target TRuC-T cells on BCMA / CS1 positive cells involved in the patent of this invention.

[0018] Figure 5 It is the detection of the in vitro killing activity of anti-Nectin-4 / B7-H3 dual-target TRuC-T cells against Nectin-4 / B7-H3 positive cells

[0019] Figure 6 This patent of the present invention involves the efficacy evaluation of the anti-BCMA&CS1 dual-target TRuC-T cells on the human multiple myeloma NSG mouse model.

[0020] Figure 7 The patent of this invention involves the efficacy of anti-Nectin-4 / B7-H3 dual-target TRuC-T cells on the breast cancer NSG mouse model. DETAILED DESCRIPTION

[0021] The following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods without specific conditions in this example are generally carried out under conventional conditions.

[0022] Example 1: Construction of a recombinant lentiviral vector (taking the B-3G-C-3E dual-target TRuC structure as an example).

[0023] Main experimental materials: EcoRI-HF and PmeI-HF restriction endonucleases were purchased from NEB; primers were synthesized by Jiangsu Jinweizhi Biotechnology Co., Ltd.; seamless cloning enzyme was purchased from Heyuan Biotechnology; high-fidelity Prime GXL STAR enzyme was purchased from TAKARA; TransStbl3 competent cells were purchased from Quanshijin Biotechnology Co., Ltd.; small-scale plasmid extraction kit was purchased from OMEGA; large-scale plasmid extraction kit was purchased from QIAGEN. NaCl, yeast powder, peptone, EDTA, NaOH and other chemical reagents were purchased from Shanghai Sangon Biotechnology Co., Ltd. NSG mice were purchased from Nanjing Jicui Yaokang Biotechnology Co., Ltd. Sanger sequencing services were provided by Shanghai Sunny Biotechnology Co., Ltd.

[0024] The B-3G-C-3E TRuC sequence was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The plenti-EF1a-MCS vector was double-digested with EcoRI-HF and PmeI-HF. The reaction conditions were 37℃2h, 65℃20min, and the enzyme digestion system was shown in Table (1). The target fragment PCR (primers are shown in Table (2)), and the reaction system is shown in Table (3).

[0025] Reagents volume EcoRI-HF 1μl PmeI-HF 1μl 10×cutsmart 2μl Vector plasmid 3μl ddH2O 13μl Total volume 20μl Table (1): Restriction enzyme digestion system.

[0026] Primers: Primers are designed according to primer design principles to amplify the target DNA fragment.

[0027] primer F TAGCCCCGGGGAATTCGCCACCATGGCCCTGCCTGTCACC primer R AGAGGTTGATTGTTTAAACTCAGATGCGTCTCTGATTCAG Table (2) Primer sequences.

[0028] Reagents volume GXL buffer 5× 5μl dNTP 2μl Prime GXL STAR 1μl template 1μl Primer F (100 μM) 0.1μl Primer R (100 μM) 0.1μl <![CDATA[ddH2O]]> 15.8μl Total volume 25μl Table (3): PCR system.

[0029] The synthetic fragment B-3G-C-3E was amplified using primers primer F and primer R. The amplification conditions were (98°C: 10s, 60°C: 15s, 68°C: 1kb / min)*35 cycles. The amplification system is shown in Table (3). The target fragment was obtained using 1% agarose gel, and then the target fragment was recovered using the XYGENE gel recovery kit (operation steps are shown in Table (4)), and the concentration and purity were tested. The vector and target fragment were connected by seamless cloning (system see Table (5)), and then plasmid transformation was performed (after the seamless cloning product was placed on ice for 5 minutes, it was transferred into 100μl TransStbl3 competent medium, placed on ice for 30 minutes, 42℃ for 45 seconds, and then on ice for 5 minutes, 500μl LB was added, and activated in a shaker at 37℃, 225rpm / min for 1 hour, and then centrifuged at 5000rpm / min at 20℃ for 5 minutes, the supernatant was discarded, the remaining bacterial solution was mixed and plated, and cultured at 37℃ for 12-14 hours), single clone colonies were picked for bacterial solution amplification at 37℃, 250rpm / min, 12h-14h, plasmid extraction, enzyme digestion identification and Sanger sequencing. The schematic diagram of the plasmid is shown in Figure 1 one.

[0030] Sol Add 3 times the volume of DE-A (100 mg = 100 μl) to the EP tube containing glue, and then incubate at 65°C for 5-10 minutes. Binding to DNA After the gel melted, add 0.5 times the volume of DE-A to DE-B, mix well, add the mixture to the nucleic acid binding column, and centrifuge at 12000 xg for 1 min. Washing membrane <![CDATA[Add 500 μl of W1 and centrifuge to wash the membrane at 12,000 g for 30 s]]> Membrane washing (desalting) <![CDATA[Add 700 μl of W2 and centrifuge the membrane at 12,000 g for 30 s to wash the membrane]]> Membrane washing (desalting) Repeat step 4 Dry 12000g, 1min centrifugal drying Elution Elute DNA with 26 μl of elution buffer Table (4): Glue recovery steps.

[0031] Reagents volume Seamless cloning buffer 5× 4μl Seamless cloning enzyme 2μl Vector fragment 1μl Purpose fragment 2μl ddH2O 11μl Total volume 20μl Table (5): Seamless cloning system.

[0032] Example 2: Preparation of lentivirus and titer detection.

[0033] 1) Take out HEK293T cells from the 37°C, 5% CO2 incubator and observe the cell status. When the cell density is 70%-80%, lentiviral packaging can be performed.

[0034] 2) Prepare opti-MEM complete medium in advance, prepare a 50 ml sterile centrifuge tube, add 20 ml opti-MEM complete medium, and place it in a 37°C incubator to incubate.

[0035] 3) Prepare two 1.5ml EP tubes, labelled a and b. Add 500μl DPBS to tubes a and b respectively, add 60μl PEI to tube a, add 20μl of target plasmid (B-3G-C-3E lentiviral vector plasmid), PLP1, PLP2, and PMD2G to tube b, and let stand at room temperature for 15 minutes.

[0036] 4) Slightly mix the liquid in tube a and transfer it to tube b. Let it stand at room temperature for 20 minutes.

[0037] 5) Use a negative pressure aspirator to discard the supernatant of the culture medium, and use a 10 ml pipette to slowly add 20 ml of opti-MEM complete culture medium along the side wall of the culture dish.

[0038] 6) After 20 minutes, add the liquid in tube b along the side wall into the HEK293T cells that have been replaced with culture medium.

[0039] 7) Place in a 37°C, 5% CO2 incubator for culture.

[0040] 8) After 48 hours, collect the supernatant into a 50 ml centrifuge tube and store at 4°C. Add 20 ml of PT-MEM complete medium into the culture dish.

[0041] 9) After 72 hours, collect the supernatant again and mix it with the supernatant collected at 48 hours. Centrifuge at 2500rpm and 4℃ for 10 minutes. Filter the supernatant with a 0.45μm MILLEX®-HP needle filter. Centrifuge the lentiviral stock solution at 3000g at 4℃ for 12 hours, resuspend it, and store it at -80℃ for later use.

[0042] 10) Take out the Jurkat cells from a 37°C, 5% CO2 incubator and observe the cell status under a microscope. When the cells are transparent and plump, they are suitable for transduction. Transfer the Jurkat cells to a 15ml centrifuge tube and centrifuge horizontally at 1500rpm for 5 minutes.

[0043] 11) Discard the supernatant, resuspend the cells in 1 ml of RPMI 1640 complete medium, take 10 μl of the cell suspension, dilute it with trypan blue and count under a microscope.

[0044] 12) Press 0.5×10 6 Jurkat cells were plated into 96-well cell culture plates at 10 cells / well.

[0045] 13) The lentiviral concentrate was diluted in a certain ratio and added to a 96-well cell culture plate, with 0.1 μl of polybrene added to each well.

[0046] 14) Fill each well to 200 μl with RPMI 1640 complete medium.

[0047] 15) Seal the plate with sealing film and centrifuge at 1200g and 32℃ for 90min.

[0048] 16) After centrifugation, place the culture medium in a 37°C, 5% CO2 incubator.

[0049] 17) After 4 hours, transfer the cell suspension in each well to a 12-well cell culture plate and add 1.5 ml of RPMI 1640 complete medium to each well. 18) After 48 hours of culture, detect the transduction efficiency by flow cytometry.

[0050] 19) Analyze the flow cytometry results with Flowjo software. After circling the positive cell population, calculate the lentiviral titer according to the formula T=(P*N) / (D*V). Where T=lentiviral titer (TU / ml), P=proportion of positive cells (e.g. P=0.6, indicating that positive cells account for 60%), N=total number of transduced cells (0.5×10 6 D = dilution factor, V = total volume during transduction (ml).

[0051] Example 3: Preparation of TRuC-T cells and detection of expression efficiency.

[0052] 1) Draw 15 ml of peripheral blood from a healthy person into an EDTA-K2 anticoagulant tube and prepare AIM-V complete medium in advance.

[0053] 2) Transfer peripheral blood to a 50 ml centrifuge tube and add an equal volume of DPBS to mix and dilute the blood.

[0054] 3) Take a 15 ml centrifuge tube, add Ficoll lymphocyte separation solution, and slowly add the diluted whole blood in (2) along the tube wall, taking care not to damage the separation layer.

[0055] 4) 800g, 25℃, horizontal centrifugation for 20min, with both acceleration and deceleration set to “0”.

[0056] 5) Use a 3ml extended Pasteur pipette to gently aspirate the buffy coat into a 15ml centrifuge tube, add DPBS to 12ml, pipette gently to mix, and centrifuge at 1500rpm for 5min.

[0057] 6) Discard the supernatant, resuspend in 1 ml DPBS, add 10 ml DPBS and gently pipette to mix, and centrifuge at 1500 rpm for 5 min.

[0058] 7) Discard the supernatant, resuspend in 1 ml Buffer I (DPBS containing 2% AB serum) into a 1.5 ml EP tube, take 10 μl of the single-cell suspension, dilute it with trypan blue, and count under a microscope.

[0059] 8) Determine the proportion of CD3+ T cells in PBMCs by flow cytometry.

[0060] 9) Add CD3 / CD28 Dynabeads to the cell suspension at a ratio of CD3 / CD28 Dynabeads:CD3+ T cells = 1:1, and mix on a vertical rotating shaker at 4°C for 30 min to allow the magnetic beads to fully contact the cells.

[0061] 10) After the reaction, place the cells on the magnetic stand for 2 min, remove the supernatant, resuspend the cells in AIM-V complete medium and count them.

[0062] 11) The cell suspension was diluted to 0.5×10 6 The cells were plated at a density of 100 / ml in a 96-well cell culture plate and cultured in a 37°C, 5% CO2 incubator.

[0063] 12) After T cells were activated for 24 hours, 10 μl was gently mixed and counted at 0.1×10 6 T cells / well were plated in a 96-well cell culture plate. The corresponding lentivirus was added at an MOI of 40, and 0.1 μl / well of Polybrene was added and the volume was filled to 200 μl with AIM-V complete medium. (MOI = number of virus particles / number of cells).

[0064] 13) Centrifuge at 1200 g for 90 min at 32°C.

[0065] 14) After culturing in a 37°C, 5% CO2 incubator for 4 hours, aspirate 150 μl of supernatant along the wall of the cell culture plate, then add 180 μl of AIM-V complete medium to each well and mix by gently pipetting.

[0066] 15) Culture in a 37°C, 5% CO2 incubator and expand the plate as needed according to the cell density.

[0067] 16) After 5 days of T cell culture, take an appropriate amount of cells and demagnetize them on a DynaMagTM-5 magnetic rack.

[0068] 17) Transfer the demagnetized T cells to a 96-well pointed bottom plate and collect the cells by centrifugation at 2500 rpm for 3 min.

[0069] 18) Discard the supernatant, add 200 μl FACS resuspended cells to each well, and centrifuge at 2500 rpm for 3 min.

[0070] 19) Repeat step 18).

[0071] 20) Add 50 μl FACS-diluted BCMA and CS1 recombinant proteins (volume ratio 1:100) to each well, pipette gently to mix, and incubate at 4°C in the dark for 15 min.

[0072] 21) Add 150 μl FACS stop buffer to each well and centrifuge at 2500 rpm for 3 min.

[0073] 22) Discard the supernatant, add 200 μl of FACS to each well, mix well, and centrifuge at 2500 rpm for 3 min.

[0074] 23) Discard the supernatant, resuspend each well in 200 μl FACS solution into a flow cytometer, and detect the expression rate of TRuC molecules.

[0075] Example 4: Luciferase assay to detect in vitro killing activity on target cells.

[0076] 1) When the number of T cells is sufficient, take the transduced T cells, demagnetize them on a magnetic rack, centrifuge them at 1500 rpm for 5 min, discard the supernatant, resuspend and count them in RPMI 1640 complete medium, and take an appropriate amount of T cells to detect the expression rate of TRuC molecules by flow cytometry.

[0077] 2) Take a 96-well cell culture plate and centrifuge the target cells at 1500 rpm for 5 min, then count them according to 0.01×10 6 Target cells / well were plated.

[0078] 3) Use untransduced Mock-T cells to adjust the ratio of TRuC-T cells in each group to be consistent, calculate the number of TRuC-T cells according to the expression rate of TRuC, and add the corresponding number of TRuC-T cells according to the effector-target ratio (E:T) of 1:1, 2:1 and 5:1. Set up a control group to add the same number of Mock-T cells as TRuC-T cells to detect the recognition and killing effect of dual-target TRuC T cells on tumor cells.

[0079] 4) Set the wells with only target cells and RPMI 1640 complete medium as positive control wells, as the maximum bioluminescence value; set the wells with only target cells and ddH2O as negative control wells, as the minimum bioluminescence value; the experimental wells and positive control wells are filled up to 200μl with RPMI 1640 complete medium, and the negative control wells are filled up to 200μl with ddH2O.

[0080] 5) After incubation at 37°C, 5% CO2 for 8 hours, centrifuge at 1500 rpm for 5 minutes.

[0081] 6) Discard the supernatant and wash twice with PBS (warm up at 37℃ in advance).

[0082] 7) Resuspend the cells in RPMI 1640 complete medium (containing 1:200 dilution of D-(-)-luciferin) (warm up at 37℃ in advance).

[0083] 8) Mix gently and transfer to a 96-well light-proof white ELISA plate. Incubate at room temperature in the dark for 10 minutes and use a full-wavelength ELISA reader to measure the bioluminescence value of each well.

[0084] 9) Calculate the lysis rate of the dual-target TRuC-T cells against the target cells. Lysis rate = (Max-V) / (Max-Min) * 100%. (Max: bioluminescence value of the positive control well; Min: bioluminescence value of the negative control well; V: bioluminescence value measured in the experimental well.).

[0085] Example 5: Establishment of human multiple myeloma NSG mouse xenograft model.

[0086] 1) Wash MM.1S-Luc cells twice with PBS, resuspend and count, and adjust the cell concentration to 1.0×10 6 / 200μl, seal with sealing film.

[0087] 2) Take 4-5 week old female NSG mice out of the cage, fix them in a mouse holder, and wipe the tail vein of the mouse with an alcohol cotton ball to make it full.

[0088] 3) Use a disposable insulin syringe to insert the needle into the tail vein and inject 1.0×10 6 Slowly push the cells in.

[0089] 4) Press the needle hole with a dry cotton ball until the bleeding stops.

[0090] 5) Return the mice to their cages and observe them regularly.

[0091] 6) IVIS imaging: After confirming tumor formation, each group of TRuC-T cells prepared in vitro were washed twice with PBS, resuspended and counted, and the cell concentration was adjusted to 2.0×10 6 / 200μl was then injected back into the tail vein of NSG mice using a disposable insulin syringe and IVIS imaging was performed regularly to observe the multiple myeloma burden of the mice.

[0092] Example 6: Establishment of human breast cancer xenograft model in NSG mice.

[0093] 1) Female NSG mice aged 4-5 weeks were housed in an SPF animal room. After one week of feeding, the animal model was established after their condition stabilized.

[0094] 2) Pre-thaw the Nectin-4-MDA-MB-231 cells in good condition, wait for them to grow to a sufficient number, digest them, transfer them to a 50 ml sterile centrifuge tube, and centrifuge at 1500 rpm for 5 minutes.

[0095] 3) Aspirate the supernatant, add 2 ml PBS, resuspend the cell pellet with a pipette, add PBS to the 25 ml mark, mix gently with a Pasteur pipette, and centrifuge at 1500 rpm for 5 min.

[0096] 4) Repeat step (3) once.

[0097] 5) Resuspend the cell pellet in 1 ml of PBS, mix thoroughly and then aspirate 10 μl for counting.

[0098] 6) Adjust the cell density to 3×10 7 / ml, place the cells on ice, add a certain amount of matrix gel according to the ratio of 500μl matrix gel per milliliter of cell suspension, mix well by pipetting, divide into 1.5ml Eppendorf tubes at 1ml / tube, and place on ice (the matrix gel needs to be placed on ice in advance and then placed in a 4℃ refrigerator to melt).

[0099] 7) Use a 1 ml sterile syringe to draw 150 μl of the cell matrix gel mixture (i.e. 3×10 6 cells) were inoculated into the right dorsal abdomen of mice.

[0100] 8) Perform IVIS imaging on mice on days 3 and 7 after inoculation to observe tumor growth.

[0101] 9) During tumor formation, TRuC-T cells are prepared in vitro for subsequent cellular immunotherapy.

[0102] 10) When the tumors of NSG mice grow to a size that can be touched by hand, the mice are randomly grouped based on the bioluminescence imaging results and the weight of the mice.

[0103] 11) On the 8th day after tumor formation, transfer each group of TRuC-T cells prepared in vitro to a sterile centrifuge tube, centrifuge at 1700 rpm for 7 min, discard the supernatant, and wash twice with 10 ml of DPBS. The steps are the same as those for tumor cell treatment.

[0104] 12) After the last wash, resuspend the cell pellet with 1 ml DPBS, demagnetize it on a magnetic rack, and transfer it to a new 15 ml sterile centrifuge tube.

[0105] 13) Demagnetize the demagnetized supernatant again and transfer it to a new 15ml sterile centrifuge tube. After mixing thoroughly, take 10μl for counting.

[0106] 14) After adjusting the expression of cells in each group to be consistent with that in the Mock-T group, the T cell concentration was adjusted to 1.5×10 7 Positive cells / ml, pipette and mix thoroughly, then dispense into 1.5ml Eppendorf tubes at 1ml / tube and place on ice.

[0107] 15) Use an insulin needle to draw 200 μl of T cell suspension from each group (i.e. 3×10 6 positive cells) were infused into the corresponding groups of NSG mice through the tail vein.

[0108] 16) Regularly observe the survival status of NSG mice, weigh the mice and perform IVIS imaging.

[0109] 17) Then, the left side of the back of the mouse was impacted again, and the steps were the same as (2) to (7) (the cell density was adjusted to 1×10 7 / ml, the final concentration is 1×10 6 / 150μL).

Claims

1. A new dual-target TRuC structure with the addition of a 4-1BB co-stimulatory domain targeting two targets at the same time, characterized by: The two scFvs molecules were simultaneously integrated into the natural TCR-CD3 complex, and the interactions between different TCR-CD3 subunits were used to construct an HLA-independent TCR-CD3 complex.

2. The novel dual-target TRuC structure with an added 4-1BB co-stimulatory domain as described in claim 1, characterized in that: Two single-target TRuC molecular structures were connected by a 2A peptide sequence, and the TRuC structure contained: an extracellular antigen recognition domain (scFvs molecule), a TCR-CD3 subunit and a 4-1BB intracellular domain.

3. The TRuC molecule construction method according to claim 2, characterized in that: Different scFvs molecules are integrated into different TCR-CD3 subunits through linker to construct the TCR-CD3 complex.

Images