A multi-epitope VP1 fusion protein, virus-like particles and polyclonal antibodies of O-type foot-and-mouth disease virus and uses thereof
The competitive detection method using multi-epitope VP1 fusion protein and virus-like particles combined with polyclonal antibodies solves the problems of complexity and low sensitivity in the detection of type O foot-and-mouth disease virus in the existing technology, and achieves rapid, simple and efficient detection results.
Patent Information
- Application Number
- CN202510413278.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-04-03
AI Technical Summary
Existing methods for detecting type O foot-and-mouth disease virus antibodies are complex, time-consuming, have low sensitivity, and have a narrow detection spectrum, making it difficult to achieve rapid, large-scale detection.
A competitive method for detecting type O foot-and-mouth disease virus antibodies was established by using multi-epitope VP1 fusion protein and virus-like particles, combined with polyclonal antibodies. Virus-like particles are used as competitive antigens and polyclonal antibodies are used as labeling antibodies, which simplifies the operation and improves detection efficiency and sensitivity.
It achieves topological detection of type O foot-and-mouth disease virus that is simple to operate, fast to detect, highly sensitive, and has wide coverage, avoiding missed detections and exhibiting good specificity and stability.
Smart Images

Figure CN119912589B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of detecting O-type foot-and-mouth disease virus (FMDV) antibodies, and in particular to a multi-epitope VP1 fusion protein of O-type foot-and-mouth disease virus, virus-like particles, polyclonal antibodies and uses thereof. BACKGROUND
[0002] Food-and-mouth disease (FMD) is listed as the first animal disease that must be reported by the World Organization for Animal Health (WOAH) and is a type of disease that must be inspected for international live livestock and livestock product customs trade. China also lists it as the first animal disease. The clinical symptoms are fever, water bubble formation in the oral cavity, tongue surface, hoof and other parts, and then gradual rupture to form scab. The mortality rate of oral, nasal, breast and other herpes FMD is less than 2.5%; if the disease continues to develop secondary pneumonia, the mortality rate of animals can reach (5-20)%, and the mortality rate of young animals and pregnant animals is higher than that of adult animals (45-60)%.
[0003] Among them, foot-and-mouth disease is a highly contagious, acute and severe infectious disease caused by foot-and-mouth disease virus (FMDV), which can not only spread among pigs, cattle, sheep and other odd-toed animals, but also spread through the air. Among them, FMDV can spread (50-100) kilometers by wind.
[0004] FMDV belongs to the Picornaviridae Aphthovirus and has seven different serotypes, namely O-type, A-type, C-type, Asia1, SAT1, SAT2 and SAT3, and each serotype contains multiple subtypes. Among them, O-type is the most widely distributed and is the most widely prevalent serotype in the world. The World Organization for Animal Health China National Foot-and-Mouth Disease Reference Laboratory divides O-type foot-and-mouth disease virus into 10 topotypes according to VP1 gene and epidemic area; among them, three topotypes are prevalent in China, namely Cathay topotype, SEA topotype and ME-SA topotype (commonly known as pan-Asian type).
[0005] The methods for detecting O-type FMDV antibodies mainly include virus neutralization test, liquid phase blocking ELISA (LPB-ELISA) and solid phase competitive ELISA (SPC-ELISA) and the like. Among them, the virus neutralization test needs to prepare a monolayer of cells, and the operation is complex, time-consuming and low in sensitivity; the LPB-ELISA and the SPC-ELISA are internationally recognized detection methods for FMDV antibodies, but the LPB-ELISA and the SPC-ELISA detection kits on the market currently have poor sensitivity, narrow detection spectrum, complicated operation steps, high requirements for detection personnel, long reaction time, and cannot realize full-automatic detection, and it is difficult to realize rapid detection of a large quantity in a short time. SUMMARY
[0006] Therefore, the application provides a multi-epitope VP1 fusion protein of O-type foot-and-mouth disease virus, virus-like particles and polyclonal antibodies and their uses. The application establishes a method for detecting O-type foot-and-mouth disease virus antibodies based on competition method by taking virus-like particles as competitive antigens and taking polyclonal antibodies as labeled antibodies, which not only has simple operation, short detection time, but also covers the main topological types of O-type foot-and-mouth disease virus, avoids missed detection, and has the advantages of strong specificity, high sensitivity and good stability.
[0007] In a first aspect, the application provides a multi-epitope VP1 fusion protein, which is selected from the structure shown in formula (I):
[0008] ;
[0009] wherein AAS1 represents an amino acid sequence as shown in SEQ ID NO. 1, and / or an amino acid sequence obtained by substituting, deleting or adding one or more bases of the amino acid sequence as shown in SEQ ID NO. 1;
[0010] AAS2, AAS3, AAS4 and AAS5 each independently represent an amino acid sequence as shown in any one of SEQ ID NO. 2-5, and AAS2, AAS3, AAS4 and AAS5 each represent a different amino acid sequence;
[0011] AAS6 represents an amino acid sequence as shown in SEQ ID NO. 6, and / or an amino acid sequence obtained by substituting, deleting or adding one or more bases of the amino acid sequence as shown in SEQ ID NO. 6;
[0012] L1, L2, L3, L4 and L5 each independently represent a flexible linker peptide.
[0013] In some embodiments, AAS1 represents an amino acid sequence as shown in SEQ ID NO. 1.
[0014] In some embodiments, AAS2 represents an amino acid sequence as set forth in SEQ ID NO. 2, AAS3 represents an amino acid sequence as set forth in SEQ ID NO. 3, AAS4 represents an amino acid sequence as set forth in SEQ ID NO. 4, and AAS5 represents an amino acid sequence as set forth in SEQ ID NO. 5.
[0015] In some embodiments, AAS6 represents an amino acid sequence as set forth in SEQ ID NO. 6.
[0016] In some alternative embodiments, each of L1, L2, L3, L4, L5 and L6 independently represents an amino acid sequence from N-terminus to C-terminus direction , n is selected from an integer from 1 to 4 (e.g. 1, 2, 3 or 4).
[0017] In some embodiments, L1 is selected from an amino acid sequence from N-terminus to C-terminus direction GGGGSGGGGS.
[0018] In some embodiments, L2 is selected from an amino acid sequence from N-terminus to C-terminus direction GGGGS.
[0019] In some embodiments, L3 is selected from an amino acid sequence from N-terminus to C-terminus direction GGGGS.
[0020] In some embodiments, L4 is selected from an amino acid sequence from N-terminus to C-terminus direction GGGGS.
[0021] In some embodiments, L5 is selected from an amino acid sequence from N-terminus to C-terminus direction GGGGSGGGGS.
[0022] In some alternative embodiments, the polyepitope VP1 fusion protein is selected from an amino acid sequence as set forth in SEQ ID NO. 11.
[0023] In some embodiments, the polyepitope VP1 fusion protein is selected from an amino acid sequence as set forth in SEQ ID NO. 11.
[0024] In a second aspect, the present application provides a nucleic acid molecule comprising a structure as set forth in formula (II):
[0025] ;
[0026] wherein NAS1 represents a nucleotide sequence as set forth in SEQ ID NO. 23, and / or a nucleotide sequence obtained by substitution, deletion or addition of one or more bases to the nucleotide sequence as set forth in SEQ ID NO. 23;
[0027] NAS2, NAS3, NAS4 and NAS5 each independently represents a nucleotide sequence as set forth in any one of SEQ ID NOs. 24-27, and NAS2, NAS3, NAS4 and NAS5 each represents a different nucleotide sequence;
[0028] NAS6 represents a nucleotide sequence as set forth in SEQ ID NO. 28, and / or a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as set forth in SEQ ID NO. 28;
[0029] L1', L2', L3', L4' and L5' each independently represents a nucleotide sequence encoding a flexible linker peptide.
[0030] In some embodiments, NAS1 represents a nucleotide sequence as set forth in SEQ ID NO. 23.
[0031] In some embodiments, NAS2 represents a nucleotide sequence as set forth in SEQ ID NO. 24, NAS3 represents a nucleotide sequence as set forth in SEQ ID NO. 25, NAS4 represents a nucleotide sequence as set forth in SEQ ID NO. 26, and NAS5 represents a nucleotide sequence as set forth in SEQ ID NO. 27.
[0032] In some embodiments, NAS6 represents a nucleotide sequence as set forth in SEQ ID NO. 28.
[0033] In some alternative embodiments, L1', L2', L3', L4' and L5' each independently represents a nucleotide sequence from 5' end to 3' end direction , n' is selected from an integer from 1 to 4 (e.g., 1, 2, 3 or 4).
[0034] In some embodiments, L1' represents a nucleotide sequence from 5' end to 3' end direction GGTGGTGGTGGTTCTGGTGGTGGTGGTTCT.
[0035] In some embodiments, L2' represents a nucleotide sequence from 5' end to 3' end direction GGTGGTGGTGGTTCT.
[0036] In some embodiments, L3' represents a nucleotide sequence from 5' end to 3' end direction GGTGGTGGTGGTTCT.
[0037] In some embodiments, L4' represents a nucleotide sequence from 5' end to 3' end direction GGTGGTGGTGGTTCT.
[0038] In some embodiments, L5' represents a nucleotide sequence of GGTGGTGGTGGTTCTGGTGGTGGTGGTTCT from 5' end to 3' end direction.
[0039] In some alternative embodiments, the nucleic acid molecule is selected from a nucleotide sequence as set forth in SEQ ID NO. 33.
[0040] In some embodiments, the nucleic acid molecule is selected from a nucleotide sequence as set forth in SEQ ID NO. 33.
[0041] In some embodiments, the nucleic acid molecule is selected from a nucleotide sequence as set forth in SEQ ID NO. 33.
[0042] In some embodiments, the nucleic acid molecule is selected from a nucleotide sequence as set forth in SEQ ID NO. 33.
[0043] In some embodiments, the nucleic acid molecule is selected from a nucleotide sequence as set forth in SEQ ID NO. 33.
[0044] (I) a polyepitope VP1 fusion protein selected from an amino acid sequence as set forth in SEQ ID NO. 11;
[0045] (II) a VP0 protein selected from an amino acid sequence as set forth in SEQ ID NO. 34;
[0046] (III) a VP3 protein selected from an amino acid sequence as set forth in SEQ ID NO. 37.
[0047] In some embodiments, the polyepitope VP1 fusion protein is selected from an amino acid sequence as set forth in SEQ ID NO. 11.
[0048] In some embodiments, the nucleic acid molecule is selected from a nucleotide sequence as set forth in SEQ ID NO. 33.
[0049] (I) a nucleic acid molecule expressing a polyepitope VP1 fusion protein selected from a nucleotide sequence as set forth in SEQ ID NO. 33;
[0050] (II) a nucleic acid molecule expressing a VP0 protein selected from a nucleotide sequence as set forth in SEQ ID NO. 36;
[0051] (III) a nucleic acid molecule expressing a VP3 protein selected from a nucleotide sequence as set forth in SEQ ID NO. 39.
[0052] In an eighth aspect, the present application provides a recombinant plasmid combination comprising:
[0053] (I) a recombinant plasmid comprising a nucleotide sequence as set forth in SEQ ID NO. 33 (e.g., a recombinant plasmid comprising a nucleotide sequence as set forth in SEQ ID NO. 33);
[0054] (II) a recombinant plasmid comprising a nucleotide sequence as set forth in SEQ ID NO. 36;
[0055] (III) a recombinant plasmid comprising a nucleotide sequence as set forth in SEQ ID NO. 39.
[0056] In a ninth aspect, the present application provides a gene expression vector combination comprising:
[0057] (I) a gene expression vector comprising a nucleotide sequence as set forth in SEQ ID NO. 33;
[0058] (II) a gene expression vector comprising a nucleotide sequence as set forth in SEQ ID NO. 36;
[0059] (III) a gene expression vector comprising a nucleotide sequence as set forth in SEQ ID NO. 39.
[0060] In a tenth aspect, the present application provides use of the multi-epitope VP1 fusion protein of the first aspect, and / or the nucleic acid molecule of the second aspect, and / or the recombinant plasmid of the third aspect, and / or the gene expression vector of the fourth aspect, and / or the virus-like particle of the fifth aspect, and / or the polyclonal antibody of the sixth aspect, and / or the nucleic acid molecule combination of the seventh aspect, and / or the recombinant plasmid combination of the eighth aspect, and / or the gene expression vector combination of the ninth aspect, in the preparation of a product for detecting antibodies to O foot-and-mouth disease virus, and / or a product for preventing a disease or condition caused by O foot-and-mouth disease virus infection, and / or a product for treating a disease or condition caused by O foot-and-mouth disease virus infection.
[0061] In an eleventh aspect, the present application provides a pharmaceutical composition comprising the multi-epitope VP1 fusion protein of the first aspect, and / or the nucleic acid molecule of the second aspect, and / or the recombinant plasmid of the third aspect, and / or the gene expression vector of the fourth aspect, and / or the virus-like particle of the fifth aspect, and / or the polyclonal antibody of the sixth aspect, and / or the nucleic acid molecule combination of the seventh aspect, and / or the recombinant plasmid combination of the eighth aspect, and / or the gene expression vector combination of the ninth aspect.
[0062] In a twelfth aspect, the present application provides a vaccine composition comprising the multi-epitope VP1 fusion protein of the first aspect, and / or the nucleic acid molecule of the second aspect, and / or the recombinant plasmid of the third aspect, and / or the gene expression vector of the fourth aspect, and / or the virus-like particle of the fifth aspect, and / or the polyclonal antibody of the sixth aspect, and / or the nucleic acid molecule combination of the seventh aspect, and / or the recombinant plasmid combination of the eighth aspect, and / or the gene expression vector combination of the ninth aspect.
[0063] In a thirteenth aspect, the present application provides a kit for detecting antibodies against O foot-and-mouth disease virus based on enzyme-linked immunosorbent assay, characterized in that it comprises a competitive antigen and a labeled antibody.
[0064] The competitive antigen is selected from the virus-like particle of the fifth aspect.
[0065] The labeled antibody is selected from the polyclonal antibody of the sixth aspect labeled with horseradish peroxidase.
[0066] In a fourteenth aspect, the present application provides a kit for detecting antibodies against O foot-and-mouth disease virus based on magnetic particle chemiluminescence, characterized in that it comprises a competitive antigen and a labeled antibody.
[0067] The competitive antigen is selected from the virus-like particle of the fifth aspect labeled with biotin.
[0068] The labeled antibody is selected from the polyclonal antibody of the sixth aspect labeled with acridinium ester.
[0069] The present application has the following beneficial effects:
[0070] Firstly, the present application fuses four VP1 dominant epitopes of O foot-and-mouth disease virus into the VP1 protein of O foot-and-mouth disease virus Mya-98 strain, and uses amino acid point mutation technology to mutate amino acid sites affecting protein thermal stability and acid stability, thereby obtaining a VP1 fusion protein with good thermal stability and strong acid resistance. Then, the virus-like particle is self-assembled based on the VP1 fusion protein, VP0 protein and VP3 protein of O foot-and-mouth disease virus Mya-98 strain, and the virus-like particle has good specificity for antibodies against three common topological types of O foot-and-mouth disease virus.
[0071] Secondly, the present application uses the virus-like particle of the fourth aspect as a competitive antigen and the polyclonal antibody of the fifth aspect as a labeled antibody, and establishes a method for detecting antibodies against O foot-and-mouth disease virus based on competition, which not only has simple operation, short detection time, but also covers the main topological types of O foot-and-mouth disease virus, avoids missed detection, and has the advantages of strong specificity, high sensitivity and good stability. BRIEF DESCRIPTION OF DRAWINGS
[0072] Figure 1 Figure 2 is a DNA agarose gel electrophoresis chart in Example 4.
[0073] Figure 2 Figure 3 is a SDS-PAGE electrophoresis chart in Example 5. DETAILED DESCRIPTION
[0074] The present application discloses a multi-epitope VP1 fusion protein, virus-like particles and polyclonal antibodies of O foot-and-mouth disease virus and their uses. Those skilled in the art can refer to the content herein and appropriately modify the process parameters to achieve. It is particularly pointed out that all similar substitutions and modifications are obvious to those skilled in the art, and they are considered to be included in the present application. The methods and applications of the present application have been described by preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present application, to realize and apply the technology of the present application.
[0075] In order to make the purpose, technical solutions and advantages of the present application more clear, the present application will be further described in detail in combination with examples.
[0076] Example 1, VP1 recombinant gene and VP1 fusion protein:
[0077] A typical FMDV-O strain O / GX / 09-7 strain (Cathay Topotype) which has been published on DNA sequence database GenBank and has been widely prevalent in China was selected, and antigen epitope prediction analysis was performed by using online tools Immunomedicine Group and SVMTriP. The antigen epitope prediction analysis results and O / GX / 09-7 strain and O / MYA98 / BY / 2010 strain (GenBank: JN998085.1) were subjected to homology analysis, and amino acid fragments SEQ ID NO. 2 and SEQ ID NO. 3 which were rich in antigen epitopes and had obvious differences from the backbone strain were selected.
[0078] The VP1 amino acid sequence of a typical FMDV-O strain O / PanAsia / TZ / 2011 strain (ME-SA Topotype-PanAsia lineage) which has been published on DNA sequence database GenBank and has been widely prevalent in China was selected, and antigen epitope prediction analysis was performed by using online tools Immunomedicine Group and SVMTriP. The antigen epitope prediction analysis results and O / PanAsia / TZ / 2011 strain and O / MYA98 / BY / 2010 strain were subjected to homology analysis, and amino acid fragments SEQ ID NO. 4 and SEQ ID NO. 5 which were rich in antigen epitopes and had obvious differences from the backbone strain were selected.
[0079] The amino acid sequence SEQ ID NO.2 corresponds to the nucleotide sequence SEQ ID NO.13;
[0080] The amino acid sequence SEQ ID NO.3 corresponds to the nucleotide sequence SEQ ID NO.14;
[0081] The amino acid sequence SEQ ID NO.4 corresponds to the nucleotide sequence SEQ ID NO.15;
[0082] The amino acid sequence SEQ ID NO.5 corresponds to the nucleotide sequence SEQ ID NO.16.
[0083] Gene recombination is performed based on nucleotide sequences SEQ ID NO. 13–16. The methods of gene recombination include:
[0084] (1) The numbers are SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15 in sequence;
[0085] (2) The numbers are SEQ ID NO.12, SEQ ID NO.14, and SEQ ID NO.15 in sequence;
[0086] (3) The numbers are SEQ ID NO.12, SEQ ID NO.13, and SEQ ID NO.15 in sequence;
[0087] (4) The numbers are SEQ ID NO.12, SEQ ID NO.13, and SEQ ID NO.14 in sequence;
[0088] (5) The numbers are SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15 in sequence.
[0089] The recombinant nucleotide sequence was inserted between nucleotides 146 and 147, starting from the 5' end, of the VP1 gene in strain O / MYA98 / BY / 2010 (i.e., between nucleotide sequences SEQ ID NO. 12 and SEQ ID NO. 17); wherein, adjacent nucleotide fragments are separated by the insertion of a nucleotide fragment encoding a flexible linker peptide. (where n' can be selected from 1, 2, 3 or 4, etc.) are linked together; and the obtained nucleotide sequence is subjected to A13T mutation and N17Y mutation to obtain the VP1 recombinant gene SEQ ID NO.18~22.
[0090] The amino acid sequence SEQ ID NO.1 corresponds to the nucleotide sequence SEQ ID NO.12;
[0091] The amino acid sequence SEQ ID NO. 6 corresponds to the nucleotide sequence SEQ ID NO. 17.
[0092] The VP1 recombinant genes SEQ ID NO. 18-22 were respectively optimized according to the preferred codons of E. coli, to obtain the codon-optimized VP1 recombinant genes SEQ ID NO. 29-33.
[0093] Table 1, sequence information of the amino acid sequence:
[0094] 、
[0095] Table 2, sequence information of the nucleotide sequence:
[0096] 、 、 、
[0097] Table 3, sequence information of the codon-optimized nucleotide sequence:
[0098] 、 、
[0099] Example 2, VP0 gene and VP0 protein:
[0100] The VP0 protein SEQ ID NO. 34 of FMDV-O strain O / MYA98 / BY / 2010 (GenBank: JN998085.1) was selected. The VP0 protein SEQ ID NO. 34 corresponds to the VP0 gene SEQ ID NO. 35. The VP0 gene SEQ ID NO. 35 was optimized according to the preferred codons of E. coli, to obtain the codon-optimized VP0 gene SEQ ID NO. 36.
[0101] Table 4, sequence information of the amino acid sequence:
[0102]
[0103] Table 5, sequence information of the nucleotide sequence:
[0104]
[0105] Example 3, VP3 gene and VP3 protein:
[0106] The VP3 protein SEQ ID NO. 37 of FMDV type O strain O / MYA98 / BY / 2010 strain was selected. The VP3 protein SEQ ID NO. 37 corresponds to the VP3 gene SEQ ID NO. 38. The VP3 gene SEQ ID NO. 38 was optimized according to the preferred codons of E. coli to obtain the codon-optimized VP3 gene SEQ ID NO. 39.
[0107] Table 6, sequence information of amino acid sequence:
[0108]
[0109] Table 7, sequence information of nucleotide sequence:
[0110]
[0111] The VP1 recombinant genes SEQ ID NO. 29-33 were used in the following experiments.
[0112] The two ends of the VP1 recombinant genes SEQ ID NO. 29-33, the VP0 gene SEQ ID NO. 36 and the VP3 gene SEQ ID NO. 39 were inserted with the restriction enzyme sites BamHI and Xhol, respectively, and were synthesized by General Biosystems (Anhui) Co., Ltd. to obtain the recombinant plasmids pUC57-VP1(29), pUC57-VP1(30), pUC57-VP1(31), pUC57-VP1(32), pUC57-VP1(33), pUC57-VP0 and pUC57-VP3.
[0113] Table 8, nucleotide sequence information of BamHI and Xhol restriction enzyme sites:
[0114]
[0115] Example 4, construction of recombinant plasmid:
[0116] The recombinant plasmids pUC57-VP1(29), pUC57-VP1(30), pUC57-VP1(31), pUC57-VP1(32), pUC57-VP1(33), pUC57-VP0 and pUC57-VP3 were respectively connected with the SUMO expression vector pET28a-SUMO by double enzyme digestion vector construction technology. The specific steps include the following:
[0117] (4-1) According to the instruction of endonuclease (purchased from QIAGEN), the recombinant plasmid pUC57-VP1(29), pUC57-VP1(30), pUC57-VP1(31), pUC57-VP1(32), pUC57-VP1(33), pUC57-VP0, pUC57-VP3 were respectively digested by BamHI / XhoI with pET28a-SUMO expression vector.
[0118] (4-2) The products were subjected to agarose gel electrophoresis (120v 30min), and the linearized recombinant plasmid pUC57-VP1(29), pUC57-VP1(30), pUC57-VP1(31), pUC57-VP1(32), pUC57-VP1(33), pUC57-VP0, pUC57-VP3 and pET28a-SUMO expression vector plasmid were recovered according to the operation of agarose gel DNA recovery kit (purchased from TIANGEN BIOTECH (BEIJING) CO., LTD.).
[0119] (4-3) According to the instruction of T4 DNA ligase (purchased from QIAGEN), the linearized recombinant plasmid pUC57-VP1(29), pUC57-VP1(30), pUC57-VP1(31), pUC57-VP1(32), pUC57-VP1(33) were respectively connected with pET28a-SUMO expression vector, and the products after connection were respectively named as pET28a-SUMO-VP1(29), pET28a-SUMO-VP1(30), pET28a-SUMO-VP1(31), pET28a-SUMO-VP1(32), pET28a-SUMO-VP1(33), pET28a-SUMO-VP0, pET28a-SUMO-VP3.
[0120] (4-4) The seven recombinant expression plasmids pET28a-SUMO-VP1(29), pET28a-SUMO-VP1(30), pET28a-SUMO-VP1(31), pET28a-SUMO-VP1(32), pET28a-SUMO-VP1(33), pET28a-SUMO-VP0 and pET28a-SUMO-VP3 after connection were respectively transformed into BL21 (DE3) competent cells (purchased from QIAGEN) and cultured at 37℃, 200rpm for 1 hour.
[0121] (4-5) The culture was respectively uniformly coated on LB agar plate (Kanamycin+), and cultured at 37℃ overnight.
[0122] (4-6) The single clone bacteria were selected as templates, and the universal primer T7P / T7T of pET28a-SUMO vector was used as a primer to perform PCR amplification, and the DNA agarose gel electrophoresis (120v 30min) was performed on the amplified product.
[0123] The DNA agarose gel electrophoresis diagram is shown in Figure 1 . Figure 1 Among them, 1 represents Marker lane, 2 represents pET28a-SUMO vector lane, 3 represents recombinant plasmid pET28a-SUMO-VP1(95) lane, 4 represents recombinant plasmid pET28a-SUMO-VP1(30) lane, 5 represents recombinant plasmid pET28a-SUMO-VP1(31) lane, 6 represents recombinant plasmid pET28a-SUMO-VP1(33) lane, 7 represents recombinant plasmid pET28a-SUMO-VP1(33) lane, 8 represents recombinant plasmid pET28a-SUMO-VP0 lane, 9 represents recombinant plasmid pET28a-SUMO-VP3 lane.
[0124] As can be seen from Figure 1 , the pET28a-SUMO vector appears a band of about 582bp size, the recombinant plasmid pET28a-SUMO-VP1(29) appears a band of about 1486bp size, the recombinant plasmid pET28a-SUMO-VP1(30) appears a band of about 1501bp size, the recombinant plasmid pET28a-SUMO-VP1(31) appears a band of about 1486bp size, the recombinant plasmid pET28a-SUMO-VP1(32) appears a band of about 1501bp size, the recombinant plasmid pET28a-SUMO-VP1(33) appears a band of about 1561bp size, the recombinant plasmid pET28a-SUMO-VP0 appears a band of about 1177bp size, and the recombinant plasmid pET28a-SUMO-VP3 appears a band of about 1206bp size; thus it is confirmed that the product fragment size is consistent with the expectation.
[0125] Table 9, sequence information of universal primer T7P / T7T:
[0126]
[0127] Example 5, virus-like particles of O foot-and-mouth disease virus:
[0128] (5-1) Respectively pick up single colonies containing 7 kinds of recombinant plasmids pET28a-SUMO-VP1 (29), pET28a-SUMO-VP1 (30), pET28a-SUMO-VP1 (31), pET28a-SUMO-VP1 (32), pET28a-SUMO-VP1 (33), pET28a-SUMO-VP0, pET28a-SUMO-VP3 into 1 mL of LB liquid medium (Kanamycin+) and culture at 37℃, 220 rpm for 1 hour for activation.
[0129] (5-2) Transfer the activated bacterial solution to 100 mL of fresh LB liquid medium (Kanamycin+) and place it in a constant temperature shaker at 220 rpm, 37℃ for overnight culture.
[0130] (5-3) Measure the OD 600nm of the bacterial solution by spectrophotometer. 600nm When the OD is 0.6-0.8, add isopropyl-beta-D-thiogalactoside (CAS number 367-93-1, abbreviated as IPTG) with a final concentration of 0.5 mM for induction expression, and express overnight at 16℃, 120 rpm.
[0131] (5-4) Centrifuge the bacterial solution at 8000 rpm, 5 min, 4℃, collect the precipitate, resuspend the bacterial body with 10 mL of PBS buffer (pH=8.0), add lysozyme (CAS number 9001-63-2) with a final concentration of 1 mg / mL and ice bath for 30 min, then low-temperature ultrasonic crushing of bacterial body (ultrasonic time 6 s, intermittent 4 s, until the bacterial solution is clear, about 30 min).
[0132] (5-5) After crushing, centrifuge at 4℃, 12000 rpm for 30 min, collect the supernatant. Take 100 μl of supernatant for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (sodium dodecyl sulfate-polyacrylamide gel electrophoresis, SDS-PAGE).
[0133] Figure 2 The SDS-PAGE electrophoretogram is shown in
[0134] Figure 2In the figure, 1 represents the lane of the expressed protein of the recombinant plasmid pET28a-SUMO-VP1 (29), 2 represents the lane of the expressed protein of the recombinant plasmid pET28a-SUMO-VP1 (30), 3 represents the lane of the expressed protein of the recombinant plasmid pET28a-SUMO-VP1 (31), 5 represents the lane of the expressed protein of the recombinant plasmid pET28a-SUMO-VP1 (32), 6 represents the lane of the expressed protein of the recombinant plasmid pET28a-SUMO-VP1 (33), 9 represents the lane of Marker protein, 10 represents the lane of the expressed protein of the recombinant plasmid pET28a-SUMO-VP0, and 12 represents the lane of the expressed protein of the recombinant plasmid pET28a-SUMO-VP3.
[0135] From Figure 2 It can be seen that the protein band of about 66 KDa size appears in the supernatant of the bacterial liquid of the recombinant plasmid pET28a-SUMO-VP1 (29), pET28a-SUMO-VP1 (30), pET28a-SUMO-VP1 (31), pET28a-SUMO-VP1 (32), and pET28a-SUMO-VP1 (33), and the expected protein band size is 58 KDa; the protein band of about 50 KDa size appears in the supernatant of the bacterial liquid of the recombinant plasmid pET28a-SUMO-VP0, and the expected protein band size is 43 KDa; the protein band of about 50 KDa size appears in the supernatant of the bacterial liquid of the recombinant plasmid pET28a-SUMO-VP3, and the expected protein band size is 44 KDa. This is because the His tag has a strong positive charge, so the protein band appearing in the SDS-PAGE electrophoretogram is slightly larger than the expected protein band.
[0136] The VP1 fusion protein expressed by the recombinant plasmid pET28a-SUMO-VP1 (29) is named FMDV-O-VP1 (29)-SUMO (the amino acid sequence is shown as SEQ ID NO. 7);
[0137] The VP1 fusion protein expressed by the recombinant plasmid pET28a-SUMO-VP1 (30) is named FMDV-O-VP1 (30)-SUMO (the amino acid sequence is shown as SEQ ID NO. 8);
[0138] The VP1 fusion protein expressed by the recombinant plasmid pET28a-SUMO-VP1 (31) is named FMDV-O-VP1 (31)-SUMO (the amino acid sequence is shown as SEQ ID NO. 9);
[0139] The VP1 fusion protein expressed by the recombinant plasmid pET28a-SUMO-VP1 (32) is named FMDV-O-VP1 (32)-SUMO (the amino acid sequence of which is shown as SEQ ID NO. 10);
[0140] The VP1 fusion protein expressed by the recombinant plasmid pET28a-SUMO-VP1 (33) is named FMDV-O-VP1 (33)-SUMO (the amino acid sequence of which is shown as SEQ ID NO. 11);
[0141] The VP0 protein expressed by the recombinant plasmid pET28a-SUMO-VP0 is named FMDV-O-VP0-SUMO (the amino acid sequence of which is shown as SEQ ID NO. 34).
[0142] The VP3 protein expressed by the recombinant plasmid pET28a-SUMO-VP3 is named FMDV-O-VP3-SUMO (the amino acid sequence of which is shown as SEQ ID NO. 37).
[0143] (5-6) The bacterial supernatant is purified by a nickel ion metal chelate affinity chromatography column, and the target protein is collected.
[0144] (5-7) Self-assembly of virus-like particles of O foot-and-mouth disease virus:
[0145] The purified proteins are mixed in equal volume ratio, SUMO protease is added, and the reaction is carried out at 25°C for 1 h to separate the His tag and the SUMO tag from the target protein; then, the protein solution is transferred to a 20KD ultrafiltration tube, centrifuged at 4°C and 3000 rpm for 5 min, and the centrifugation is repeated until the liquid in the 20KD ultrafiltration tube is about 4 mL; the pH value of the protein solution after ultrafiltration purification is adjusted to 8.0, and the protein is self-assembled into virus-like particles of O foot-and-mouth disease virus at 4°C for 2 hours.
[0146] Among them, the three proteins FMDV-O-VP1 (29)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO self-assemble into virus-like particles I of O foot-and-mouth disease virus;
[0147] The three proteins FMDV-O-VP1 (31)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO self-assemble into virus-like particles II of O foot-and-mouth disease virus;
[0148] The three proteins FMDV-O-VP1 (32)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO self-assemble into virus-like particles III of O foot-and-mouth disease virus;
[0149] 3 kinds of proteins FMDV-O-VP1(33)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO automatically assemble into virus-like particles IV of O type foot-and-mouth disease virus.
[0150] Example 6, preparation of polyclonal antibody:
[0151] Two-month-old female New Zealand rabbits are immunized with virus-like particles of O type foot-and-mouth disease virus as immunogen. The first immunization is carried out by subcutaneous injection of 1 mg of virus-like particles emulsified with equal amount of Freund's complete adjuvant in multiple points on the back; the booster immunization is carried out every two weeks by subcutaneous injection of 1 mg of fusion protein emulsified with equal amount of Freund's incomplete adjuvant in multiple points on the back; one week after the third booster immunization, the rabbits are bled from the marginal ear vein, centrifuged at 12000 r / min for 5 min to obtain serum containing polyclonal antibodies.
[0152] The virus-like particles of O type foot-and-mouth disease virus are used as coating agent, the serum containing polyclonal antibodies is used as the antibody to be detected, and the horseradish peroxidase-labeled goat anti-rabbit antibody is used as the secondary antibody; when the titer of the serum containing polyclonal antibodies is greater than 1:10000, the heart is bled, the blood is left to stand at room temperature overnight, and then centrifuged at 12000 r / min for 20 min to reserve the serum, which is treated by ammonium sulfate precipitation to obtain the polyclonal antibodies.
[0153] Among them, the virus-like particles I of O type foot-and-mouth disease virus automatically assembled from FMDV-O-VP1(29)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO are used as immunogen to obtain polyclonal antibodies I;
[0154] The virus-like particles II of O type foot-and-mouth disease virus automatically assembled from FMDV-O-VP1(31)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO are used as immunogen to obtain polyclonal antibodies II;
[0155] The virus-like particles III of O type foot-and-mouth disease virus automatically assembled from FMDV-O-VP1(32)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO are used as immunogen to obtain polyclonal antibodies III;
[0156] The virus-like particles IV of O type foot-and-mouth disease virus automatically assembled from FMDV-O-VP1(33)-SUMO, FMDV-O-VP0-SUMO and FMDV-O-VP3-SUMO are used as immunogen to obtain polyclonal antibodies IV.
[0157] Example 7, kit for detecting O foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent assay:
[0158] In this embodiment, the main components of the kit for detecting O-type foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent assay are as follows: virus-like particle antigen coated plate of O-type foot-and-mouth disease virus (referred to as antigen coated plate), horseradish peroxidase (HRP) labeled polyclonal antibody (referred to as enzyme-labeled antibody), positive control, negative control, sample diluent, washing solution, color developing substrate solution A, color developing substrate solution B, and termination solution.
[0159] The preparation process of the antigen coated plate is as follows: the virus-like particles of O-type foot-and-mouth disease virus are diluted into a coating solution with a final concentration of 1 μg / mL using CBS buffer (pH = 9.6), 100 μL / well of the coating solution is added to the enzyme-labeled plate, 4°C coating for 16 h, and the solution in the wells of the enzyme-labeled plate is discarded; PBST buffer (0.05% Tween-20, pH = 7.4) is added for washing, 300 μL / well, washing for 5 times, 3 min / time; OVA blocking solution is added to the enzyme-labeled plate, 200 μL / well, 37°C blocking for 2 h, and the solution in the wells of the enzyme-labeled plate is discarded; PBST buffer (0.05% Tween-20, pH = 7.4) is added for washing, 300 μL / well, washing for 5 times, 3 min / time; and the antigen coated plate is obtained.
[0160] The OVA blocking solution is prepared by diluting chicken ovalbumin (ovalbumin, referred to as OVA) with PBS buffer (pH = 7.4), and the concentration of the OVA blocking solution is 2% (w / v).
[0161] The color developing substrate solution A is prepared by adding 13.6 g of sodium acetate, 1.6 g of citric acid, 30% (wt) hydrogen peroxide 0.3 mL, and distilled water to 500 mL.
[0162] The color developing substrate solution B is prepared by adding 0.2 g of disodium ethylenediaminetetraacetate, 0.95 g of citric acid, 50 mL of glycerol, 3,3',5,5'-tetramethylbenzidine (0.15 g) in DMSO (3 mL), and distilled water to 500 mL.
[0163] The termination solution is H2SO4.
[0164] In this embodiment, the working principle of the kit for detecting O foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent assay is as follows: whether the O foot-and-mouth disease virus antibody is contained in the sample to be detected is determined by using a competitive method. The virus-like particles of the O foot-and-mouth disease virus are used as antigens and are coated on the enzyme-labeled plate holes to prepare an antigen-coated plate. The sample to be detected and the enzyme-labeled antibody are added to the antigen-coated plate, and the O foot-and-mouth disease virus antibody in the sample to be detected and the enzyme-labeled antibody are combined with the virus-like particles of the O foot-and-mouth disease virus on the antigen-coated plate in a competitive manner to form antigen-enzyme-labeled antibody complexes, respectively. After washing, the O foot-and-mouth disease virus antibody and the enzyme-labeled antibody complex in the sample to be detected are washed away, and the antigen and the enzyme-labeled antibody complex combined on the antigen-coated plate are retained. Then, a color developing solution is added, 3,3',5,5'-tetramethylbenzidine is converted into blue under the catalysis of HRP, and finally converted into yellow under the action of a termination solution. The color depth is negatively correlated with the content of the O foot-and-mouth disease virus antibody in the sample to be detected; the absorbance (OD value) is determined at 450 nm by using an enzyme-labeled instrument, and whether the O foot-and-mouth disease virus antibody is contained in the sample to be detected is calculated according to the OD value.
[0165] The working process of the kit for detecting O foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent assay specifically includes the following steps:
[0166] (7-1) Preparation of the sample to be detected: the sample to be detected is diluted 10 times with PBST buffer (0.05% Tween-20, pH=7.4); specifically, 20 μL of the serum sample to be detected and 180 μL of the PBST buffer;
[0167] (7-2) Incubation: the negative quality control, the positive quality control and the sample to be detected are added to the antigen-coated plate, 10 μL / hole, and the enzyme-labeled antibody is added, 90 μL / hole, and mixed; the enzyme-labeled plate is sealed with a sealing film, and incubated at 37°C for 30 min;
[0168] The enzyme-labeled antibody is an HRP-labeled polyclonal antibody diluted with the PBST buffer (0.05% Tween-20, pH=7.4) at a dilution ratio of 1:8000 (mass / volume ratio w / v);
[0169] (7-3) Washing: the solution in the holes of the antigen-coated plate is discarded, the PBST buffer (0.05% Tween-20, pH=7.4) is added for washing, 300 μL / hole, and the washing is performed 5 times, 3 min / time;
[0170] (7-4) Color development and termination: the TMB color developing solution (prepared by mixing color developing substrate liquid A and color developing substrate liquid B at a volume ratio of 1:1) is added to the antigen-coated plate, 100 μL / hole, mixed, and color developed at 37°C for 15 min in the dark; then, 2M concentrated sulfuric acid is added, 50 μL / hole, and the enzyme-labeled plate is gently shaken until the color development is uniform;
[0171] (7-5) Reading: Put the antigen-coated plate into the enzyme label instrument, and read the absorbance OD value under the condition of double-wavelength measurement at the test wavelength of 450 nm and the reference wavelength of 630 nm. Among them, the OD value of the negative quality control is recorded as ODN value, the OD value of the positive quality control is recorded as ODP value, and the OD value of the sample to be tested is recorded as ODS value.
[0172] The detection condition is that ODN value > 0.5 and ODP value < 0.2, and the detection result is valid; otherwise, re-detect.
[0173] Result judgment: ODS value of the sample to be tested / ODN value of the negative quality control ≤0.20, the result is positive;
[0174] ODS value of the sample to be tested / ODN value of the negative quality control >0.3, the result is negative;
[0175] 0.2<ODS value of the sample to be tested / ODN value of the negative quality control ≤0.30, the result is suspicious; re-detect the ODS value of the sample to be tested, and the ODS value of the re-detection / ODN value of the negative quality control ≤0.20, the result is positive, and the ODS value of the re-detection / ODN value of the negative quality control >0.30, the result is negative.
[0176] Example 8, kit for detecting O foot-and-mouth disease virus antibody based on magnetic microparticle chemiluminescence:
[0177] In this embodiment, the working principle of the kit for detecting O-type foot-and-mouth disease virus antibody based on magnetic microparticle chemiluminescence method is as follows: the sample to be tested, biotin-labeled O-type foot-and-mouth disease virus virus-like particles, acridinium ester-labeled polyclonal antibody, and streptavidin magnetic beads are mixed and incubated, the O-type foot-and-mouth disease virus antibody in the sample to be tested and the polyclonal antibody competitively bind to the biotin-labeled O-type foot-and-mouth disease virus virus-like particles to form immune complexes, respectively, and the immune complexes are formed. After removing the unbound impurities by washing, the excitation solution is added to promote the luminescence of the immune complex, and the relative luminescence intensity (RLU) is measured. Within a certain range, RLU is inversely proportional to the titer of O-type foot-and-mouth disease virus antibody, and the standard curve built in the instrument is used to output RLU and the corresponding O-type foot-and-mouth disease virus antibody titer.
[0178] In this embodiment, the main components of the kit for detecting O-type foot-and-mouth disease virus antibody based on magnetic microparticle chemiluminescence method are: magnetic bead working solution, antigen working solution, acridinium ester label working solution, pre-excitation solution, excitation solution, calibration sample, positive quality control, and negative quality control.
[0179] Magnetic bead working solution: prepared from 225 uL of streptavidin magnetic beads and 4275 uL of PBS-BSA solution (pH=7.4).
[0180] Antigen working solution: 100 ug of biotin-labeled virus-like particles of O-type foot-and-mouth disease virus and 9900 μL of PBS-BSA solution (pH = 7.4) were prepared.
[0181] Acridinester-labeled working solution: 1.5 ug of acridinester-labeled polyclonal antibody and 10 mL of PBS-BSA solution (pH = 7.4) were prepared.
[0182] Pre-priming solution: 0.1 mol / L nitric acid, 0.13 mol / L urea peroxide, and physiological saline.
[0183] Primed solution: 0.4 mol / L sodium hydroxide, 0.02 mol / L Triton X-100 (English name: Triton x-100, CAS number: 9002-93-1), and physiological saline.
[0184] The working process of detecting foot-and-mouth disease virus-O antibody based on magnetic particle chemiluminescence method includes the following steps:
[0185] Mix 10 μL of the sample to be tested, 50 μL of the antigen working solution, 20 μL of the magnetic bead working solution, and 50 μL of the acridinester-labeled working solution uniformly, react at 37℃ for 15 min, wash with 0.1 mol / L PBST buffer solution, add 100 μL of pre-priming solution and 100 μL of priming solution, and detect RLU value.
[0186] Establishment of standard curve: The neutralizing antibody titer of the O-type foot-and-mouth disease virus antibody positive serum detected by the antibody neutralization experiment method in GB / T 18935-2018 "Foot-and-mouth disease diagnostic technology" is 1:8192, and the specific pathogen free (SPF) pig serum is used as a diluent. The O-type foot-and-mouth disease virus antibody positive serum is diluted by 2 times gradient, and positive sera with neutralizing antibody titers of 1:4096, 1:2048, 1:1024, 1:512, 1:256, 1:128, 1:64, 1:32, 1:16, and 1:8 are obtained.
[0187] Select the positive sera with neutralizing antibody titers of 1:512, 1:256, 1:128, 1:64, 1:32, and 1:16 as calibration samples, and sequentially record them as calibration sample 1, calibration sample 2, calibration sample 3, calibration sample 4, calibration sample 5, and calibration sample 6. During detection, add them in order, and the instrument automatically recognizes and detects to generate a standard curve.
[0188] Detection condition: The antibody titer of the positive quality control is between 1:512 and 1:2048, and the antibody titer of the negative quality control is <1:8.
[0189] Quantitative result determination: the standard curve is automatically calculated by the instrument, and the result displayed is the neutralizing antibody titer of the sample to be tested.
[0190] Qualitative result determination: when the neutralizing antibody titer is ≥1:128, it is determined that the O foot-and-mouth disease virus antibody is positive;
[0191] When the neutralizing antibody titer is ≤1:64, it is determined that the O foot-and-mouth disease virus antibody is negative.
[0192] When the neutralizing antibody titer is 1:64≤1:128, it is determined to be suspicious; the neutralizing antibody titer of the sample to be tested is retested, and when the retested neutralizing antibody titer is ≥1:128, it is determined to be positive, and when the retested neutralizing antibody titer is <1:128, it is determined to be negative.
[0193] Performance test of kit:
[0194] Sensitivity test:
[0195] The sensitivity control samples were detected by the kit for detecting O foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent method, the kit for detecting O foot-and-mouth disease virus antibody based on magnetic particle chemiluminescence immunoassay and the liquid phase blocking ELISA detection kit for O type foot-and-mouth disease antibody of the present application. Among them, the sensitivity control sample is prepared by 2-fold gradient dilution of O foot-and-mouth disease virus antibody positive serum with known neutralizing antibody titer, and the neutralizing antibody titers of the sensitivity control samples are 1:8192, 1:4096, 1:2048, 1:1024, 1:512, 1:256, 1:128, 1:64, 1:32, 1:16, 1:8, respectively.
[0196] Among them, the sensitivity detection results of the kit for detecting O foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent method of the present application are shown in Table 10.
[0197] Table 10, the sensitivity detection results of the kit for detecting O foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent method of the present application:
[0198]
[0199] Among them, the sensitivity detection results of the kit for detecting O foot-and-mouth disease virus antibody based on magnetic particle chemiluminescence immunoassay of the present application are shown in Table 11.
[0200] Table 11, the sensitivity detection results of the kit for detecting O foot-and-mouth disease virus antibody based on magnetic particle chemiluminescence immunoassay of the present application:
[0201]
[0202] The sensitivity test results of the certain FMDV O antibody liquid-phase blocking ELISA detection kit are shown in Table 12.
[0203] Table 12, the sensitivity test results of the certain FMDV O antibody liquid-phase blocking ELISA detection kit:
[0204]
[0205] It can be seen from Tables 10-12 that the sensitivity of the kit for detecting O type foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent assay and the kit for detecting O type foot-and-mouth disease virus antibody based on magnetic particle chemiluminescence immunoassay of the present application is obviously superior to the sensitivity of the FMDV O antibody liquid-phase blocking ELISA detection kit.
[0206] Specificity (cross reaction) test:
[0207] The antibody positive sera of A type foot-and-mouth disease virus, Asia I type foot-and-mouth disease virus, swine fever virus, porcine reproductive and respiratory syndrome virus, and canine parvovirus were detected by the kit for detecting O type foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent assay and the kit for detecting O type foot-and-mouth disease virus antibody based on magnetic particle chemiluminescence immunoassay of the present application, respectively, with virus-like particles IV as the competitive antigen and polyclonal antibody IV as the labeled antibody. The specificity test results are shown in Table 13.
[0208] Table 13, specificity test results:
[0209]
[0210] It can be seen from Table 13 that the kit for detecting O type foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent assay and the kit for detecting O type foot-and-mouth disease virus antibody based on magnetic particle chemiluminescence immunoassay of the present application have no cross-reaction with other susceptible animal virus antibodies.
[0211] Conformity test:
[0212] 326 foot-and-mouth disease clinical samples were simultaneously detected by the kit for detecting O type foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent assay, the kit for detecting O type foot-and-mouth disease virus antibody based on magnetic particle chemiluminescence immunoassay of the present application, and the FMDV O antibody liquid-phase blocking ELISA detection kit, with virus-like particles IV as the competitive antigen and polyclonal antibody IV as the labeled antibody.
[0213] The coincidence rate test results of the kit for detecting O type foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent assay of the present application are shown in Table 14.
[0214] Table 14: Specificity test results of the kit for detecting O-type foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent assay
[0215]
[0216] In the above, the specificity test results of the kit for detecting O-type foot-and-mouth disease virus antibody based on magnetic microparticle chemiluminescence immunoassay are shown in Table 15.
[0217] Table 15: Coincidence rate test results of the kit for detecting O-type foot-and-mouth disease virus antibody based on magnetic microparticle chemiluminescence immunoassay
[0218]
[0219] As can be seen from Tables 14 and 15, compared with the standard method and the international trade designated method recommended by the World Organization for Animal Health (WOAH) for detecting foot-and-mouth disease virus antibody, i.e., liquid-phase blocking ELISA method, the coincidence rate of the kit for detecting O-type foot-and-mouth disease virus antibody based on enzyme-linked immunosorbent assay is 97.46%, and the coincidence rate of the kit for detecting O-type foot-and-mouth disease virus antibody based on magnetic microparticle chemiluminescence immunoassay is 98.10%.
[0220] The above provides a detailed introduction to the O-type foot-and-mouth disease virus multi-epitope VP1 fusion protein, virus-like particles, and polyclonal antibody and their uses. This paper applies specific examples to explain the principles and implementation modes of the present application. The above description of the examples is only used to help understand the method of the present application and its core idea. It should be pointed out that for those skilled in the art, without departing from the principles of the present application, some improvements and modifications can be made to the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.
Claims
1. A multi-epitope VP1 fusion protein of type O foot-and-mouth disease virus, characterized in that, The structure of the multi-epitope VP1 fusion protein is shown in formula (I): ; Wherein, AAS1 represents the amino acid sequence as shown in SEQ ID NO.1; AAS2 represents the amino acid sequence shown in SEQ ID NO.2; AAS3 represents the amino acid sequence shown in SEQ ID NO.3; AAS4 represents the amino acid sequence shown in SEQ ID NO.4; AAS5 represents the amino acid sequence shown in SEQ ID NO.5; AAS6 represents the amino acid sequence shown in SEQ ID NO.6; L1, L2, L3, L4, and L5 each independently represent a flexible linker peptide; L1, L2, L3, L4, and L5 each independently represent an amino acid sequence from the N-terminus to the C-terminus. n is selected from integers from 1 to 4.
2. The multi-epitope VP1 fusion protein according to claim 1, characterized in that, The amino acid sequence of the multi-epitope VP1 fusion protein is shown in SEQ ID NO.
11.
3. A nucleic acid molecule, characterized in that, The nucleic acid molecule includes the structure shown in formula (II): ; Wherein, NAS1 represents the nucleotide sequence shown in SEQ ID NO.23; NAS2 represents the nucleotide sequence shown in SEQ ID NO.24; NAS3 represents the nucleotide sequence shown in SEQ ID NO.25; NAS4 represents the nucleotide sequence shown in SEQ ID NO.26; NAS5 represents the nucleotide sequence shown in SEQ ID NO.27; NAS6 represents the nucleotide sequence shown in SEQ ID NO.28; L1', L2', L3', L4', and L5' each independently represent the nucleotide sequence encoding the flexible linker peptide; L1', L2', L3', L4', and L5' each independently represent the nucleotide sequence from the 5' end to the 3' end. , where n' is selected from integers from 1 to 4.
4. The nucleic acid molecule according to claim 3, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.
33.
5. A recombinant plasmid, characterized in that, The recombinant plasmid comprises the nucleic acid molecule as described in any one of claims 3 to 4.
6. A gene expression vector, characterized in that, The gene expression vector comprises the nucleic acid molecule as described in any one of claims 3 to 4.
7. A virus-like particle of type O foot-and-mouth disease virus, characterized in that, The virus-like particles comprise: (I) A multi-epitope VP1 fusion protein, the amino acid sequence of which is shown in SEQ ID NO.11; (II) VPO protein, the amino acid sequence of which is shown in SEQ ID NO.34; (III) VP3 protein, the amino acid sequence of which is shown in SEQ ID NO.
37.
8. A combination of nucleic acid molecules, characterized in that, The nucleic acid molecule combination comprises: (I) A nucleic acid molecule expressing a multi-epitope VP1 fusion protein, the nucleotide sequence of which is shown in SEQ ID NO.33; (II) A nucleic acid molecule expressing the VPO protein, the nucleotide sequence of which is shown in SEQ ID NO.36; (III) A nucleic acid molecule expressing the VP3 protein, the nucleotide sequence of which is shown in SEQ ID NO.
39.
9. A recombinant plasmid combination, characterized in that, The recombinant plasmid combination comprises: (I) A recombinant plasmid containing the nucleotide sequence shown in SEQ ID NO.33; (II) A recombinant plasmid containing the nucleotide sequence shown in SEQ ID NO.36; (III) A recombinant plasmid containing the nucleotide sequence shown in SEQ ID NO.
39.
10. A gene expression vector combination, characterized in that, The gene expression vector combination comprises: (I) A gene expression vector containing the nucleotide sequence shown in SEQ ID NO.33; (II) Gene expression vectors containing the nucleotide sequence shown in SEQ ID NO.36; (III) Gene expression vectors containing nucleotide sequences as shown in SEQ ID NO.
39.
11. Use of the multi-epitope VP1 fusion protein as described in any one of claims 1 to 2, and / or the nucleic acid molecule as described in any one of claims 3 to 4, and / or the recombinant plasmid as described in claim 5, and / or the gene expression vector as described in claim 6, and / or the virus-like particle as described in claim 7, and / or the combination of nucleic acid molecules as described in claim 8, and / or the combination of recombinant plasmids as described in claim 9, and / or the combination of gene expression vectors as described in claim 10, in the preparation of an antibody product for detecting type O foot-and-mouth disease virus.
12. A kit for detecting type O foot-and-mouth disease virus antibodies based on enzyme-linked immunosorbent assay (ELISA), characterized in that, It includes competitive antigens and labeled antibodies; The competing antigen is the virus-like particle as described in claim 7; The labeled antibody is a horseradish peroxidase-labeled polyclonal antibody; the immunogen of the polyclonal antibody is the virus-like particle as described in claim 7.
13. A kit for detecting type O foot-and-mouth disease virus antibodies based on magnetic microparticle chemiluminescence immunoassay, characterized in that, It includes competitive antigens and labeled antibodies; The competing antigen is a biotin-labeled virus-like particle as described in claim 7; The labeled antibody is an acridine ester-labeled polyclonal antibody; the immunogen of the polyclonal antibody is the virus-like particle as described in claim 7.
Citation Information
Patent Citations
O-type foot-and-mouth disease virus multi-epitope virus-like particle antigen as well as preparation method and application thereof
CN116041547A
O-type foot-and-mouth disease virus multi-epitope bionic nano self-assembled virus-like particle as well as preparation method and application thereof
CN116286682A