A method for preparing a ratiometric electrochemical biosensor and detecting L1CAM-type extracellular vesicles

Abstract

This invention provides a yly12 nucleic acid aptamer containing a single-stranded DNA with the following sequence: 5'-HS-SH-(CH2)6-T MB TTTTTTTTAGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTG GTGGGTCTTCTG-3'. This invention also provides a GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor, its preparation, detection, and application. This invention combines the redox properties of DSPE-PEG molecules with ratiometric electrochemical sensing technology. The complex formed by DSPE-PEG modification not only achieves stable electrochemical signal output but also significantly enhances the detection signal of L1CAM-EVs. This invention constructs a sensitive, efficient, and easy-to-operate electrochemical detection strategy, providing a novel approach and technical support for the accurate detection of L1CAM-EVs.

Description

Technical Field

[0001] This invention belongs to the field of biochemical detection, specifically relating to a yly12 nucleic acid aptamer, a ratiometric electrochemical biosensor, its preparation method, and its application. Background Technology

[0002] Brain-derived extracellular vesicles (BDEVs) are heterogeneous, bilayered nanovesicles released by various nerve cells within the central nervous system. They carry biomolecular information from their source cells and play a crucial role in the physiological and pathological states of the brain. Analyzing the quantity and composition of BDEVs can provide important information on the progression of neurological diseases, aiding in early diagnosis, disease monitoring, and treatment strategy evaluation. Among these, vesicles specifically expressing the L1CAM (neural cell adhesion molecule L1) protein (L1CAM-EVs) are considered important biomarkers for the diagnosis of neurological diseases. Accurate quantification and detection of the quantity of L1CAM-EVs in plasma are essential for disease diagnosis, disease progression tracking, and efficacy evaluation.

[0003] However, current methods for detecting L1CAM-EVs have many limitations. For example, nanoparticle tracking analysis (NTA) cannot distinguish vesicle origins and has low sensitivity for detecting low concentrations and small-diameter vesicles; flow cytometry, due to insufficient equipment resolution, cannot accurately detect all L1CAM-EVs; transmission electron microscopy (TEM) involves cumbersome sample preparation, making it difficult to analyze large batches of samples; and Western blot technology only provides relative quantitative information and cannot accurately measure vesicle concentration. Therefore, there is an urgent need for a simple, sensitive, and specific method to achieve accurate quantification of L1CAM-EVs.

[0004] Electrochemical detection has been widely used in clinical practice due to its advantages of speed, low cost, and ease of operation. However, to improve detection sensitivity, existing electrochemical detection methods often rely on signal amplification strategies using nucleic acid amplification, nanomaterials, or enzymes. These complex steps diminish their ease of use and low cost advantages. In recent years, membrane affinity molecules have been used for the separation of extracellular vesicles (EVs) due to their high affinity for the phospholipid bilayer. Summary of the Invention

[0005] The purpose of this invention is to address the above-mentioned technical problems by providing a ratiometric electrochemical biosensor capable of rapidly and accurately detecting L1CAM-EVs in plasma.

[0006] To achieve the above-mentioned objectives, the present invention provides a yly12 nucleic acid aptamer, wherein the yly12 nucleic acid aptamer is a single-stranded DNA containing the following sequence: 5'-HS-SH-(CH2)6-T MB TTTTTTTTAGGATAGGGGGT AGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTG-3'.

[0007] On the other hand, the present invention also provides a GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor containing the yly12 nucleic acid aptamer.

[0008] On the other hand, the present invention also provides a method for preparing the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor, the method comprising the following steps:

[0009] (1) Pretreatment of gold electrodes;

[0010] (2) Preparation of modified gold electrodes using modified yly12 aptamers;

[0011] (3) Modification of MCH anti-fouling coating;

[0012] (4) Modified yly12 aptamer captures L1CAM-EVs;

[0013] (5) DSPE-PEG modified vesicles to form the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor.

[0014] Preferably, in step (1), the pretreatment steps of the gold electrode are as follows: polishing and grinding the gold electrode with alumina powder with particle sizes of 0.3μm and 0.05μm until the surface of the gold electrode is as smooth as a mirror, and then ultrasonically cleaning it with deionized water; then cleaning it sequentially with 0.1M NaOH solution for 10min, 0.1M HCl solution for 5min, piranha solution for 3min, and then ultrasonically cleaning it with ethanol and deionized water for 5min.

[0015] Preferably, in step (2), the preparation steps of the modified yly12 aptamer-modified gold electrode are as follows: the pretreated gold electrode is immersed in a 1 μM modified yly12 aptamer solution and incubated at 4°C for 12 hours.

[0016] Preferably, in step (3), the modification step of the MCH antifouling coating is as follows: soak the gold electrode treated in step (2) in a 0.1 mM MCH solution.

[0017] Preferably, in step (4), the modified yly12 aptamer captures L1CAM-EVs as follows: 10 μL of L1CAM-EVs is dropped onto the electrode after step (3) to capture the target.

[0018] Preferably, in step (5), the DSPE-PEG modified vesicle step is as follows: 10 μL of 1 μM DSPE-PEG solution is dropped onto the electrode surface treated in step (3), incubated at 4 °C for 30 min to form a complex, and then washed with PBS.

[0019] This invention also provides a method for detecting L1CAM-EVs based on a GE / MB-yly12 / EVs@DSPE-PEG biosensor. The method includes: immobilizing the yly12 nucleic acid aptamer on an electrode surface as an affinity capture ligand; using MCH as an antifouling coating to block the remaining active sites on the gold electrode surface; after capturing L1CAM-EVs, modifying the vesicles with DSPE-PEG to form a complex EVs@DSPE-PEG with an electrochemical signal, and then performing detection.

[0020] The method of the present invention fixes the yly12 aptamer carrying the methylene blue signal tag onto the electrode as an affinity capture ligand to form the first signal molecule. After capturing L1CAM-EVs, it is modified with DSPE-PEG to form a complex EVs@DSPE-PEG to form the second signal molecule and amplify the detection signal, thus forming a highly efficient amplified ratiometric electrochemical biosensor.

[0021] This invention provides a ratiometric electrochemical biosensor and detection method for rapid and accurate detection of L1CAM-EVs in plasma. The method utilizes the yly12 nucleic acid aptamer targeting the L1CAM protein, which undergoes sequence extension and is labeled with a methylene blue (MB) signal tag. The yly12 aptamer is immobilized on the electrode surface as an affinity trapping ligand, and MCH is used as an antifouling coating to block residual active sites on the gold electrode surface. Subsequently, the yly12 aptamer traps L1CAM-EVs, and the L1CAM-EVs are modified with DSPE-PEG to form an electrochemically potentiated complex EVs@DSPE-PEG. The high binding efficiency of DSPE-PEG successfully enhances the electrochemical signal. Without complex signal amplification, the calculated detection limit of L1CAM-EVs in this platform is 8.92 × 10⁻⁶. 2 particles / mL.

[0022] The present invention has the following advantages over the prior art:

[0023] (1) By using the yly12 nucleic acid aptamer targeting L1CAM protein, its sequence is extended and labeled with methylene blue (MB) signal tag, which can effectively avoid interference from other proteins on the surface of exosomes, thereby significantly improving the specificity of plasma L1CAM-EVs detection;

[0024] (2) The complex EVs@DSPE-PEG formed by DSPE-PEG modification was used as a redox probe and a signal amplification probe to construct a ratiometric electrochemical biosensor by significantly amplifying the electrochemical signal.

[0025] (3) The gold electrode GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor constructed based on the electrochemical analysis platform can quickly and accurately detect L1CAM-EVs in plasma. Attached Figure Description

[0026] Figure 1 This is a schematic diagram of the structure of DSPE-PEG and a schematic diagram of the electrochemical properties of the composite EVs@DSPE-PEG.

[0027] Figure 2 Potentiograms for verifying DSPE-PEG, EVs@DSPE-PEG, and EVs in SWV experiments.

[0028] Figure 3 Potentiogram of the MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG modified electrode.

[0029] Figure 4 This is a cyclic voltammogram of an electrochemical biosensor in a standard solution of brain-derived extracellular vesicles.

[0030] Figure 5 This is a schematic diagram illustrating the fabrication process of the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor and its detection of L1CAM-EVs.

[0031] Figure 6 Current standard curves were constructed for the detection of different concentrations of L1CAM-EVs using the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor.

[0032] Figure 7 A statistical analysis of L1CAM-EVs levels in the plasma of AD, MCI, and healthy controls. Detailed Implementation

[0033] To better illustrate the technical objectives, solutions, and advantages of this invention, the following description, in conjunction with the accompanying drawings and specific embodiments, further clarifies the invention. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0034] Blood samples were collected from the Department of Laboratory Medicine at Guangdong Provincial Hospital of Traditional Chinese Medicine, using leftover specimens from patients and healthy individuals undergoing physical examinations. The project was approved by the Ethics Committee of Guangdong Provincial Hospital of Traditional Chinese Medicine (ethics number ZE2024-189-01).

[0035] 1. Modification and synthesis of yly12 aptamers

[0036] 1.1 Synthesis of modified yly12 nucleic acid aptamers

[0037] The aptamer yly12, which specifically binds to the L1CAM protein, has a secondary structure that forms a stem-loop to recognize the L1CAM protein. Its nucleotide sequence is shown below: 5'-AGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTG-3'.

[0038] To improve the stability of the DNA aptamer while maintaining the above sequence, nine thymine deoxyribonucleotides (T) were added to one end. Based on this, the yly12 nucleic acid aptamer was synthesized. To enable the nucleic acid aptamer to attach to the gold electrode, a -SH modification (dithiol hexaalkylene modification) annealing was performed at the 5' end. Furthermore, a methylene blue (MB) signal tag was modified onto the first thymine deoxyribonucleotide (T) of the extended chain to form an electrical signal. The modified aptamer was synthesized by Shanghai Sangon Biotech Co., Ltd.

[0039] The complete modified yly12 aptamer sequence is as follows:

[0040] 5'-HS-SH-(CH2)6-T MB TTTTTTTTAGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTG-3'.

[0041] 2. Fabrication of a GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor

[0042] 2.1 Preparation of DSPE-PEG solution

[0043] Dissolve 2 mg of DSPE-PEG in 10 mL of PBS solution to form a 100 μM stock solution. Then take 10 μL of the 100 μM stock solution and dilute it to 1 mL with PBS to form a 1 μM DSPE-PEG solution.

[0044] 2.2 Preparation of modified yly12 aptamer solution

[0045] The modified yly12 nucleic acid aptamer was added to a quantitative amount of TE buffer to prepare a 100 μM stock solution. 5 μL of the stock solution was added to 455 μL of pure water and diluted to a 1 μM working solution.

[0046] 2.3 Extraction of L1CAM-EVs

[0047] Remove the plasma sample and place it on ice. Centrifuge the plasma sample at 2000×g for 20 minutes at room temperature to remove cells and debris. Transfer the required volume of clear plasma to a new test tube and add 0.5 volumes of 1×PBS. Vortex to thoroughly mix the sample with the PBS. Add 0.2 volumes (total volume = plasma + PBS) of exosome precipitation reagent (Total Exosome Separation Kit (from Plasma), Catalog No. 4484450, Invitrogen) to the sample. TM After standing at room temperature for 10 minutes, the sample was centrifuged at 10000×g for 5 minutes at room temperature. The supernatant was then removed and the sample was reconstituted with PBS.

[0048] L1CAM-EVs were isolated from total EVs using immunoprecipitation. The suspended total EVs were treated with 4 μg of L1CAM antibody (catalog number 67115-1-Ig, Wuhan Sanying) in 50 μL of 3% BSA-PBS and gently incubated at 4°C for 1 hour. Subsequently, 15 μL of streptavidin mixed with 25 μL of 3% BSA in Ultralink resin (catalog number 53113, Thermo Scientific) was added. TM The mixture was incubated by gentle rotation at 4°C for another 30 minutes. After incubation, the mixture was centrifuged at 200×g for 10 minutes at 4°C, and the supernatant was discarded. The resulting precipitate was resuspended in 50 μL of 0.1M glycine-HCl (pH 2.5–3.0) and vigorously mixed for 30 seconds. The solution was then centrifuged at 4500×g for 5 minutes at 4°C. The supernatant containing the separated vesicles was carefully collected and its pH was adjusted to neutral using 1×PBS (pH 8.0). Finally, the enriched L1CAM-EVs were stored at -80°C for future use.

[0049] 2.4 Pretreatment of Gold Electrodes (GE)

[0050] First, the gold electrode was carefully polished using alumina powders with particle sizes of 0.3 μm and 0.05 μm until the surface was as smooth as a mirror. Then, it was ultrasonically cleaned with deionized water. Next, it was sequentially cleaned with 0.1 M NaOH solution for 10 min, 0.1 M HCl solution for 5 min, and piranha solution (31% H₂O₂ / concentrated H₂SO₄ mixed at a volume ratio of 1:3) for 3 min. Finally, it was ultrasonically cleaned with ethanol and deionized water for 5 min. The ultrasonic cleaning conditions were: frequency 40 kHz, cleaning time 5-10 minutes, and temperature controlled at room temperature (20-25℃).

[0051] 2.5 Preparation of modified yly12 aptamer-modified gold electrodes

[0052] The pretreated gold electrode was immersed in a modified yly12 aptamer solution (1 μM) and incubated at 4 °C for 12 hours. The yly12 nucleic acid aptamer-modified gold electrode (GE / yly12) was washed three times with deionized water and PBS, and stored in PBS for further use. Thus, GE / MB-yly12 was formed.

[0053] 2.6 Modification of MCH anti-fouling coating

[0054] The gold electrode was immersed in a 0.1 mM MCH (6-mercapto-1-hexanol) solution to occupy unbound aptamer sites and prevent nonspecific binding. This resulted in the formation of GE / MB-yly12 / MCH.

[0055] 2.7 Modified yly12 aptamer captures L1CAM-EVs

[0056] 10 μL of L1CAM-EVs were dropped onto the electrode to capture the target, forming GE / MB-yly12 / MCH / L1CAM-EVs.

[0057] 2.8 Formation of the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG complex

[0058] 10 μL of 1 μM DSPE-PEG solution was drop-coated onto the surface of GE / MB-yly12 / MCH and incubated at 4 °C for 30 min to form a complex, followed by washing with PBS. This resulted in a GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor.

[0059] Figure 5 The fabrication process of the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor is shown.

[0060] 2.9 Characterization of the GE / MB-yly12 / MCH / EVs@DSPE-PEG electrochemical biosensor

[0061] The electroactive properties of [Fe(CN)6] were examined using cyclic voltammetry. 3- / 4- Whether the preparation of the sensing interface in the KCl solution (0.1 M) where the probe is present was successful. Due to [Fe(CN)6] 3- / 4- The electron transfer efficiency between the electrode and the bare gold electrode is very high, exhibiting a strong, reversible, and well-defined current peak. For example... Figure 4 As shown, the electrochemical biosensor operates at 2.1 × 10⁻⁶. 8 Cyclic voltammetry in standard brain-derived extracellular vesicle solutions at particle / mL, scan rate 50 mV / s. Figure 4 In the figure, curve a shows the current response of the bare gold electrode (GE), curve b shows a decrease in current after immobilization of the yly12 nucleic acid aptamer, and curve c shows a slight decrease in peak current after the introduction of the antifouling coating MCH. This is due to the negative charge and steric hindrance effect of MCH on [Fe(CN)6]. 3- / 4- The repulsive effect resulted in a decrease in peak current, indicating the successful construction of the GE / MB-yly12 / MCH biosensor, capable of effectively detecting L1CAM-EVs. Subsequently, when detecting L1CAM-EVs, as... Figure 4 As shown by curve d, the current further decreases; as shown by curve e, with the formation of the EVs@DSPE-PEG complex after modification with DSPE-PEG, the current gradually decreases, ultimately forming a ratiometric electrochemical biosensor. In a solution containing 0.1 M KCl and 1 mM Fe(CN)6... 3- / 4- The electrochemical cyclic voltammetry analysis in the (1:1) solution was performed at a frequency of 10. -2 ~10 5 Hz, amplitude is 10mV / s.

[0062] 2.10 Detection of L1CAM-EVs using the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG electrochemical biosensor

[0063] Total exosomes were extracted from plasma using a plasma exosome extraction kit (Invitrogen), and L1CAM-EVs were extracted using an L1CAM antibody. Nanoparticle tracking analysis (NTA) was then performed to determine the concentration of extracted brain-derived exosomes. L1CAM-EVs were diluted with PBS to a concentration of 2.1 × 10⁻⁶. 10 L1CAM-EVs stock solution containing particles / mL was prepared by further reconstituted with PBS to a concentration of 2.1 × 10⁻⁶. 3 -2.1×108 Linearity and sensitivity were evaluated using L1CAM-EVs solutions containing particles / mL. The linear range of this detection method was then established.

[0064] MB-yly12 / MCH modified gold electrodes were drop-coated with 10 μL L1CAM-EVs for 30 min, then washed three times with deionized water and PBS to remove non-specific adsorption. Next, 10 μL (1 μM) of a redox signal amplification electrochemical probe, DSPE-PEG, was added to the electrode surface. The solution on the electrode surface was allowed to air dry, followed by washing three times with deionized water and PBS, and then SWV testing was performed. Electrochemical square wave voltammetry was performed in 1xPBS solution at pH 7.4, with a test frequency of 10. -2 ~10 5 Hz, amplitude is 10mV / s.

[0065] 3. Characterization and electrochemical property verification of DSPE-PEG, EVs@DSPE-PEG, and EVs

[0066] 3.1 Verification of the redox properties of DSPE-PEG in electrolyte solution

[0067] The electrochemical properties of DSPE-PEG were investigated in 1×PBS. See the schematic diagram below for details. Figure 1 .

[0068] The SWV (square wave voltammetry) response of a bare gold electrode in a 1 μM DSPE-PEG solution showed a peak current of approximately 0.3 V, corresponding to the electrochemical redox signal of DSPE-PEG. DSPE-PEG is an amphiphilic molecule composed of hydrophobic DSPE (stearoylphosphatidylethanolamine) and hydrophilic PEG (polyethylene glycol). The amide bond connecting DSPE and PEG provides an electrochemical signal in the electrolyte solution, forming a redox potential, such as... Figure 2 As shown.

[0069] Electrochemical square wave voltammetry was performed in 1×PBS solution at a frequency of 10. -2 ~10 5 The amplitude of the square wave is between 10 and 50 mV, the step voltage is between 1 and 5 mV, usually set to 2 mV, and the voltage range is set to -0.2 V to 0.7 V for quantitative analysis.

[0070] 3.2 Verification of the redox properties of EVs@DSPE-PEG in electrolyte solution

[0071] The electrochemical properties of EVs@DSPE-PEG were investigated in 1×PBS.

[0072] To obtain the optimal ratio of DSPE-PEG-modified EVs, a 1 nM EVs (extracted according to method 2.3 above) was modified with a 1 μM DSPE-PEG solution to form a complex. Specifically, 20 μL of a 1×PBS solution containing 1 μM DSPE-PEG was coated onto a screen-printed gold electrode, and square wave voltammetry (SWV) analysis was performed. Then, 20 μL of EVs@DSPE-PEG solution (1 nM EVs, 1 μM DSPE-PEG) was analyzed under the same SWV conditions. The SWV experimental parameters were: potential scan range from -0.1 V to 0.8 V, step potential of 2 mV, amplitude of 20 mV, and frequency of 20 Hz.

[0073] The results showed a significant peak current at the electrode surface, around 0.3 V, indicating that the EVs@DSPE-PEG composite exhibits a significant redox signal, such as... Figure 2 As shown.

[0074] 3.3 Verification of the redox properties of EVs in electrolyte solution

[0075] The electrochemical properties of EVs were investigated in 1×PBS.

[0076] The validation was performed on the electrode by directly detecting 1 nM EVs in PBS. SWV analysis was performed on the individual EVs solution (1 nM). The experimental parameters for SWV were: potential scan range from -0.1 V to 0.8 V, step potential of 2 mV, amplitude of 20 mV, and frequency of 20 Hz.

[0077] The SWV results showed no peak current, confirming that EVs, when alone in solution, have no redox properties and cannot generate an electrical signal. Figure 2 As shown.

[0078] 3.4 MB-yly12 and EVs@DSPE-PEG modified electrodes ratio signal verification

[0079] The MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG modified electrode exhibits two oxidation peaks at -0.3V and 0.3V relative to the silver chloride reference electrode. Figure 3 (Curve a). Conversely, the MB-yly12 / MCH / L1CAM-EVs modified electrode without DSPE-PEG only showed a -0.3V peak ( Figure 3 Curve b), while no peaks were observed on the MCH / L1CAM-EVs@DSPE-PEG electrode without MB-yly12 modification. Figure 3(Curve c). These results indicate that the -0.3V peak corresponds to the redox potential of methylene blue (MB), while the 0.3V peak is related to the redox potential of EVs@DSPE-PEG.

[0080] Using the MB-derived peak current as a reference and the DSPE-PEG current as the output signal, the ratio (I) DSPE / I MB It enables ratio detection of L1CAM-EVs. Furthermore, compared to MB, the DSPE-PEG current is higher because each L1CAM-EV has multiple DSPE-PEG tags, thus improving sensitivity.

[0081] 4. Performance evaluation and clinical application of the GE / MB-yly12 / MCH / EVs@DSPE-PEG electrochemical biosensor

[0082] 4.1 L1CAM-EVs Electrochemical Detection Platform Based on MB-yly12 Aptamer

[0083] The yly12 aptamer targeting the L1CAM protein was sequence-extended and labeled with a methylene blue (MB) signal tag. The yly12 aptamer was immobilized on the electrode surface as an affinity trapping ligand, and MCH was used as an antifouling coating to block residual active sites on the gold electrode surface. Subsequently, the yly12 aptamer captured L1CAM-EVs, and L1CAM-EVs were modified with DSPE-PEG to form an electrochemically potentiated complex EVs@DSPE-PEG. The electrochemical signal was successfully amplified by the high binding efficiency of DSPE-PEG.

[0084] The GE / MB-yly12 / MCH / EVs@DSPE-PEG electrochemical ratio biosensor of this invention exhibits good detection performance, short analysis time, and low cost. For example... Figure 5 The diagram shown illustrates the fabrication process of the GE / MB-yly12 / MCH / EVs@DSPE-PEG electrochemical biosensor of the present invention and its detection of L1CAM-EVs.

[0085] 4.2 Performance Evaluation of GE / MB-yly12 / MCH / EVs@DSPE-PEG Ratioform Electrochemical Biosensor

[0086] To verify that the constructed GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor platform can be used for the quantitative detection of brain-derived extracellular vesicles, a standard curve was established using the platform to analyze extracted plasma brain-derived extracellular vesicles at a concentration of 2.1 × 10⁻⁶. 3particles / mL -2.1×10 8 particles / mL, as concentration increases I DSPE / I MB The value also increases accordingly. The change in net current ratio (I) DSPE / I MB The change was linearly related to the concentration of L1CAM-EVs (e.g., Figure 6 As shown), the relationship satisfies the equation Y = 0.2699lg[EVs] + 0.4496(R). 2 =0.9916). Furthermore, the total detection time of this biosensor is approximately 35 minutes, which is shorter than that of ELISA-based methods.

[0087] To further evaluate the selectivity of the GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor, extracellular vesicles derived from L-02, RWPE-1, and BEAS-2B cells were selected to assess the selectivity of the GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor of the present invention.

[0088] When the sample contains pure brain-derived extracellular vesicles (L1CAM-EVs) or a mixture containing L1CAM-EVs, I DSPE / I MB The value is enhanced, while when exosomes from other sources are used as analytes, I... DSPE / I MB The values ​​did not change significantly. The results indicate that the GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor of this invention exhibits high specificity for L1CAM-EVs.

[0089] 4.3 GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor used for detection of real samples.

[0090] Nanoparticle tracking analysis (NTA) is currently the mainstream method for exosome detection. However, NTA cannot distinguish vesicles from different sources, such as whether they originate from the brain. Furthermore, NTA may struggle to detect smaller vesicles, such as those smaller than 30 nanometers. Due to the low concentration of L1CAM-EVs, the detection limit of NTA is typically around 1 × 10⁻⁶. 6 particles / mL, low concentrations of L1CAM-EVs are difficult to detect.

[0091] Samples to be tested: (1) AD group: plasma samples from 25 patients with Alzheimer's disease who visited Guangdong Provincial Hospital of Traditional Chinese Medicine from August 2023 to April 2024, including 15 males and 10 females, with an average age of 74 years. All patients met the diagnostic criteria for Alzheimer's disease. (2) MCI group: plasma samples from 18 patients with mild cognitive impairment who visited Guangdong Provincial Hospital of Traditional Chinese Medicine from August 2023 to April 2024, including 7 males and 11 females, with an average age of 60 years. All patients met the diagnostic criteria for Alzheimer's disease. (3) Non-AD group (normal control): 25 plasma samples from normal elderly people, all of whom were elderly people who underwent normal physical examinations in the hospital and were not patients with Alzheimer's disease. All samples were collected by fasting venous serum separation and stored at -80℃. This study was approved by the Ethics Committee of Guangdong Provincial Hospital of Traditional Chinese Medicine (ethics number: ZE2024-189-01).

[0092] The above samples were detected using the GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor of the present invention. The detection results are as follows: Figure 7 The results showed that the increased proportion of L1CAM-EVs occurred in elderly AD patients, with the proportion in the AD group and MCI group being higher than that in the non-AD group (Control), P<0.05. The differences in current proportions between the two groups were statistically significant, P<0.05. In the AD group, the GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor of this invention exhibited good sensitivity, with a detection limit of 8.92 × 10⁻⁶. 2 particles / mL.

[0093] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor, characterized in that The modified yly12 nucleic acid aptamer; The modified yly12 nucleic acid aptamer is a single-stranded DNA containing the following sequence: 5'-HS-SH-(CH2)6-T MB TTTTTTTTAGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTG - 3' The GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor is prepared by the following steps: (1) Pretreatment of gold electrode; (2) Preparation of modified yly12 nucleic acid aptamer modified gold electrode; (3) Modification of MCH anti-fouling coating; (4) Capture of L1CAM-EVs by modified yly12 nucleic acid aptamer; (5) Modification of vesicles by DSPE-PEG to form the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor; In step (1), the pretreatment of the gold electrode is as follows: the gold electrode is polished and polished with 0.3 μm and 0.05 μm alumina powder until the surface of the gold electrode is as smooth as a mirror, and then ultrasonic cleaning is performed with deionized water; then sequentially clean with 0.1 M NaOH solution for 10 min, 0.1 M HCl solution for 5 min, and piranha solution for 3 min, and then ultrasonic clean with ethanol and deionized water for 5 min; In step (2), the preparation of the modified yly12 nucleic acid aptamer modified gold electrode is as follows: the pretreated gold electrode is immersed in a 1 μM modified yly12 nucleic acid aptamer solution and incubated at 4℃ for 12 hours; In step (3), the modification of the MCH anti-fouling coating is as follows: the gold electrode treated in step (2) is immersed in a 0.1 mM MCH solution; In step (4), the capture of L1CAM-EVs by the modified yly12 nucleic acid aptamer is as follows: 10 μL of L1CAM-EVs is drop-coated on the electrode treated in step (3) to capture the target; In step (5), the modification of the vesicles by DSPE-PEG is as follows: 10 μL of 1 μM DSPE-PEG solution is drop-coated on the electrode surface treated in step (3), and the complex is formed by incubation at 4℃ for 30 min, followed by washing with PBS.

Images