A method for rapid obtaining of transgenic raspberry plants
The Agrobacterium rhizogenes-mediated genetic transformation method for raspberries uses mature raspberry leaves as recipient material, simplifying the operation and shortening the cycle. This solves the problems of complexity and long cycle in existing raspberry genetic transformation technologies, and enables the efficient acquisition of transgenic raspberry plants.
Patent Information
- Application Number
- CN202510016624.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-06
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2045-01-06
AI Technical Summary
There are limited reports of successful genetic transformation of raspberries in the current technology, and most of them require plant tissue culture, which is a long cycle and complicated operation, making it difficult to quickly obtain transgenic raspberry plants.
Genetic transformation of raspberries was mediated by Agrobacterium rhizogenes ATCC15834-PK7WG2D.1, using mature raspberry leaves as recipient material. Transgenic hairy roots were obtained through co-culture, and transgenic plants were cultured, simplifying the operation and shortening the cycle.
It enables rapid acquisition of transgenic raspberry plants, shortening the cycle to 8-10 weeks. The operation is simple, requiring no plant tissue culture or aseptic operation, and has high transformation efficiency and easy access to recipient materials.
Smart Images

Figure CN119913195B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of plant transgenic technology, and in particular to a method for rapidly obtaining a transgenic raspberry plant. BACKGROUND
[0002] Raspberry (Rubus ideaus L.) is a perennial shrub fruit tree of the genus Rubus in the Rosaceae family. Raspberry is rich in various nutrients, including vitamins, minerals, amino acids and other bioactive substances beneficial to human health, and is a new emerging fruit for nutrition and health. The difficulty of adapting to cool and warm growth conditions, sensitivity to high temperature environment and low tolerance to high temperature are important factors restricting the widespread planting of raspberries. Traditional hybrid breeding methods have long cycles, large workloads and limited improvement range due to the influence of breeding material variation. With the rapid development of biotechnology, plant cell engineering and genetic engineering technology are becoming mature, which can improve the efficiency of breeding by using exogenous genes to control the directional improvement of traits while maintaining the relative stability of other traits of the variety, thereby providing a new way for breeding new raspberry varieties.
[0003] Research on raspberry genetic transformation is the basis of genetic engineering breeding, but there are very few successful reports on raspberry genetic transformation at home and abroad, and all of them are through plant tissue culture to obtain transgenic materials. Most domestic and foreign studies on raspberry genetic transformation use Agrobacterium-mediated method, and other genetic transformation methods such as gene gun method, PEG chemical mediation method and pollen tube channel method are less studied. There is no successful report on obtaining transgenic raspberry plants without tissue culture at home and abroad. SUMMARY
[0004] The present application aims to overcome the shortcomings of the prior art and provides a method for rapidly obtaining a transgenic raspberry plant. The present application uses mature raspberry leaves as the receptor material and uses Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 to mediate raspberry genetic transformation. This method has the advantages of simple method, short culture period and no need for tissue culture.
[0005] To achieve the above-mentioned purpose, the technical scheme designed by the present application is as follows:
[0006] The present application provides a method for rapidly obtaining a transgenic raspberry plant, comprising the following steps:
[0007] (1) Preparing receptor material: selecting mature leaves from the top of seedling raspberry and cutting new wounds at the petiole as receptor material;
[0008] (2) Infection: the receptor material is dipped in Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 bacteria to perform infection;
[0009] (3) Co-culture: the infected receptor material is inserted into a soil matrix to perform co-culture;
[0010] (4) Selection culture: the co-cultured receptor material is applied with an antibiotic, the antibiotic is applied once a week, and a transgenic raspberry plant is obtained after culture.
[0011] Further, in the step (1), the mature leaf is sterilized in 1 ‰ potassium permanganate diluent for 10-15 min.
[0012] Further, in the step (2), the Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 carries a PK7WG2D.1 plasmid, and the PK7WG2D.1 plasmid carries an EGFP reporter gene after a proID promoter;
[0013] The infection time is 3-5 s.
[0014] Further, the nucleotide sequence of the EGFP reporter gene is shown in SEQ ID NO: 1; and the infection time is 5 s.
[0015] Further, the preparation method of the bacteria of the Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 includes the following steps:
[0016] 1) The PK7WG2D.1 plasmid is electroporated into the competent cell ATCC15834 of the Agrobacterium rhizogenes to obtain the Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 single colony;
[0017] 2) The Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 single colony is streaked on a TY solid culture medium containing an antibiotic to activate and grow a single colony;
[0018] 3) The single colony is inoculated in a TY liquid culture medium containing an antibiotic to activate and culture, and an activated bacteria solution is obtained;
[0019] 4) The activated bacteria solution is inoculated in a TY liquid culture medium containing an antibiotic to culture and obtain a bacteria solution;
[0020] 5) The bacteria solution is centrifuged to collect bacteria, resuspended in a MMA resuspension solution, and then cultured and centrifuged to collect bacteria, thereby obtaining the bacteria of the Agrobacterium rhizogenes ATCC15834-PK7WG2D.1.
[0021] Further, in the TY solid culture medium containing an antibiotic and the TY liquid culture medium containing an antibiotic, the antibiotic is spectinomycin, and the content of the spectinomycin is 100 mg / L.
[0022] Further, in the step 2), the condition of the line activation is dark culture for 2 days in a 28 DEG C constant temperature box;
[0023] In the step 3), the condition of the activation culture is 28 DEG C, 200 rpm vibration culture for 12-16 hours;
[0024] In the step 4), the volume ratio of the activated bacteria liquid and the TY liquid medium containing antibiotics is 1:900-1000, and the culture condition is 28 DEG C, 200 rpm vibration culture until the OD600 of the bacteria liquid is 0.8-1.0;
[0025] In the step 5), the components of the MMA resuspension liquid include 10 mM magnesium chloride, 10 mM 2-morpholinoethanesulfonic acid, 100 mu M acetyl-syringone, and pH = 5.6; and the standing culture condition is 2-4 hours.
[0026] Further, in the step (3), the components of the soil matrix are matrix soil: peat soil: vermiculite with a mass ratio of 2:1:1;
[0027] The co-culture condition is temperature 24 DEG C + / - 2 DEG C, humidity 80-90%, light intensity 3000-3500 lux, light cycle 16 hours light and 8 hours darkness, and growth for 7 days.
[0028] Further, in the step (4), the antibiotic is kanamycin, the concentration is 100 mg / L, and the application amount is 200-300 mL.
[0029] Further, in the step (3) and the step (4), the leaf surface fertilizer is sprayed on the receptor material every week during the co-culture and the selection culture stages, the leaf surface fertilizer is nitrogen, phosphorus and potassium water-soluble fertilizer 500 times dilution liquid, and the spraying amount is 50 mL.
[0030] The beneficial effects of the present application are as follows:
[0031] 1. The present application uses Agrobacterium rhizogenes to infect raspberry leaves to obtain transgenic hairy roots, and further cultivates transgenic raspberry plants from the transgenic hairy roots, and the whole genetic transformation process does not need sterile operation, compared with the traditional method of obtaining transgenic plants through plant tissue culture, the genetic transformation operation is more simple and convenient, and the genetic transformation period is greatly shortened, and the transgenic raspberry plants can be obtained only for 8-10 weeks.
[0032] 2. The present application successfully realizes the use of raspberry leaves as the transformation receptor material, and obtains the transgenic plants containing the GFP reporter gene through the mediation of Agrobacterium rhizogenes and the further cultivation, which lays a good foundation for the transformation of the target gene.
[0033] 3、The application has simple operation, short culture period, and does not need plant tissue culture and sterile operation. The receptor material used in the application is easy to obtain, and the genetic transformation experiment of raspberry can be carried out without material limitation. BRIEF DESCRIPTION OF DRAWINGS
[0034] Figure 1 is a PK7WG2D.1 plasmid map;
[0035] Figure 2 is a technical roadmap of the method for quickly obtaining a transgenic raspberry plant;
[0036] Figure 3 is a phenotype comparison diagram of a transgenic raspberry plant and an untransformed raspberry plant under natural light and 475nm excitation light;
[0037] In the figure, a~b: transgenic raspberry plant and untransformed raspberry plant under natural light, a: transgenic plant, b: untransformed raspberry plant;
[0038] c~d: transgenic raspberry plant and untransformed raspberry plant under 475nm excitation light, c: transgenic plant, d: untransformed raspberry plant;
[0039] Figure 4 is a transgenic raspberry plant PCR detection diagram;
[0040] In the figure, M represents DNA Maker, and WT represents untransformed raspberry plant. DETAILED DESCRIPTION
[0041] The application will be further described in detail below in combination with specific embodiments, so as to be understood by those skilled in the art.
[0042] Test materials:
[0043] 1. Receptor material: 3-6 mature leaves of the top of the seedling raspberry.
[0044] 2. Strain and plasmid: The Agrobacterium rhizogenes strain used in the experiment is Agrobacterium rhizogenes competent cell ATCC15834, which is purchased from Shanghai Weidi Biotechnology Co., Ltd. The plasmid used in the experiment is PK7WG2D.1 plasmid, and the plasmid map is as shown in Figure 1 The plasmid carries an EGFP reporter gene after a proID promoter, and the nucleotide sequence of the EGFP reporter gene is as shown in SEQ ID NO: 1.
[0045] 3. Medium or solution formula
[0046] (1) YT solid or liquid medium: 3 g / L Yeast Extract, 5 g / L Tryptone, 10 mM CaCl2, 15 g / L Agar for solid medium;
[0047] (2) MMA resuspension solution: 10 mM magnesium chloride (MgCl2), 10 mM 2-morpholinoethanesulfonic acid (MES), 100 mM acetyl-syringone (AS), pH = 5.6;
[0048] (3) Antibiotics: 100 mg / L Spectinomycin (Spe), 100 mg / L Kanamycin (Km);
[0049] (4) AS acetyl-syringone: weigh a certain amount of AS, dissolve it with 95% alcohol, and finally dilute it with sterile distilled water to prepare a 100 mM stock solution, filter sterilize it with a 0.45 μm filter membrane, and store it at -20 °C;
[0050] (5) Soil matrix composition: matrix soil: peat soil: vermiculite mass ratio = 2:1:1.
[0051] Example 1
[0052] Preparation of Agrobacterium for infection
[0053] 1. Transformation of Agrobacterium rhizogenes competent cells ATCC15834 with PK7WG2D.1 plasmid
[0054] (1) 0.1 cm electroporation cup and cup cover were taken out from the storage solution and inverted on a clean absorbent paper for 5 minutes, then they were righted for 5 minutes to allow the ethanol to fully evaporate. After the ethanol was completely evaporated, they were immediately inserted into ice, the ice surface was compacted, and the electrode cup was 0.5 cm away from the ice surface to facilitate the cover of the cup cover. They were left in the ice for 5 minutes to fully cool down.
[0055] (2) The Agrobacterium rhizogenes competent cells ATCC15834 stored at -80 °C were inserted into ice for 5 minutes, then they were thawed, 100 ng of PK7WG2D.1 plasmid DNA (which carries an EGFP reporter gene after the proID promoter, and the nucleotide sequence of the EGFP reporter gene is shown in SEQ ID NO: 1) was added, the tube bottom was mixed by hand, and it was immediately inserted into ice. The competent-plasmid mixture was quickly moved to the electroporation cup with a 200 μL gun head, the cup cover was covered, and the empty tube was reserved for later use.
[0056] (3) Start the electroshocking device, set the parameters: C=25 μF, PC=200 ohm, V=2400 V, take the shocking cup out of the ice, dry the outer surface with a paper towel, quickly put it into the electroshocking tank, start the electric shock, quickly insert it into the ice after the electric shock is completed, add 1 mL of antibiotic-free liquid TY medium, and transfer it to a 1.5 mL empty tube, and cultivate at 28°C for 2-3 h.
[0057] (4) Centrifuge at 6000 rpm for 1 min to collect the bacteria, take about 100 μL of supernatant, gently blow and resuspend the bacterial block, and plate it on TY solid medium containing 100 mg / L Spe antibiotic, and invert it in a 28°C incubator for 72 h.
[0058] (5) Pick single colonies and use primers GFP-F / R for PCR detection, and the primer sequences are as follows:
[0059] GFP-F: ATGGTGAGCAAGGGCGAGGA;
[0060] GFP-R: GCCGTCGTCCTTGAAGAAGA.
[0061] After verification, a positive single colony is obtained, i.e. Agrobacterium rhizogenes ATCC15834-PK7WG2D.1.
[0062] 2. Preparation of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 bacteria
[0063] (1) Pick Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 single colonies and inoculate them in 2 mL TY liquid medium containing 100 mg / L Spe, and cultivate at 28°C on a constant temperature shaker at 200 rpm overnight (12-16 h).
[0064] (2) The next day, 200 μL of bacterial solution is transferred to 200 mL of TY liquid medium containing 100 mg / L Spe, and cultivated at 28°C on a constant temperature shaker at 200 rpm until OD600=0.8-1.0.
[0065] (3) Transfer the bacterial solution from the conical flask to a 50 mL centrifuge tube, centrifuge at 5000 r / min for 10 min, remove the supernatant, and resuspend the collected Agrobacterium rhizogenes ATCC15834 bacteria in MMA resuspension solution, and incubate at room temperature for 2-4 h, then centrifuge at 5000 r / min for 10 min to collect Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 bacteria, which are used for infection of the receptor material.
[0066] Example 2
[0067] A method for quickly obtaining transgenic raspberry plants
[0068] In combination Figure 2 As shown in the figure, the method for quickly obtaining a transgenic raspberry plant comprises the following steps:
[0069] 1. Preparing a receptor material: taking 3-6 mature leaves of a seedling raspberry from the top down as an explant, disinfecting the explant in 1‰ potassium permanganate diluent for 10-15 min, and cutting a new wound at the petiole to provide a receptor material for genetic transformation.
[0070] Since the leaves of the seedling raspberry are used as the transformation receptor material, only healthy and disease-free leaves are selected for sampling. Too young or senescent leaves will gradually yellow or die during subsequent growth after being infected with Agrobacterium.
[0071] 2. Infection: the receptor material prepared in step 1 is directly dipped into the prepared hairy root Agrobacterium ATCC15834-PK7WG2D.1 bacterial body of Example 1 for infection, and the infection time is 3-5 s.
[0072] 3. Co-culture: the infected receptor material is inserted into the prepared soil matrix, and is grown at 24±2℃, humidity 80-90%, light intensity 3000-3500 lux, and light cycle 16h light / 8h dark for 7 days.
[0073] For raspberry leaves, a fresh wound is an important factor affecting infection. When the hairy root Agrobacterium is infected, a new wound must be cut on the petiole of the disinfected raspberry leaf. Further, through multiple tests, it is found that the control of water and fertilizer during the growth of the infected raspberry has a great influence on the entire genetic transformation cycle. Reasonable fertilization can shorten the cycle of obtaining transgenic raspberries, so leaf fertilizer is sprayed every week during the co-culture and selection culture stages. The leaf fertilizer is a 500-fold dilution of nitrogen, phosphorus and potassium water-soluble fertilizer, and the spraying amount is 50mL.
[0074] 5. Selection culture: the receptor material co-cultured for 7 days is treated with 200-300mL of 100mg / L K solution, and the antibiotic is applied once a week. After a week, positive callus forms at the petiole, and the positive callus grows into positive roots after two weeks. The positive roots grow into positive shoots after four weeks, and the positive shoots grow into transgenic raspberry plants after one week of leaf expansion.
[0075] Example 3
[0076] Detection of transgenic raspberry plants
[0077] The transgenic raspberry plants and untransformed raspberry plants obtained in Example 2 were placed under 475 nm excitation light for GFP fluorescence detection, and the untransformed raspberry plants were used as negative controls; total DNA was extracted from the leaves of the transgenic raspberry plants using the CTAB method, and PCR detection was performed. The experiment was performed in three independent repeats, and a total of 50 raspberry leaves were transformed,
[0078] The results are shown in Table 1. Figures 3-4 As shown in Table 1, 44 of the 50 transformed raspberry leaves grew positive calli by GFP fluorescence detection and PCR identification, and the transformation rate was 88%; 13 transgenic plants were ultimately obtained, and the transformation efficiency was 26%. The method of the present application can quickly obtain transgenic raspberry plants, and is simple to operate, has a short culture period, and does not require plant tissue culture and sterile operation
[0079] The other parts not specifically described are prior art. Although the above examples have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which are within the protection scope of the present application.
Claims
1. A method for rapidly obtaining transgenic raspberry plants, characterized in that: Includes the following steps: (1) Preparation of recipient material: Select mature leaves from the top of raspberry seedlings, disinfect them, and make new cuts at the petiole to serve as recipient material; (2) Infection: The recipient material was dipped into Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 cells for infection; Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 carries the PK7WG2D.1 plasmid, and the PK7WG2D.1 plasmid carries the EGFP reporter gene after the proID promoter; the infection time is 3~5 s; (3) Co-culture: The infected recipient material was inserted into the soil matrix for co-culture; the composition of the soil matrix was substrate soil: peat soil: vermiculite mass ratio = 2:1:1; the co-culture conditions were temperature 24±2℃, humidity 80~90%, light intensity 3000~3500 lux, photoperiod 16 h light 8 h dark environment, growth for 7 days; (4) Selection and cultivation: Antibiotics were applied to the recipient material after co-culture once a week, and transgenic raspberry plants were obtained after cultivation; In steps (3) and (4), during the co-cultivation and selection cultivation stages, foliar fertilizer is sprayed onto the recipient material weekly. The foliar fertilizer is a 500-fold diluted solution of nitrogen, phosphorus, and potassium water-soluble fertilizer, and the spraying volume is 50 mL.
2. The method according to claim 1, characterized in that: In step (1), mature leaves are disinfected in a 1‰ potassium permanganate solution for 10-15 minutes.
3. The method according to claim 1, characterized in that: The nucleotide sequence of the EGFP reporter gene is shown in SEQ ID NO: 1; the infection time is 5 s.
4. The method according to claim 1, characterized in that: The method for preparing the Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 cells includes the following steps: 1) The plasmid PK7WG2D.1 was electroporated into Agrobacterium rhizogenes competent cells ATCC15834 to obtain single colonies of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1; 2) A single colony of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 was streaked onto TY solid medium containing antibiotics to activate it and grow into a single colony; 3) Pick a single colony and inoculate it into TY liquid medium containing antibiotics for activation culture to obtain activated bacterial solution; 4) The activated bacterial solution was inoculated into TY liquid medium containing antibiotics and cultured to obtain the bacterial solution; 5) Centrifuge the bacterial culture to collect the bacterial cells, add MMA resuspension solution to resuspend the cells, let them stand for culture, centrifuge again to collect the bacterial cells, and obtain Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 bacterial cells.
5. The method according to claim 4, characterized in that: The antibiotic in the TY solid culture medium and the TY liquid culture medium containing antibiotics is spectinomycin, and the spectinomycin content is 100 mg / L.
6. The method according to claim 4, characterized in that: In step 2), the conditions for streak activation are: dark incubation at 28°C for 2 days. In step 3), the activation culture conditions are 28℃ and 200 rpm shaking culture for 12~16 h; In step 4), the volume ratio of activated bacterial solution to antibiotic-containing TY liquid culture medium is 1:900~1000, and the culture conditions are 28℃, 200 rpm shaking culture until the bacterial solution OD600=0.8~1.0; In step 5), the MMA resuspension consists of 10 mM magnesium chloride, 10 mM 2-morpholine ethanesulfonic acid, 100 μM acetylsyl syringone, and pH=5.6; the static culture conditions are 2~4 h.
7. The method according to claim 1, characterized in that: In step (4), the antibiotic is kanamycin, with a concentration of 100 mg / L and an application volume of 200-300 mL.
Citation Information
Patent Citations
Agrobacterium rhizogenes mediated strawberry gene transferring method
CN104593410A
Establishment method of gynostemma pentaphylla hairy root genetic transformation system
CN116179593A