Application of transcription factor p53 in regulation and control of KIF18B gene expression

Abstract

The invention discloses an application of a transcription factor p53 as a target in screening a reagent for regulating and controlling KIF18B gene expression, and an application of a substance expressed by the transcription factor p53 in preparing a reagent for inhibiting KIF18B gene expression. Researches prove that p53 inhibits KIF18B gene expression through NF-YB interaction, so that an application scheme for inhibiting KIF18B gene expression by p53 is provided, that is, a transcription factor p53 can be used for regulating and controlling a KIF18B promoter region through NF-YB so as to regulate and control expression of KIF18B and abnormal expression of KIF18B in various cancers, and a foundation is laid for researching new drugs and new strategies for treating cancers.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to an application of transcription factor p53 in regulating KIF18B gene expression. Background Art

[0002] Lung cancer is the cancer with the highest mortality rate worldwide. Lung cancer is divided into small cell lung cancer and non-small cell lung cancer according to histological type, among which lung adenocarcinoma is the main pathological type of non-small cell lung cancer. Lung adenocarcinoma patients have an insidious onset, and its complex etiology and molecular mechanism make treatment difficult. Therefore, early detection, early diagnosis and early treatment of lung adenocarcinoma are of great significance. In gene therapy and the development of tumor targeted drugs, transcriptional regulation is one of the core mechanisms of gene expression control. Promoters, as key regulatory regions of gene transcription, directly affect the expression level of genes. Promoters are essentially a DNA sequence located upstream of the 5' end of structural genes. They do not have the function of regulating genes themselves, but specifically regulate gene expression through interactions with a variety of specific transcription factors. Research on promoter function helps us to have a deeper understanding of the regulatory mechanism of biological growth and development, and is of great significance to the study of functional gene expression regulation. In recent years, promoter research has become a research hotspot in the field of genetic engineering, especially in the construction of efficient and precise gene regulation systems.

[0003] KIF18B (kinesin family member 18B) is a protein belonging to the kinesin family, which is mainly involved in the separation of chromosomes and the dynamic regulation of microtubules during cell mitosis. Recent studies have shown that KIF18B is abnormally expressed in a variety of cancers, and its high expression in non-small cell lung cancer is closely related to the poor prognosis of patients (Ji Z, Pan X, Shang Y, et al. KIF18B as aregulator in microtubule movement accelerates tumor progression and triggers poor outcome in lung adenocarcinoma [J]. Tissue Cell, 2019, 61: 44-50.). KIF18B promotes the proliferation and metastasis of tumor cells by participating in the regulation of the cell cycle, and is therefore considered a potential target for cancer therapy. By inhibiting the expression or function of KIF18B, it is expected to provide a new strategy for the treatment of cancer (QiuM, WangQ, Li Q, et al. KIF18B is a Prognostic Biomarker and Correlates with Immune Infiltrates in Pan-Cancer[J]. FrontMolBiosci, 2021, 8: 559800.).

[0004] Transcription factor p53 is a "famous" tumor suppressor that participates in processes such as cell cycle regulation, DNA repair, apoptosis, and genome stability. p53 exerts its tumor suppressor effect by binding to DNA and regulating the expression of multiple downstream genes. In recent years, studies have found that p53 not only plays a role in the cell nucleus, but may also regulate gene expression by interacting with transcription factors such as NF-YB. NF-YB (Nuclear factor-YB) is a universal transcription factor that can bind to the CCAAT box and regulate the expression of multiple genes. Studies have found that the core promoter region of KIF18B does not contain p53 binding sites, but has a typical CCAAT box. At present, there are few reports on the mechanism of action between p53 and KIF18B. Summary of the invention

[0005] The purpose of the present invention is to provide an application of transcription factor p53 in regulating the expression of KIF18B gene in view of the above problems.

[0006] In order to achieve its purpose, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention provides the use of transcription factor p53 as a target in screening agents that regulate KIF18B gene expression.

[0008] In the above-mentioned application technology scheme, the reagent promotes the expression of transcription factor p53, thereby inhibiting the expression of KIF18B gene.

[0009] The second aspect of the present invention provides use of a substance that promotes the expression of transcription factor p53 in the preparation of an agent for inhibiting the expression of the KIF18B gene.

[0010] In the above-mentioned application technology scheme, the substance that promotes the expression of transcription factor p53 is a p53 overexpression vector.

[0011] Preferably, the p53 overexpression vector is pCDNA3.1-Flag-p53.

[0012] In the above application technology solution, the transcription factor p53 binds to the NF-YB site of the KIF18B promoter.

[0013] Among them, p53 exerts an inhibitory effect by binding to the -28bp to -13bp region of the KIF18B promoter.

[0014] Furthermore, the transcription factor p53 binds to the P200 region of the KIF18B promoter, and the nucleotide sequence of the P200 region is shown in SEQ ID NO.20.

[0015] The beneficial effects of the present invention are:

[0016] The research of the present invention has proved that p53 inhibits KIF18B gene expression through NF-YB interaction, and provides an application scheme of p53 inhibiting KIF18B gene expression, that is, the transcription factor p53 can regulate the KIF18B promoter region through NF-YB, thereby regulating the expression of KIF18B. KIF18B is abnormally expressed in many cancers, so the present invention lays a foundation for studying new drugs and new strategies for treating cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a schematic diagram of the construction of the KIF18B reporter gene promoter and the transcription factor binding sites.

[0018] Figure 2 It is the result of agarose gel electrophoresis detection of the recombinant vector.

[0019] Figure 3 The results of dual-luciferase reporter gene assays of five KIF18B promoters and the identification of the core promoter region.

[0020] Figure 4 This is the result of promoter dual luciferase activity detection after co-transfection of p53, NF-YB overexpression plasmids and five KIF18B promoter recombinants into H1299 cells.

[0021] Figure 5 These are the results of detecting the mRNA and protein expression levels of the KIF18B gene after transient transfection of H1299 cells with overexpression of p53.

[0022] Figure 6 These are the RT-qPCR and WB results of A549 cells treated with ADR for 48 h.

[0023] Figure 7 The results of dual luciferase reporter gene analysis of KIF18B-P200WT and P200Mut promoters. DETAILED DESCRIPTION

[0024] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0025] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0026] Example 1. Construction and identification of KIF18B gene promoter

[0027] 1. Experimental Methods

[0028] 1. Human Genomic DNA Extraction

[0029] Human genomic DNA was extracted from human 293T cells using the TIANGEN blood / cell genomic DNA extraction kit.

[0030] 2. Construction of KIF18B promoter and truncated dual-luciferase reporter gene plasmid

[0031] (1) Bioinformatics analysis of KIF18B gene promoter

[0032] The transcription start site of the human gene KIF18B (NCBI Gene ID: 146909) was located by querying the NCBI database or GenBank, and the upstream 2000 bp sequence was extracted to obtain the KIF18B promoter region. The promoter region was limited to between 1000 bp and 2600 bp, and the potential binding sites of Myb, SP1, NF-YB and p53 transcription factors on the promoter were analyzed using online prediction tools such as JASPAR, PROMO and MatInspector (e.g. Figure 1 The prediction results were integrated to determine the region of the promoter truncation, and primers were designed accordingly.

[0033] Figure 1The construction of the KIF18B reporter gene promoter and a schematic diagram of the transcription factor binding site are shown. These structures are named P-length (starting position / ending position). Exon1 represents the first exon of KIF18B, indicating the position relative to the main transcription start site (+1) of KIF18B. The determined sequence of the KIF18B promoter P1480 (-922 / +557) is shown in SEQ ID NO.1. According to the binding site of the transcription factor, it is gradually truncated from the 5' end to construct four truncations of KIF18B: P1152 (-594 / +557), P899 (-341 / +557), P671 (-113 / +557), P200 (-100 / +100).

[0034] The promoter region fragment of KIF18B was constructed on the empty vector pGL4.10[luc2] (Promega, USA). The primers of the promoter P1480 (-922 / +557) were designed according to the homologous recombination method. The primers contained NheI and BglⅡ restriction endonuclease sites, and 20 base homology arms were inserted upstream and downstream to ensure seamless cloning. The primers of KIF18B truncation P1152, P899, P671, and P200 were designed according to the TOYOBO site-directed mutagenesis kit (KOD-Plus-Mutagenesis Kit) method (specific primer sequences are shown in Table 1), and the vector was self-ligated using Ligation high.

[0035] Table 1. PCR primer sequences for construction of KIF18B promoter reporter gene recombinant and site-directed mutagenesis

[0036]

[0037] (2) PCR amplification of KIF18B promoter

[0038] The above primers were used to amplify the KIF18B promoter fragment using human genomic DNA as a template using TAKARA PrimeSTAR Max high-fidelity DNA polymerase. The reaction system (50 μl) was as follows: PrimeSTAR Max Premix (2x) 25 μl, upstream / downstream primers (10 μM) 1 μl each, DNA template 10 ng, and ddH2O was added to make up to 50 μl.

[0039] PCR reaction conditions: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, extension at 72°C for 5 s / kb, 30 cycles; storage at 4°C.

[0040] After amplification, take 5μl of PCR product and mix with 1μl DNA Loading buffer, spot it in the well of 1% agarose gel, and use 5μl DNA standard molecular weight DL 2000 Marker as a control. Perform electrophoresis at 220V for 20-30min. After the electrophoresis, a bright band of about 1500bp can be observed in the gel imaging system.

[0041] The product was purified using the TIANGEN common DNA product purification kit, and the concentration and OD value of the purified product were measured using a NanoDrop 2000 nucleic acid protein concentration analyzer.

[0042] (3) Use the Vazyme homologous recombination kit to homologously recombine the fragment and the pGL4.10[luc2] vector

[0043] Calculate the amount of each reagent required in the homologous recombination system, the amount of vector and fragment used: The optimal amount of cloning vector used in the ClonExpress II recombination reaction system is 0.03pmol, and the optimal amount of insert fragment used is 0.06pmol (the molar ratio of vector to insert fragment is 1:2). The DNA mass corresponding to these molar numbers can be roughly calculated by the following formula:

[0044] The most suitable amount of cloning vector to use = [0.02 × number of base pairs of cloning vector] ng (0.03 pmol)

[0045] The most suitable amount of insert fragment = [0.04 × number of base pairs of insert fragment] ng (0.06 pmol)

[0046] The calculated amount of vector used was 90 ng, and the amount of fragment used was 68 ng.

[0047] Use a pipette to gently mix (do not oscillate), centrifuge briefly to collect the reaction solution at the bottom of the tube. Incubate at 37°C for 30 minutes; cool to 4°C or immediately place on ice.

[0048] (4) Transformation, bacterial selection, and sequencing

[0049] First, take out the Trans 5α competent medium from the -80℃ refrigerator and place it on ice to thaw. Add 10μl of the above ligation product to 50μl competent medium, mix gently with a pipette tip, then place it in an ice bath for 30min, heat it at 42℃ for 1min, and immediately place it on ice for 2min. Then add 500μl of LB medium without antibiotics, mix gently, and shake it in a 37℃ constant temperature shaker for 1h, keeping a sterile environment throughout the process. Spread the transformed bacteria evenly on the LB plate containing Amp antibiotics, and place it upside down in a 37℃ constant temperature incubator for overnight culture.

[0050] On the second day, a single colony was picked up with a 10 μl pipette tip and placed in a 1.5 ml EP tube containing 1 ml LB liquid medium containing 100 mg / L Ampoule, and placed in a 37°C constant temperature shaker for 5-6 hours. A portion of the bacterial solution was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and a portion was kept in a 4°C refrigerator.

[0051] Compare the sequencing results with NCBI or SnapGene, expand the culture of the correctly sequenced bacterial solution, add 50μl of the bacterial solution into a 50ml centrifuge tube containing 20ml of 100mg / LAmp, and shake at 37℃ constant temperature shaker overnight, usually 12-20h.

[0052] The plasmid was extracted according to the instructions of TIANprep Mini Plasmid Kit (TIANGEN BIOTECH), and then the concentration and OD value were measured using NanoDrop 2000 nucleic acid protein concentration analyzer, and the extracted plasmid was stored at -20°C. The pGL4.10-KIF18B promoter recombinant plasmid containing 1458 bp of the human KIF18B promoter region was obtained.

[0053] (5) Construction of KIF18B truncation

[0054] The truncated primers are shown in Table 1 and were constructed according to the instructions of the site-directed mutagenesis kit (KOD-Plus-Mutagenesis Kit, TOYOBO, SMK-101). The specific steps are as follows: Reverse PCR: Use the primers shown in Table 1 to amplify the truncated fragments, among which P200 (-100 / +100) is constructed using the P671 (-113 / +557) promoter as a template, and the remaining truncations are constructed using the KIF18B promoter P1480 (-922 / +557) as a template.

[0055] The reaction system (50 μl) for inverse PCR amplification is as follows:

[0056]

[0057]

[0058] PCR was performed under the following conditions: pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, annealing and extension at 68°C for 1 min / kb, storage at 4°C, and 4 to 10 cycles.

[0059] Similarly, take 5 μl of PCR product for agarose electrophoresis, use DL15000 DNA Marker as a reference, and proceed to the next step if a bright band around 5000 bp is observed.

[0060] Digest the PCR amplification product with Dpn I: add 2 μl of Dpn I to the PCR reaction solution (total amount 50 ul), mix gently, centrifuge briefly, and react at 37°C for 1 hour.

[0061] PCR product self-circularization: Take out T4 Polynucleotide Kinase and Ligation high, and melt them in an ice bath. After melting, gently stir the Ligation high to make it uniform, take a new PCR tube, and prepare the following connection system: 2μl of PCR product treated with Dpn I, 5μl of Ligation high, 1μl of T4 Polynucleotide Kinase, and add ddH2O to 15μl. Then gently stir it to make it uniform, centrifuge it instantly, and react at 16℃ for 1h.

[0062] Transformation, bacterial selection, and sequencing: Subsequent steps are the same as above. The sequencing results are all correct, and the extracted plasmids are stored at -20℃.

[0063] 3. Identification of KIF18B promoter region

[0064] (1) Cell transfection

[0065] H1299 and A549 cells were cultured at 3×10 5 The cells were seeded at a density of 100 cells / well on a 12-well plate and cultured for 24 hours until the confluence reached 60%-70%, and then transfected with pGL4.74[hRluc / TK] (Promega, USA).

[0066] The system for promoter transfection into cells is as follows:

[0067]

[0068] Prepare transfection reagent: dilute 1μl Neofect DNA transfection reagent in 50μl Opti-MEM. After standing for 5 minutes, mix the transfection reagent and plasmid mixture, mix with the pipette tip and stand at room temperature for 15-20 minutes, then add to 12-well cell culture plates, mark them, put them in the incubator, and continue to culture for 48 hours. After 48 hours, lyse the cells and take the cell lysate to measure the dual luciferase activity.

[0069] (2) Dual luciferase activity assay

[0070] The procedure was performed according to the instructions of the Beyotime Dual Luciferase Reporter Gene Assay Kit (RG027).

[0071] Lyse cells: Wash twice with PBS, then add 200μl cell lysis buffer to each well, freeze at -80 for 5 minutes, shake at room temperature for 30 minutes, and white flocculent precipitate will be visible after cell lysis. Pour the lysis buffer into a 1.5ml centrifuge tube, centrifuge at 12000xg for 3-5 minutes, and take the supernatant for determination.

[0072] Take 20 μl of supernatant and add 100 μl of firefly luciferase detection reagent, mix gently, put into Promega luminescence detector to detect Firefly luciferase reporter gene activity X, then add 100 μl of Renilla luciferase detection working solution (Renilla buffer: Renilla substrate = 1:100, prepared and used immediately) to determine Renilla luciferase reporter gene activity Y, compare the promoter activity based on the ratio X / Y of the two, and then normalize with pGL4.1-basic.

[0073] 2. Results and Analysis

[0074] Construction of KIF18B reporter gene recombinant and detection of dual luciferase activity. Through agarose gel electrophoresis, 5 recombinant dual luciferase reporter gene plasmids released bands consistent with the expected size, indicating that the vector was successfully constructed ( Figure 2 ). In the two lung adenocarcinoma cell lines H1299 and A549, compared with the activity of the reporter gene vector pGL4-basic, the five luciferase reporter gene recombinants all had higher activities, among which P200 (-100 / +100) had the highest activity, P671 (-113 / +557) had the second highest activity, P1480 (-922 / +557) had the lowest activity, and P1152 (-594 / +557) and P899 (-341 / +557) had similar activities, so the KIF18B core promoter region may be included in this 200 bp fragment ( Figure 3 ). Data were obtained from representatives of at least three independent experiments, and the results are presented as the mean and standard deviation (SD) of triplicate results from one representative experiment (p < 0.01).

[0075] Example 2: Transcriptional regulation and inhibition of KIF18B by transcription factor p53

[0076] 1. Co-transfection of p53, NF-YB overexpression plasmids and five KIF18B promoter recombinants into H1299 cells

[0077] The p53 overexpression plasmid pCDNA3.1-Flag-p53 and the NF-YB overexpression plasmid pRC-CMV-Flag-NF-YB were constructed and provided by Shanghai Biotech Co., Ltd. The Gene IDs of transcription factors p53 and NF-YB in NCBI are 7157 and 4801, respectively.

[0078] H1299 cells were seeded onto 12-well plates and transfected when the cell confluence reached 60%-70% at 24h. 100ng pCDNA3.1-Flag-p53 or NF-YB overexpression plasmid, 300ng pCDNA3.1-basic, 10ng internal reference, and 100ng KIF18B promoter plasmid were diluted in 50μl Opti-MEM, and 1μl Neofect DNA transfection reagent was diluted in 50μl Opti-MEM. The two groups were allowed to stand for 5min, then fully mixed and allowed to stand for 15min, then slowly added to the cell well plate and placed in a cell culture incubator for continued culture. After 48h, the cells were lysed and the supernatant of the lysate was collected to measure the promoter dual luciferase activity.

[0079] The results are as follows Figure 4 As shown: p53 can inhibit the expression of KIF18B through the NFY binding site. NF-YB and p53 overexpression plasmids were co-transfected into H1299 cells, and the dual luciferase activity was measured. It can be seen that overexpression of NF-YB increased the promoter activity, while overexpression of p53 significantly reduced the KIF18B promoter activity. Given that the first four promoter regions all contain p53 and NF-YB binding sites, while the P200 promoter does not contain a p53 binding site, and since P200 was previously identified as a possible core promoter region, it is speculated that p53 may exert an inhibitory effect by interacting with the NF-YB binding site.

[0080] 2. Overexpression of p53 in H1299 cells and detection of KIF18B mRNA and protein expression levels

[0081] To further determine whether p53 inhibits the expression of KIF18B in cells, we transiently transfected p53 overexpression plasmid in H1299 cells, and used RT-PCR and Western Blot techniques to detect the expression of KIF18B gene. The specific steps are as follows: H1299 cells were seeded on a 6-well plate the day before, cultured for 12-24 hours, and transfected when the cell confluence was 70%-80%. Add 2μg pCDNA3.1-Flag-p53 overexpression plasmid diluted in 100μl Opti-MEM to each well, and 2μl Neofect DNA transfection reagent diluted in 100μl Opti-MEM. The two groups were allowed to stand for 5 minutes each, then fully mixed and allowed to stand for 15 minutes, then slowly added to the cell well plate, and placed in a cell culture incubator at 37°C and 5% CO2 for continued culture. Collect cells for RNA extraction after 48 hours, extract total RNA according to the instructions of total RNA Kit I, reverse transcribe and synthesize cDNA according to TAKARA PrimeScript 1st reverse transcription reagent, and use fluorescent reagent PremixEx TaqTM was used for quantitative RT-PCR detection. A mixture of RIPA cell lysis buffer and protease inhibitor cocktail at a ratio of 1:100 was used to lyse the cells to extract proteins. After sonication, 1 / 4 of 5xLoding buffer was added to denature the proteins, and then SDS-PAGE gel electrophoresis was used to separate the proteins. The proteins were transferred to PVDF membranes and blocked with 5% skimmed milk powder at room temperature for 2 hours. The primary antibody was then incubated overnight, and the secondary antibody was incubated at room temperature for 1 hour the next day, and the protein bands were detected by chemiluminescence. Figure 5 As shown, with GAPDH as the control, after exogenous overexpression of p53, the expression of KIF18B at both mRNA and protein levels was significantly decreased. In summary, p53 inhibits the expression of KIF18B gene.

[0082] Table 2 Quantitative RT-PCR primer sequences

[0083]

[0084] 3. Treatment of doxorubicin ADR

[0085] In order to further study the mechanism of p53 regulating KIF18B gene expression, doxorubicin was used to induce DNA damage. p53 can be activated and stabilized by different signaling pathways, causing cell cycle arrest, apoptosis or senescence by enhancing the transcription of multiple downstream genes, maintaining the integrity of the cell genome and eliminating damaged cells. Therefore, p53 expression increases when DNA is damaged.

[0086] A549 cells were seeded on a 6 cm dish, and 1 μM ADR was added when the cell confluence reached 60%-70%. The control group was treated with an equal amount of DMSO. RNA and protein were extracted after 48 h of treatment. The expression of KIF18B at the mRNA and protein levels was detected by RT-qPCR and Western Blot experimental techniques. The results are shown in Figure 2. Figure 6 As shown: With GAPDH as the control, ADR treatment resulted in a significant decrease in the basal expression of KIF18B at the mRNA and protein levels in A549 cells, and a significant increase in the expression level of p53 after ADR treatment. Since p21 is the transcriptional target of the p53 tumor suppressor, the P21 protein level also increased significantly after ADR treatment. These results are consistent with the aforementioned experimental results that overexpression of p53 resulted in a significant decrease in the expression of the KIF18B promoter or the mRNA and protein expression levels, which highly indicates that the p53 transcription factor inhibits the transcription of KIF18B, and clarifies that p53 is a transcriptional regulator of the KIF18B gene.

[0087] Example 3: Functional analysis of p53 through NFY binding sites in the core promoter

[0088] 1. Experimental Methods

[0089] 1. Construction of site-directed mutagenesis vector for NF-YB transcription binding site

[0090] (1) Bioinformatics analysis

[0091] The NFY binding sites in the KIF18B promoter gene were analyzed using the JASPAR online prediction website, and it was found that there were three binding sites with higher scores at -50bp~0bp, of which there were two typical CCAAT binding sites at -50bp~-36bp and -28bp~-13bp. Therefore, it was speculated whether p53 targeted the core promoter region of the KIF18B gene by binding to one or two of the above transcription binding sites.

[0092] (2) Construction of mutation vector

[0093] Using the KIF18B-P200 promoter constructed in Example 1 as a template, two pairs of primers were designed according to the instructions of the site-directed mutagenesis kit (KOD-Plus-Mutagenesis Kit, TOYOBO, SMK-101), and the two predicted typical binding sites were mutated, that is, CCAAT was mutated to TCTAG (for specific steps, refer to the construction of KIF18B truncation in Example 1). The mutant recombinants were named KIF18B-P200M1 and KIF18B-P200M2, and the primer sequences used for the two mutants are shown in Table 1.

[0094] The nucleotide sequence of promoter P200 (SEQ ID NO.20) is as follows:

[0095] CCCACTGTGAACGGCTCTCGCAACACTTTGTTACTTAGGAAACAG CCAAT CAGCGATACGGACGCTGA CCAAT AGGAAGCACGGTCCGGCCCGCCCGGCTAATTTGAACGCAAGGCGCCGGGTGGAGGTTGGCGGGTAGGGGAGGGTGTGGGGCGCTCTCCCGGTGTGGGTACTGCTGTCTGTGGTGTGGCTGTGG.

[0096] KIF18B-P200M1 refers to the mutation of "CCAAT" to "TCTAG" at bases 46-50 (first underline) in the sequence shown in SEQ ID NO.20. KIF18B-P200M2 refers to the mutation of "CCAAT" to "TCTAG" at bases 69-73 (second underline) in the sequence shown in SEQ ID NO.20.

[0097] Reverse PCR: Using KIF18B-P200 promoter as template, the mutant truncated fragments were amplified using primers corresponding to KIF18B-P200M1 and KIF18B-P200M2.

[0098] The reaction system of inverse PCR amplification is the same as that of Example 1. The PCR program is: pre-denaturation at 94°C for 2 min, denaturation at 98°C for 10 sec, annealing and extension at 68°C for 1 min / kb, storage at 4°C, and 4 to 10 cycles.

[0099] Similarly, take 5 μl of PCR product for agarose electrophoresis, use DL15000 DNA Marker as a reference, and proceed to the next step if a bright band around 5000 bp is observed.

[0100] Digest the PCR amplification product with Dpn I: add 2 μl of Dpn I to the PCR reaction solution (total amount 50 ul), mix gently, centrifuge briefly, and react at 37°C for 1 hour.

[0101] PCR product self-circularization: Take out T4 Polynucleotide Kinase and Ligation high, and melt them in an ice bath. After melting, gently stir the Ligation high to make it uniform. Take a new PCR tube and prepare the following connection system: 2μl of PCR product treated with Dpn I, 5μl of Ligation high, 1μl of T4 Polynucleotide Kinase, and add ddH2O to 15μl. Gently stir it to make it uniform, centrifuge it instantly, and react at 16℃ for 1h.

[0102] (3) Transformation, bacterial selection, and sequencing

[0103] First, take out the Trans 5α competent medium from the -80℃ refrigerator and place it on ice to thaw. Add 10μl of the above ligation product to 50μl competent medium, mix gently with a pipette tip, then place it in an ice bath for 30min, heat it at 42℃ for 1min, and immediately place it on ice for 2min. Then add 500μl of LB medium without antibiotics, mix gently, and shake it in a 37℃ constant temperature shaker for 1h, keeping a sterile environment throughout the process. Spread the transformed bacteria evenly on the LB plate containing Amp antibiotics, and place it upside down in a 37℃ constant temperature incubator for overnight culture.

[0104] On the second day, a single colony was picked up with a 10 μl pipette tip and placed in a 1.5 ml EP tube containing 1 ml LB liquid medium containing 100 mg / L Ampoule, and placed in a 37°C constant temperature shaker for 5-6 hours. A portion of the bacterial solution was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and a portion was kept in a 4°C refrigerator.

[0105] Align the sequencing results using NCBI or Snap Gene. Expand the culture of the correctly sequenced bacterial solution. Add 50 μl of the bacterial solution to a 50-ml centrifuge tube containing 20 ml of 50 mg / L Amp and incubate overnight in a constant-temperature shaker at 37°C, usually for 12 - 20 h.

[0106] Extract the plasmid according to the instructions of the TIANprep Mini Plasmid Kit (TIANGEN BIOTECH). Then use a NanoDrop 2000 nucleic acid and protein concentration analyzer to measure the concentration and OD value. Store the extracted plasmid at -20°C. 2. Detection of KIF18B-P200WT and P200Mut promoter expression

[0107] Seed H1299 cells at 3x10 5 / well in a 12-well plate. After 24 h, when the cell confluence reaches 60% - 70%, transfect the promoter plasmid. Co-transfect H1299 cells with the overexpression plasmids of KIF18B-P200, P200-M1, P200-M2, NF-YB, and p53. Lyse the cells 48 h after transfection and collect the cell lysate for dual-luciferase activity detection.

[0108] II. Results and Analysis

[0109] Transfect wild-type P200 and its NF-YB mutants into H1299 cells to detect the dual-luciferase reporter gene activity (*0.01 < p < 0.05). The results are as Figure 7 shown. Compared with the control group, the mutations of both NF-YB binding sites led to a different degree of decrease in the core promoter activity, and there was no obvious change in the promoter activity after co-transfection with NF-YB, indicating that NF-YB is an important site for promoting KIF18B expression. In wild-type P200, the promoter activity decreased significantly after co-transfection with p53, while the promoter activity of the mutant increased compared with the wild-type after co-transfection with p53, especially significantly in P200-M2, indicating that p53 may play an inhibitory role by binding to the NF-YB site in the region of -28 bp to -13 bp.

Claims

1. Application of transcription factor p53 as a target in screening agents that regulate KIF18B gene expression.

2. The use according to claim 1, characterized in that: The agent promotes the expression of transcription factor p53, thereby inhibiting the expression of KIF18B gene.

3. Use of a substance that promotes the expression of transcription factor p53 in the preparation of an agent that inhibits the expression of the KIF18B gene.

4. The use according to claim 1 or 3, characterized in that: The substance that promotes the expression of transcription factor p53 is a p53 overexpression vector.

5. The use according to claim 4, characterized in that: The p53 overexpression vector is pCDNA3.1-Flag-p53.

6. The use according to claim 1 or 3, characterized in that: The transcription factor p53 binds to the NF-YB site of the KIF18B promoter.

7. The use according to claim 6, characterized in that: p53 exerts its inhibitory effect by binding to the -28bp to -13bp region of the KIF18B promoter.

8. The use according to claim 1 or 3, characterized in that: The transcription factor p53 binds to the P200 region of the KIF18B promoter, and the nucleotide sequence of the P200 region is shown in SEQ ID NO.20.

Images