A primer for identifying the gender of kiwifruit male and female plants, a kit thereof and application

By designing primer Fr-1 and its kit, and combining it with PCR analysis, we have achieved efficient, accurate, and widely applicable sex identification of kiwifruit male and female plants. This solves the problems of insufficient accuracy and versatility in existing technologies, and improves breeding efficiency and industrial application value.

CN119913244BActive Publication Date: 2025-12-05SICHUAN ACAD OF NATURAL RESOURCES SCI (SICHUAN PRODUCTIVITY PROMOTION CENT) +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510230260.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-28
Publication Date
2025-12-05
Estimated Expiration
2045-02-28

AI Technical Summary

Technical Problem

Existing methods for sexing kiwifruit plants are not very accurate and have poor universality, making them difficult to apply widely to different varieties.

Method used

A pair of primers, Fr-1, and their kit were designed and combined with PCR analysis for sex identification of kiwifruit plants. The kit included DNA extraction, PCR amplification, and gel electrophoresis steps, optimizing the accuracy and versatility of sex identification.

Benefits of technology

Fr-1 primers can efficiently and accurately identify male and female plants of different kiwifruit varieties with near-zero error, and have broad field application value, improving the technical support for kiwifruit breeding efficiency and industrial utilization.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119913244B_ABST
    Figure CN119913244B_ABST
Patent Text Reader

Abstract

The application provides a primer for identifying the gender of kiwifruit male and female plants, and a kit and application thereof, and belongs to the technical field of molecular biology. A pair of male-specific primers Fr-1 is designed, which can well identify the gender of kiwifruit. The experimental results show that the Fr-1 primer has good repeatability, can quickly and accurately identify the gender of kiwifruit through PCR amplification, and the universality verification result shows that the Fr-1 primer can efficiently and accurately distinguish different varieties of kiwifruit male and female plants, and the error in the verification process is close to zero, indicating that the primer has high reliability and credibility. Meanwhile, the Fr-1 marker can amplify specific bands in 'Huahong 4' seedling seedlings, and the sample can be expanded for field test in the later period, so as to ensure the accuracy. Therefore, the primer and method provided by the application have high practical application value and are suitable for large-scale popularization and use.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a primer and its kit for sex identification of male and female kiwifruit plants and its application. Background Technology

[0002] Kiwifruit (Actinidia chinensis Planch.), belonging to the genus Actinidiaceae, is a perennial deciduous or semi-deciduous woody vine. As the origin of kiwifruit, China is a major source of global kiwifruit resources. The main cultivated varieties in my country are *Actinidia chinensis*, *Actinidia deliciosa*, and *Actinidia arguta*, with other minor varieties including *Actinidia pubescens*, *Actinidia arguta*, and *Actinidia arguta*.

[0003] Kiwifruit plants are dioecious, exhibit rich ploidy variation, and have a long juvenile stage in seedlings, making traditional breeding methods time-consuming and inefficient. Given that kiwifruit is a perennial vine, its dioecious nature makes sex identification crucial in its breeding process. Applying kiwifruit sex identification technology to the screening of early seedlings can shorten breeding time, save breeding costs, and improve breeding efficiency.

[0004] Recently, researchers successfully identified and characterized two Y-linked sex-determining genes, SyGl and FrBy, in *Actinidia chinensis*, revealing the origin and evolution of the Y chromosome in kiwifruit and providing important theoretical basis for a deeper understanding of the molecular mechanisms of sex determination in kiwifruit. However, despite these studies providing important clues to the elucidation of the genetic basis of sex, early methods for sex determination in kiwifruit remain insufficient in practical applications. Solving this problem will not only improve the efficiency of kiwifruit cultivation and management but also provide new research directions for genetic improvement and optimization of breeding strategies.

[0005] Currently, some studies have attempted to identify sex using morphological observation, physiological and biochemical methods, and isoenzyme comparison. However, these methods are often affected by environmental factors, resulting in low accuracy and a lack of universal applicability.

[0006] With the rapid development of molecular biology, molecular marker technology has gradually become the main method for identifying the sex of kiwifruit. Methods using DNA molecular markers for identification mainly include RAPD markers, AFLP markers, SSR markers, SRAP markers, and SCAR markers. In the identification of different kiwifruit varieties, the identification methods used may differ due to varietal variations. Therefore, selecting an appropriate identification method for a specific kiwifruit variety is particularly important. Furthermore, verifying the universality of screened and successfully identified markers is a crucial step in improving the reliability of identification results; however, current marker methods still have shortcomings in terms of universality.

[0007] Previous research on DNA molecular markers has mainly focused on the development and validation of sex markers in kiwifruit. LGFraser et al. discovered the SmY marker, a male-linked marker located in the sex-determining region of chromosomes, providing an important reference for sex identification in kiwifruit. Guo Dandan validated the applicability of the SmY1 marker in *Actinidia chinensis* and *Actinidia arguta*, finding that SmY1 was effective for sex identification in *Actinidia chinensis*, but less effective in *Actinidia arguta*. Yao Chunchao et al. used RAPD technology to obtain the S1032 marker linked to the male gene and validated its applicability in hybrid offspring, *Actinidia chinensis*, and *Actinidia deliciosa*. The results showed that this marker could effectively identify male individuals, but exhibited some specific fluctuations in some female individuals.

[0008] Therefore, there is an urgent need to provide a primer and labeling method for sex identification of kiwifruit male and female plants with high accuracy and good versatility, which has become a pressing technical problem to be solved. Summary of the Invention

[0009] This invention aims to solve the aforementioned technical problems by providing primers, a reagent kit, and their application for sex identification of kiwifruit plants. The technical objective of this invention is to address the shortcomings of existing labeling methods in sex identification of kiwifruit plants, which suffer from insufficient accuracy, applicability to only a limited number of varieties, and poor universality of the test results. Therefore, this invention provides a highly accurate and universally applicable labeling method for sex identification of kiwifruit plants.

[0010] To achieve the above-mentioned technical objectives, the technical solution adopted by the present invention is as follows:

[0011] One objective of this invention is to provide a primer for sex identification of male and female kiwifruit plants. The primer includes a forward primer and a reverse primer. The sequence of the forward primer is 5'AGCCATCTCCAACACCACAG3', and the sequence of the reverse primer is 5'GCTCGGGATGAATAGGGTGG3'.

[0012] The second objective of this invention is to provide a kit for sex identification of male and female kiwifruit plants, which includes the forward primer and reverse primer as described above.

[0013] Furthermore, the kit also includes detection reagents required for detecting various genes in male and female kiwifruit plants using PCR analysis methods.

[0014] The third objective of this invention is to provide a detection method for sex identification of male and female kiwifruit plants, comprising the following steps:

[0015] (1) DNA extraction from kiwi fruit samples to be tested;

[0016] (2) PCR amplification of the extracted sample DNA using the primers described in this invention;

[0017] (3) Perform gel electrophoresis for sex identification of male and female kiwifruit plants.

[0018] Furthermore, the PCR amplification procedure is as follows:

[0019] 1) Pre-denaturation: 94℃, 5 min;

[0020] 2) Denaturation: 94℃, 30s;

[0021] 3) Annealing: 56℃, 40s;

[0022] 4) Extension: 72℃, 2min;

[0023] 5) Further extension: 72℃, 5min;

[0024] 6) Keep at 4℃.

[0025] The fourth objective of this invention is to provide the application of the primers described above in the sex identification of male and female kiwifruit plants.

[0026] The fifth objective of this invention is to provide the application of the kit described above in the sex identification of male and female kiwifruit plants.

[0027] This invention uses *Actinidia chinensis* and *Actinidia deliciosa* as experimental materials to systematically evaluate and verify the reliability and applicability of developed molecular markers for sex determination in kiwifruit. However, the results show that the existing molecular marker methods have poor universality. Based on this, this invention designed six pairs of primers and screened out the most representative and applicable molecular markers. Simultaneously, universality verification was conducted in different local varieties to verify whether the marker could effectively distinguish between male and female kiwifruit plants, thereby achieving accurate sex identification. This invention provides a widely applicable and accurate molecular marker, thus optimizing kiwifruit sex identification technology. By improving the accuracy and efficiency of sex identification, it can provide efficient technical support for early sex identification of kiwifruit, thereby improving breeding efficiency and providing a theoretical basis for subsequent breeding and production.

[0028] The beneficial effects of this invention are as follows:

[0029] This invention designed a series of primers, and after screening, identified a male-specific primer pair, Fr-1, which is highly effective for sex identification in kiwifruit. Experimental results show that the Fr-1 primer exhibits good repeatability and can rapidly and accurately identify the sex of kiwifruit through PCR amplification. Further universality verification results show that the Fr-1 primer can efficiently and accurately distinguish between male and female kiwifruit plants of different varieties, with near-zero error during verification, indicating high reliability and credibility. Furthermore, the Fr-1 marker can amplify a specific band in 'Huahong 4' seedlings, demonstrating practical application value. Further field trials with larger sample sizes can be conducted to ensure accuracy. In summary, the Fr-1 primer not only possesses strong universality but also broad field application value, providing an efficient and reliable tool for kiwifruit sex identification and laying a technical foundation for the development and industrial utilization of kiwifruit varieties. Attached Figure Description

[0030] Figure 1 The images show DNA electrophoresis patterns of some kiwifruit samples, where M represents the DNA Marker and the material numbers correspond to Table 1.

[0031] Figure 2 The image shows the SmY1 marker amplification patterns of some kiwifruit samples, where M is the DNA Marker and the material number corresponds to Table 1.

[0032] Figure 3 The image shows the S1032 marker amplification patterns of some kiwifruit samples, where M is the DNA Marker and the material number corresponds to Table 1.

[0033] Figure 4 The image shows the FrBy marker amplification patterns of some kiwifruit samples, where M is the DNA Marker and the material number corresponds to Table 1.

[0034] Figure 5 The images show the Fr-labeled amplification patterns of some kiwifruit samples, where M is the DNA Marker and the material numbers correspond to Table 1.

[0035] Figure 6 The amplification patterns of Fr-1 labeled in some kiwifruit samples are shown, where M is the DNA Marker and the material number corresponds to Table 1.

[0036] Figure 7 The amplification patterns of Fr-1 markers in other kiwifruit samples are shown in Table 1, where M is the DNA Marker and the material number corresponds to Table 1.

[0037] Figure 8 The image shows the amplification pattern of Fr-1 marker in 'Huahong 4' seedlings, where M is the DNA Marker and the material number corresponds to Table 1. Detailed Implementation

[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is described in detail below with reference to embodiments. It should be noted that the following embodiments are for explanation and illustration only and are not intended to limit the invention. Non-essential improvements and adjustments made by those skilled in the art based on the above description are still within the scope of protection of this invention.

[0039] Example 1

[0040] I. Experimental Materials and Methods

[0041] (I) Experimental Materials and Sources

[0042] 1. Plant materials

[0043] In June 2023, a total of 113 kiwifruit plants were collected from the kiwifruit research base in Guangji Town, Deyang City, Sichuan Province, as listed in Table 1. Among them, 89 kiwifruit plants of known sex were collected, listed as numbers 1-89, including *Actinidia chinensis*, *Actinidia deliciosa*, *Actinidia arguta*, *Actinidia pubescens*, and *Actinidia davidii*. Additionally, 24 seedlings of the 'Huahong 4' variety of unknown sex were collected, listed as numbers 90-113. Young leaves were harvested, flash-frozen in liquid nitrogen, and samples were brought back and stored in an ultra-low temperature freezer at -80℃ for later use.

[0044] Table 1. Kiwi fruit male and female plant materials used in this embodiment.

[0045]

[0046]

[0047]

[0048]

[0049]

[0050] Note: "-" represents an unknown sample name or an unknown gender.

[0051] 2. Main reagents

[0052] Anhydrous ethanol, chloroform (Chengdu Kelong Chemicals Co., Ltd.), agarose, TAE, nucleic acid dye (Biosharp), DNA marker, loading buffer (GENERAY), PCR MasterMix (Shanghai Biosciences). All organic reagents used were analytical grade.

[0053] 3. Main Instruments

[0054] Electronic balance (BSA124S, Beijing Sartorius Instruments Co., Ltd.); PCR instrument (Mastercycler Nexus, Eppendorf); high-speed centrifuge (Mcrofuge 20R, Fujian Langjian); electrophoresis apparatus (DYY-6C, Beijing Liuyi); DNA spectrophotometer (Tnano-700, Tuohe); gel imaging system (Chemidoc XRS, Bio-rad); ice maker (IM-25, XUEKE); tissue homogenizer (LC-TC0-24, Lichen Technology).

[0055] (II) Experimental Methods

[0056] 1. DNA extraction

[0057] After grinding plant tissues in liquid nitrogen, DNA was extracted from young kiwifruit leaves using the BIOFIT Plant Genomic DNA Extraction Kit. The quality and purity of the extracted DNA were measured by agarose gel electrophoresis and UV spectrophotometry, and the DNA was stored at -80°C for later use.

[0058] 2. Collection of sex molecular markers in kiwifruit

[0059] Three previously reported molecular markers related to sex in kiwifruit were collected, and the information is shown in Table 2. The expected product size is 700–867 bp.

[0060] Table 2. Information on sex markers collected from kiwifruit.

[0061]

[0062] 3. Primer design and synthesis

[0063] A total of 22 primer pairs were designed by aligning the FrBy gene sequence using Primer 3.0 and NCBI Primer. A list of all primer pairs is shown in Table 3. After screening, 6 primer pairs were finally selected, and their details are shown in Table 4.

[0064] Table 3 shows the information on the 22 pairs of male and female primers designed for kiwifruit.

[0065]

[0066]

[0067]

[0068] Table 4 Information on the selected male and female primers for kiwifruit

[0069]

[0070] 4. PCR amplification system

[0071] The above six primer pairs were initially screened using experimental materials with known sexes. A second screening was then conducted with a larger sample size. Primers exhibiting good amplification effects, clear bands, and good reproducibility were selected for subsequent amplification of all samples. The annealing temperature of the primers was varied and set at several gradients, with the experiment repeated three times. Based on the results of the three experiments, a stable annealing temperature was selected as the optimal temperature for the primers. The specific amplification procedure is shown in Table 5.

[0072] Table 5 PCR amplification program

[0073]

[0074] II. Experimental Results and Analysis

[0075] 1. DNA extraction

[0076] Genomic DNA was extracted from 72 known sex kiwifruit samples and one seedling. The quality of some DNA extractions is shown in [reference needed]. Figure 1 As can be seen, the absence of tails in the lanes indicates that the DNA is intact and at a high concentration, making it suitable for PCR amplification.

[0077] 2. Establishment and universality verification of the SmY1 labeling amplification system

[0078] The SmY1 marker was amplified in eight kiwifruit samples (both male and female), with the first four samples being female plants and the last four being male plants. The results are as follows: Figure 2 .from Figure 2It can be seen that no specific band was amplified in any of the four female samples; in the four male samples, only sample 24 amplified a specific band, consistent with the expected marker band position, with an identification accuracy of 25%. The results show that the SmY1 marker performed poorly, inconsistent with previous reports that SmY1 is a male-specific marker. Overall analysis indicates that this marker cannot be used for sex identification in kiwifruit, and the primers lack specificity.

[0079] 3. Establishment and universality verification of the S1032 label amplification system

[0080] The S1032 marker was amplified in eight kiwifruit samples (both male and female). The first four samples were from female plants, and the last four were from male plants. The results are as follows: Figure 3 No specific bands were amplified in either the four female or four male samples. This contradicts previous studies indicating that S1032 is a male-specific marker that appears only in male samples. Overall analysis shows that this marker cannot be used for sex determination in kiwifruit, and the primers lack specificity.

[0081] 4. Establishment and universality verification of the FrBy label amplification system

[0082] The FrBy marker was amplified by PCR in eight kiwifruit samples (male and female). The first four samples were from female plants, and the last four were from male plants. The results are as follows: Figure 4 As shown, no specific bands were amplified in any of the four female samples; while in the four male samples, only sample 25 successfully amplified a specific band consistent with the expected marker band position. Overall analysis indicates that the FrBy marker performed poorly in this experiment, failing to stably amplify sex-specific bands in all samples. Therefore, the FrBy marker lacks sufficient sex identification specificity and cannot be widely used for sex identification in kiwifruit.

[0083] 5. Establishment and universality verification of the Fr-labeled amplification system

[0084] Using Primer 3.0 and NCBI Primer to align the FrBy gene sequence, the 22 primer pairs designed in Table 3 were named the Fr series. After screening, 18 primer pairs were found to have unclear bands or no bands, and finally 6 primer pairs (see Table 4) were selected for subsequent experiments. To evaluate the amplification effect of these primers, PCR amplification was performed on 8 kiwifruit samples, the first 4 of which were female plants and the last 4 were male plants. The experimental results are as follows: Figure 5 As shown.

[0085] from Figure 5It can be seen that all six primer pairs in the Fr series produced 1 to 7 fragments after amplification, with DNA fragment sizes ranging from 100 to 1000 bp. Specifically, primer Fr-1 failed to amplify a specific band in four female samples, but amplified a specific band of approximately 550 bp in four male samples, indicating that Fr-1 can effectively distinguish between male and female plants. Therefore, Fr-1 will be used for sex identification amplification in subsequent experiments. In contrast, primers Fr-2, Fr-3, Fr-4, Fr-5, and Fr-6 amplified multiple bands in eight samples, and the banding patterns were irregular; therefore, they will not be considered as candidate primers for subsequent experiments.

[0086] 4. Further validation of Fr-1 marker in all samples

[0087] To further verify whether Fr-1 can be used for sex identification of kiwifruit, PCR amplification was performed on all collected samples of *Actinidia chinensis* and *Actinidia deliciosa*. The results are as follows: Figure 6 .Depend on Figure 6 It was found that no bands were amplified in any of the 48 female samples, while bands were amplified in all 24 male samples, and the size was consistent with the expected product. Therefore, Fr-1 has a 100% accuracy rate in sex identification of kiwifruit, which has been fully validated in both Chinese kiwifruit and delicious kiwifruit, and it can be well used for sex identification in kiwifruit.

[0088] 5. Verification of the universality of the Fr-1 marker in different varieties

[0089] Considering that the designed primers should have universal applicability, the Fr-1 marker was applied to the identification of other kiwifruit varieties and seedlings to verify its universality (samples are shown in Table 1). The experimental results are as follows: Figure 7 The analysis showed that specific bands were amplified in all six male kiwifruit samples from other varieties, while no bands were amplified in the remaining 13 female samples. This indicates that the Fr-1 marker can successfully amplify stable bands in male samples from other varieties, but cannot amplify bands in female samples, and the band size is the same as expected, consistent with previous research results, suggesting that Fr-1 can be accurately used for sex identification.

[0090] 6. Identification of seedlings using Fr-1 markers

[0091] 'Huahong 4' is the world's first tetraploid red-fleshed female kiwifruit variety. The Fr-1 marker was applied to the identification of 'Huahong 4' seedlings. Sample information is shown in Table 1, and the identification results are as follows: Figure 8 .Depend on Figure 8It was found that among the 24 seedling samples, 12 samples were able to amplify specific bands, and the band size was the same as expected. The results indicate that the Fr-1 marker can amplify stable bands in seedlings, and has certain application value in the identification of seedlings.

[0092] III. Conclusion

[0093] Kiwifruit, a dioecious crop with high economic value, sees female plants generating significantly higher economic value and market demand than male plants in its industrial development. With advancements in molecular biology techniques, kiwifruit sex determination has gradually shifted from traditional morphological identification to molecular marker recognition. In particular, primer design and molecular markers enable accurate sex determination in the early growth stages of kiwifruit, providing crucial support for subsequent breeding efforts. This study first demonstrated that the SmY1 marker's identification effect in Actinidia chinensis (also known as Delicious kiwifruit) is unsatisfactory, indicating that its applicability is highly susceptible to kiwifruit variety influences. The S1032 marker failed to amplify the corresponding specific band. While the FrBy marker is considered a candidate gene for sex determination, its accuracy was found to be low in practical applications.

[0094] This invention designed a series of primers, and after screening, identified a male-specific primer pair, Fr-1, which is highly effective for sex identification in kiwifruit. Experimental results show that the Fr-1 primer exhibits good repeatability and can rapidly and accurately identify the sex of kiwifruit through PCR amplification. Further universality verification results show that the Fr-1 primer can efficiently and accurately distinguish between male and female kiwifruit plants of different varieties, with near-zero error during the verification process, indicating high reliability and trustworthiness. Furthermore, the Fr-1 marker can amplify a specific band in 'Huahong 4' seedlings, demonstrating practical application value. Further field trials with larger sample sizes can be conducted to ensure its accuracy. In summary, the Fr-1 primer not only possesses strong universality but also has broad field application value, providing an efficient and reliable tool for kiwifruit sex identification and laying a technical foundation for the development and industrial utilization of kiwifruit varieties.

Claims

1. A primer for gender identification of kiwifruit female and male plants, characterized in that, The primer comprises a forward primer and a reverse primer, the sequence of the forward primer is 5' AGCCATCTCCAACACCACAG 3', and the sequence of the reverse primer is 5' GCTCGGGATGAATAGGGTGG 3'.

2. A kit for gender identification of kiwifruit female and male plants, characterized by, The primer comprises a forward primer and a reverse primer, the sequence of the forward primer is 5' AGCCATCTCCAACACCACAG 3', and the sequence of the reverse primer is 5' GCTCGGGATGAATAGGGTGG 3'.

3. The kit for gender identification of kiwifruit plants according to claim 2, characterized in that, The detection reagent required for detecting each gene of the kiwi male and female plants based on the PCR analysis method is further included.

4. A detection method for gender identification of kiwifruit female and male plants, characterized in that, The method comprises the following steps: (1) DNA extraction is performed on the kiwi sample to be tested, and the kiwi is Actinidia chinensis, Actinidia deliciosa, Actinidia arguta, Actinidia eriantha or Actinidia macrosperma; (2) the extracted sample DNA is subjected to PCR amplification by using the primer according to claim 1; (3) gel electrophoresis is performed, and the gender of the kiwi male and female plants is identified.

5. The detection method according to claim 4, characterized in that, The PCR amplification program is as follows: 1) pre-denaturation: 94℃, 5 min; 2) denaturation: 94℃, 30 s; 3) annealing: 56℃, 40 s; 4) extension: 72℃, 2 min; 5) re-extension: 72℃, 5 min; 6) 4℃ keeping.

6. Use of the primer of claim 1 in gender identification of kiwifruit male and female plants, wherein, The kiwi male and female plants are Actinidia chinensis, Actinidia deliciosa, Actinidia arguta, Actinidia eriantha or Actinidia macrosperma.

7. Use of the kit according to claim 2 or 3 for gender identification of kiwifruit plants, wherein, The kiwi male and female plants are Actinidia chinensis, Actinidia deliciosa, Actinidia arguta, Actinidia eriantha or Actinidia macrosperma.

Citation Information

Patent Citations

  • Molecular marker for early sex identification of actinidia arguta seedlings and applications thereof

    CN109609686A

  • InDel molecular marker for discriminating sex of Actinidia arguta and uses thereof

    KR1020230143303A