Molecular markers, primers and methods for identifying hybrid purity of eggplant varieties and applications
By combining molecular markers at specific locations in the eggplant genome with KASP primers for fluorescence quantitative detection, the problems of time-consuming, labor-intensive, and costly traditional eggplant hybrid purity identification have been solved, enabling rapid and accurate hybrid purity identification and breeding selection.
Patent Information
- Application Number
- CN202510268765.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-07
- Publication Date
- 2026-02-17
- Estimated Expiration
- 2045-03-07
AI Technical Summary
Traditional methods for identifying the purity of eggplant hybrids are time-consuming and labor-intensive, easily affected by environmental and human factors, and existing molecular marker detection technologies are costly.
By using molecular markers located at specific locations in the eggplant genome, combined with KASP primers and quantitative fluorescence detection, a rapid and accurate purity identification method was developed, which accelerates the selection of hybrid plants through molecular marker-assisted selection breeding.
This technology enables rapid and accurate identification of the purity of eggplant hybrids, reducing testing costs and improving identification efficiency and accuracy.
Smart Images

Figure CN119913278B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of plant breeding, in particular to a molecular marker, primer, method and application for identifying hybrid purity of eggplant varieties. BACKGROUND
[0002] Eggplant (Solanum melongena L.) is an annual herb of Solanaceae and Solanum, with a long cultivation history, a wide planting area, and a great popularity among the public, and has excellent economic benefits, playing a very important role in vegetable crops.
[0003] Artificial emasculation and pollination are the main means of eggplant hybrid seed production, and the purity of the seeds cannot be guaranteed, so it is necessary to identify the purity of eggplant hybrids to ensure that excellent varieties are more efficiently applied in production.
[0004] Seed purity is a manifestation of the consistency of varieties, and is an important indicator of seed quality and the main basis for seed grading, and is positively correlated with economic benefits. Therefore, purity identification of hybrid seeds is an essential step in the actual production process of hybrid seeds, and is the key to ensuring that excellent varieties are better utilized.
[0005] Traditional hybrid seed purity identification is mainly carried out in the field, and is detected by plant morphology, which is time-consuming, labor-intensive, susceptible to environmental and human factors, and has low accuracy; with the development of genome sequencing technology, researchers have developed SNP marker sites for both parents, and currently, SNP detection, as the latest molecular marker detection method, has been recommended by many international organizations, such as the International Seed Testing Association (ISTA), the International Union for the Protection of New Varieties of Plants (UPOV), the International Seed Federation (ISF), etc. as a method for variety identification at the DNA level. There are mainly SNP chip platforms, sample high-throughput in situ scanning platforms (LGC KASP technology, Life Taqman technology), and site and sample high-throughput targeted sequencing technologies, etc. These technology platforms have high costs. SUMMARY
[0006] The present application is made in view of the above problems, and aims to provide a molecular marker for identifying the purity of eggplant hybrid varieties.
[0007] Specifically, the present application provides the application of the molecular marker in the following aspects, including:
[0008] (I) predicting, screening and / or identifying the purity of eggplant hybrids;
[0009] and / or (II) improving eggplants;
[0010] The molecular marker includes at least one of a first molecular marker and a second molecular marker;
[0011] The first molecular marker is located at the base position 36453022 of chromosome 1 of the eggplant genome;
[0012] The second molecular marker is located at the base position 98723146 of chromosome 1 of the eggplant genome;
[0013] The improvement includes accelerating the selection of hybrid planting plants in the offspring eggplant by molecular marker assisted selection breeding.
[0014] The application develops parent polymorphism KASP primer through parent chip sequencing data, combines F1 rapid seed germination, DNA extraction and laboratory fluorescence quantitative detection, and quickly and accurately completes the purity identification work.
[0015] The second aspect of the application provides a primer set, which comprises: (I) a first forward primer set:
[0016] The first forward primer set comprises a nucleotide sequence as shown in SEQ ID NO. 1
[0017] SEQ ID NO. 1: GAAGGTGACCAAGTTCATGCTATTGGATCTACACACGAGGGGC .
[0018] And / or, (II) a second forward primer set:
[0019] The first forward primer set comprises a nucleotide sequence as shown in SEQ ID NO. 2;
[0020] SEQ ID NO. 2: GAAGGTCGGAGTCAACGGATTATTGGATCTACACACGAGGGGA .
[0021] And / or, (III) a third forward primer set:
[0022] The third forward primer set comprises a nucleotide sequence as shown in SEQ ID NO. 3;
[0023] SEQ ID NO. 3: GAAGGTGACCAAGTTCATGCTACTTCCTCCTAAACATACTTAGACGT .
[0024] And / or, (IV) a fourth forward primer set:
[0025] The fourth forward primer set comprises a nucleotide sequence as shown in SEQ ID NO. 4;
[0026] SEQ ID NO. 4: GAAGGTCGGAGTCAACGGATTACTTCCTCCTAAACATACTTAGACGC .
[0027] And / or, (V) a first reverse primer set,
[0028] the first reverse primer group has a nucleotide sequence as shown in SEQ ID NO. 5;
[0029] SEQ ID NO. 5: TCACGACCCATTTGATAGGCTTAA.
[0030] and / or, (VI) a second reverse primer group,
[0031] the second reverse primer group has a nucleotide sequence as shown in SEQ ID NO. 6;
[0032] SEQ ID NO. 6: GAAAATGAGGTGACTGGAAAGGTG.
[0033] and / or, (VII) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in any one of (I) to (VI), but differs from the nucleotide sequence shown in any one of (I) to (VI) due to the degeneracy of the genetic code;
[0034] and / or, (VIII) a nucleotide sequence obtained by substitution, deletion or addition of one or more nucleotides to the nucleotide sequence shown in any one of (I) to (VII), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in any one of (I) to (VII);
[0035] and / or, (IX) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence shown in any one of (I) to (VIII);
[0036] and / or, the linker sequence comprises a nucleotide sequence as shown in SEQ ID NO. 7 or SEQ ID NO. 8;
[0037] SEQ ID NO. 7: GAAGGTGACCAAGTTCATGCT (FAM);
[0038] SEQ ID NO. 8: GAAGGTCGGAGTCAACGGATT (HEX).
[0039] The third aspect of the present application provides the use of the primer group of the second aspect in the following aspects:
[0040] (I) predicting, screening and / or identifying the purity of eggplant hybrid;
[0041] and / or, (II) improving eggplant;
[0042] and / or, (III) a kit for predicting, screening and / or identifying the purity of eggplant hybrid;
[0043] The improvement comprises accelerating selection of a Solanum lycopersicum hybrid in a progeny Solanum lycopersicum by marker-assisted selection breeding.
[0044] The fourth aspect of the present application provides a kit, characterized in that it comprises the primer set according to the second aspect of the present application.
[0045] The fifth aspect of the present application provides use of the kit according to the fourth aspect of the present application in:
[0046] (I) predicting, screening and / or identifying purity of a Solanum lycopersicum hybrid;
[0047] and / or, (II) improving Solanum lycopersicum;
[0048] The improvement comprises accelerating selection of a Solanum lycopersicum hybrid in a progeny Solanum lycopersicum by marker-assisted selection breeding.
[0049] The sixth aspect of the present application provides a method for identifying purity of a Solanum lycopersicum hybrid, comprising the following steps: extracting genomic DNA of Solanum lycopersicum, identifying genotype of Solanum lycopersicum using the primer set according to the second aspect of the present application and / or the kit according to the fourth aspect of the present application, and identifying purity of a Solanum lycopersicum hybrid.
[0050] According to some embodiments of the present application, the standard for identifying purity of a Solanum lycopersicum hybrid according to the genotype is as follows:
[0051] (I) if the base pair at position 36453022 of chromosome 1 of the Solanum lycopersicum genome is AA and the base pair at position 98723146 of chromosome 1 of the Solanum lycopersicum genome is CC, it is determined to be a paternal-type false hybrid;
[0052] (II) if the base pair at position 36453022 of chromosome 1 of the Solanum lycopersicum genome is AA and the base pair at position 98723146 of chromosome 1 of the Solanum lycopersicum genome is CC, it is determined to be a paternal-type false hybrid;
[0053] (III) if the base pair at position 36453022 of chromosome 1 of the Solanum lycopersicum genome is CC and the base pair at position 98723146 of chromosome 1 of the Solanum lycopersicum genome is TT, it is determined to be a maternal-type false hybrid;
[0054] (IV) if the base pair at position 36453022 of chromosome 1 of the Solanum lycopersicum genome is CC and the base pair at position 98723146 of chromosome 1 of the Solanum lycopersicum genome is TT, it is determined to be a maternal-type false hybrid;
[0055] (V), if the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC, it is determined to be a true hybrid;
[0056] (VI), if the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC, it is determined to be a true hybrid;
[0057] (VII), if other genotype combinations occur, it is determined to be a hybrid of other types.
[0058] The seventh aspect of the present application provides a method for determining the purity of an eggplant hybrid, comprising the following steps: extracting eggplant genomic DNA, PCR amplification using the primer set of the second aspect of the present application and / or the kit as described in the fourth aspect of the present application, and obtaining the corresponding variety according to the fluorescence signal of the PCR product.
[0059] According to some embodiments of the present application, the standard for evaluating the purity of an eggplant hybrid according to the fluorescence signal is as follows:
[0060] (I), if the base pair at position 36453022 of chromosome 1 of the eggplant genome is AA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is CC, it is determined to be a paternal type false hybrid according to the fluorescence signal;
[0061] (II), if the base pair at position 36453022 of chromosome 1 of the eggplant genome is AA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is CC, it is determined to be a paternal type false hybrid according to the fluorescence signal;
[0062] (III), if the base pair at position 36453022 of chromosome 1 of the eggplant genome is CC and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TT, it is determined to be a maternal type false hybrid according to the fluorescence signal;
[0063] (IV), if the base pair at position 36453022 of chromosome 1 of the eggplant genome is CC and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TT, it is determined to be a maternal type false hybrid according to the fluorescence signal;
[0064] (V), if the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC, it is determined to be a true hybrid according to the fluorescence signal;
[0065] (VI) if the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC as judged by the fluorescence signal, the true hybrid is determined;
[0066] (VII) if other genotype combinations occur, the other type hybrid is determined.
[0067] According to some embodiments of the present application, the reaction procedure of the PCR amplification comprises:
[0068] (I) 94-95℃ pre-denaturation for 14-15min, 94-95℃ denaturation for 20-30s, 65-56℃ annealing and extension for 60-70s, 10-15 cycles, and each cycle is reduced by 0.6-0.8℃;
[0069] and / or (II) 94-95℃ denaturation for 20-30s, 55-57℃ annealing and extension for 60-70s, 26-30 cycles. BRIEF DESCRIPTION OF DRAWINGS
[0070] In order to more clearly illustrate the technical solutions in the drawings embodiments or prior art, the drawings needed to be used in the following embodiment or prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the drawings, and other drawings can be obtained according to the structures shown in the drawings without creative labor for those skilled in the art.
[0071] Figure 1 It is a phenotype diagram of the female parent (left), the male parent (middle) and the hybrid (right) of "Hongxiu No. 3".
[0072] Figure 2 It is the difference between the female parent and the male parent detected by the eggplant chip.
[0073] Figure 3 It is the genotyping diagram of Chr01-36453022 and Chr01-98723146 molecular markers of the present application in identifying true and false hybrids of "Hongxiu No. 3";
[0074] In the figure, A represents that the PCR product is the fluorescence signal corresponding to the primers Chr01-36453022 and Chr01-98723146, which is the male parent and the false hybrid of the male parent type;
[0075] B represents that the PCR product is the fluorescence signal corresponding to the primers Chr01-36453022 and Chr01-98723146, which is the female parent and the false hybrid of the female parent type;
[0076] C indicates: PCR product has two fluorescent signals of primers Chr01-36453022, Chr01-98723146, which is hybrid F1.
[0077] The purposes, functional features and advantages of the drawings will be further described with reference to the drawings in conjunction with embodiments. DETAILED DESCRIPTION
[0078] Hereinafter, specific embodiments of the reference electrode, lithium ion battery and the preparation method and application thereof according to the present application will be specifically described with appropriate reference to the drawings. However, there will be cases where unnecessary detailed description is omitted. For example, there will be cases where detailed description of matters known well and repeated description of substantially identical structures are omitted. This is to avoid the following description from becoming unnecessarily lengthy and to facilitate understanding by those skilled in the art. In addition, the drawings and the following description are provided to enable those skilled in the art to fully understand the present application, and are not intended to limit the subject matter recited in the claims.
[0079] The "ranges" disclosed in the present application are defined in the form of lower and upper limits, and a given range is defined by selecting a lower limit and an upper limit, and the selected lower limit and upper limit define the boundaries of a particular range. The ranges defined in this way can include or exclude the end values, and can be arbitrarily combined, i.e., any lower limit can be combined with any upper limit to form a range. For example, if the ranges 60-120 and 80-110 are listed for a particular parameter, it is understood that the ranges 60-110 and 80-120 are also contemplated. In addition, if the minimum range values 1 and 2 are listed, and if the maximum range values 3, 4 and 5 are listed, the following ranges are all contemplated: 1-3, 1-4, 1-5, 2-3, 2-4 and 2-5. In the present application, unless otherwise specified, the numerical range "a-b" represents a shorthand notation for any real combination of numbers between a and b, where a and b are both real numbers. For example, the numerical range "0-5" means that all real numbers between "0-5" have been listed herein, and "0-5" is just a shorthand notation for these numerical combinations. In addition, when it is stated that a parameter is an integer ≥ 2, it is equivalent to disclose that the parameter is, for example, an integer 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.
[0080] If not specifically stated, all embodiments and optional embodiments of the present application can be combined with each other to form new technical solutions.
[0081] If not specifically stated, all technical features and optional technical features of the present application can be combined with each other to form new technical solutions.
[0082] If not specifically stated, all steps of the application can be performed in any order, preferably in the order stated. For example, the method comprises steps (a) and (b) means that the method can comprise steps (a) and (b) in the order stated, or the method can comprise steps (b) and (a) in the order stated. For example, the method can further comprise step (c) means that step (c) can be added to the method in any order. For example, the method can comprise steps (a), (b) and (c), or the method can comprise steps (a), (c) and (b), or the method can comprise steps (c), (a) and (b), etc.
[0083] If not specifically stated, the terms "comprising" and "including" as used herein are open terms that also mean "consisting essentially of" and "consisting of". For example, the terms "comprising" and "including" can mean that other components can also be included or can mean that only the listed components are included.
[0084] If not specifically stated, the term "or" as used herein is inclusive. For example, the phrase "A or B" means "A, B, or both A and B". More specifically, any of the following are satisfied by the condition "A or B": A is true (or exists) and B is false (or does not exist); A is false (or does not exist) and B is true (or exists); or both A and B are true (or exist).
[0085] Before describing the present application in detail, it is to be understood that the application is not limited in its application to the details set forth in the following description, or to the details of the examples. The application is capable of other embodiments and of being practiced or being carried out in various ways. Also, it is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a plant," "the plant" or "one plant" also includes a plurality of plants; and reference to "a nucleic acid" is taken to optionally mean a plurality of copies of the nucleic acid molecule; similarly, the term "probe" optionally (and typically) encompasses a plurality of similar or identical probe molecules.
[0086] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation. Numerical ranges recited within the specification are inclusive of the numbers within the range and include each integer or non-integer fraction of the range limits. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice of the present application, the preferred methods and materials are described herein. In describing and claiming the present application, the following terminology will be used in accordance with the definitions set out below.
[0087] Certain definitions used in the specification and claims are provided below. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided:
[0088] "Agronomic," "agronomic trait," and "agronomic performance" refer to a trait (and the underlying genetic factor) of a given plant variety that contributes to yield over the course of a growing season. Individual agronomic traits include emergence vigor, nutrient use efficiency, stress tolerance, disease resistance or tolerance, insect resistance or tolerance, herbicide resistance, branching, flowering, seed fill, seed size, seed density, lodging resistance, shattering, fruit browning, and the like.
[0089] The term "allele" refers to any one of one or more alternative forms of a genetic sequence. For example, in a diploid cell or organism, two alleles of a given sequence typically occupy the corresponding loci on a pair of homologous chromosomes. In reference to a SNP marker, an allele refers to the particular nucleotide base present at the SNP locus in the individual plant.
[0090] An allele is "associated" with a trait when it is a DNA sequence or portion of or linked to an allele that affects the expression of the trait. The presence of the allele is an indication of how the trait will be expressed.
[0091] The term "amplification" in the context of nucleic acid amplification is any process by which additional copies of a selected nucleic acid (or transcribed therefrom) are produced thereby. Typical amplification methods include various polymerase-based replication methods, including polymerase chain reaction (PCR), ligase-mediated methods such as ligase chain reaction (LCR), and RNA polymerase-based amplification (e.g., transcription) methods. An "amplicon" is an amplified nucleic acid, e.g., a nucleic acid produced by amplification of a template nucleic acid by any available amplification method (e.g., PCR, LCR, transcription, etc.).
[0092] The term "chromosomal segment" refers to a contiguous linear segment of genomic DNA that is present on a single chromosome in a plant.
[0093] The term "complement" refers to a nucleotide sequence complementary to a given nucleotide sequence, i.e., the above sequence is associated by the rules of Watson-Crick base pairing.
[0094] "Cultivars" and "varieties" are used synonymously and refer to a population of plants within a species (e.g., Solanum melongena) that share certain genetic traits that distinguish them from other possible varieties within that species.
[0095] An "elite line" is an agronomically elite line resulting from many generations of breeding and selection for superior agronomic performance. Many elite lines are available and are known to those skilled in the art of Solanum melongena breeding.
[0096] An "elite population" refers to a mixed population of elite individuals or lines that can be used to represent the state of the art in agronomically elite genotypes of a given crop species, such as Solanum melongena.
[0097] An "advantageous allele" is an allele at a particular locus that confers or contributes to an agronomically desirable phenotype (e.g., a resistance to browning trait) and that allows for the identification of plants having that agronomically desirable phenotype. A marker advantageous allele is a marker allele that segregates with the advantageous phenotype.
[0098] A "genetic map" is a description of the genetic linkage relationships between loci on one or more chromosomes (or linkage groups) within a given species, usually presented in the form of a diagram or table. For each genetic map, the distance between loci is measured by how often their alleles appear together in a population (their recombination frequency). Alleles can be detected using DNA or protein markers, or observable phenotypes. A genetic map is a product of the mapping population, the type of markers used, and the likelihood of polymorphism at each marker between different populations. The genetic distance between loci can be different from one map to another. However, using common markers, information can be related between one map and another. One of ordinary skill in the art can use common marker positions to identify the positions of markers and other loci of interest on various genetic maps. The order of loci should be invariant between maps, however, there are often small variations in marker order due to, for example, detection of alternative repeat loci for a marker in different populations, differences in statistical methods used to order markers, new mutations, or experimental error.
[0099] "Genetic recombination frequency" is the frequency of exchange events (recombination) between two loci. Recombination frequencies can be observed by following the segregation of markers and / or traits after meiosis.
[0100] "Genome" refers to the complete set of DNA or genes carried by a chromosome or set of chromosomes.
[0101] "Genotype" refers to the genetic makeup of a cell or organism.
[0102] "Genetic stock" refers to the genetic material that constitutes the physical basis of the hereditary qualities of an organism. As used herein, genetic stock includes seeds and living tissue from which new plants can grow; or additional plant parts, such as leaves, stems, pollen, or cells, that can be cultured into whole plants. Genetic stock provides a source for plant breeders to improve the genetic traits of commercial cultivars.
[0103] "Haplotype" is the genotype of an individual at multiple loci, i.e., the combination of alleles. Typically, the loci described by a haplotype are physically and genetically linked, i.e., located on the same chromosomal segment. The term "haplotype" can refer to the alleles at a particular locus, or to the alleles at multiple loci along a chromosomal segment.
[0104] An individual is "homozygous" at a given locus if it has only one type of allele at that locus (e.g., a diploid individual has one copy of the same allele at a locus on each of the two homologous chromosomes). An individual is "heterozygous" at a given locus if there is more than one type of allele present at that locus (e.g., a diploid individual has one copy of each of two different alleles). The term "homogeneity" indicates that members of a population have the same genotype at one or more particular loci. In contrast, the term "heterogeneity" is used to indicate that individuals within a population differ in genotype at one or more particular loci.
[0105] The term "insertion-deletion" refers to an insertion or deletion, wherein one line can be said to have an inserted nucleotide or fragment of DNA relative to a second line, or the second line can be said to have a deleted nucleotide or fragment of DNA relative to the first line.
[0106] "Ingress" refers to the introduction or infusion of a gene, quantitative trait locus (QTL), marker locus, haplotype, marker profile, trait, or trait locus from the genome of one plant into the genome of another plant.
[0107] A "line" or "strain" is a group of individuals of the same lineage, which are typically inbred to some degree and are generally homozygous and homogenous (isogenic or near-isogenic) at most loci. A "subline" refers to an inbred subset of offspring that is genetically distinct from other similar inbred subsets that originated from the same ancestor. Conventionally, a subline is obtained by inbreeding seeds from a single eggplant plant selected at the F3 to F5 generation until residual segregating loci are "fixed" or homozygous at most or all loci. A commercial eggplant variety (or line) is typically created by pooling ("converging") the self-pollinated progeny of individual F3 to F5 plants from a controlled cross between two genetically distinct parents. While the above-described variety appears to be uniform, the self-pollinated variety derived from the selected plants will eventually (e.g., F8) become a mixture of homozygous plants that can be genotypically different at any locus that was heterozygous in the initially selected F3 to F5 plants. Marker-based sublines that differ from each other at one or more specific marker loci based on qualitative polymorphisms at the DNA level are obtained by genotyping seed samples derived from individual self-pollinated progeny of the selected F3-F5 plants. The seed samples can be genotyped directly as seeds or as plant tissue grown from such seed samples. Optionally, seeds that share a common genotype at a particular locus (or loci) are pooled, providing a subline that is genetically homogenous at the identified loci important for the trait of interest (e.g., anther extrusion, flowering time, heading time, and / or scab resistance, etc.).
[0108] "Linkage" refers to the phenomenon that alleles on the same chromosome tend to be co-inherited more often than would be expected by chance if their transmission were independent. Genetic recombination occurs throughout the genome at an assumed random frequency. A genetic map is constructed by measuring the frequency of recombination between pairs of traits or markers. The closer together traits or markers are on a chromosome, the lower the frequency of recombination and the higher the degree of linkage. Traits or markers are considered to be linked herein if they segregate substantially together. A recombination probability of 1 in 100 per generation is defined as a map distance of 1.0 centiMorgans (1.0 cM).
[0109] Genetic elements or genes located in a single chromosomal segment are physically linked. Advantageously, the two locus positions are in close proximity such that recombination between the pair of homologous chromosomes during meiosis does not occur between the two loci at a high frequency, e.g., such that the linked loci are co-segregated at least about 90% of the time, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.75%, or more of the time. Genetic elements located within a chromosomal segment are also genetically linked, typically within a genetic recombination distance of less than or equal to 50 centimorgans (cM), e.g., about 49, 40, 30, 20, 10, 5, 4, 3, 2, 1, 0.75, 0.5, or 0.25 cM or less. That is, two genetic elements within a single chromosomal segment recombine with each other during meiosis at a frequency of less than or equal to about 50%, e.g., about 49%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, or 0.25% or less.
[0110] In the present application, the phrase "closely linked" with respect to loci means that recombination between the two linked loci occurs at a frequency equal to or less than 10% (i.e., separated on a genetic map by no more than 10 cM). In other words, closely linked loci are co-segregated at least 90% of the time. Markers loci are particularly useful in the present application when they exhibit a significant probability of co-segregation (linkage) with a desired trait (e.g., resistance to browning). Closely linked loci, such as a marker locus and a second locus, can exhibit an interlocus recombination frequency of 10% or less, preferably about 9% or less, more preferably about 8% or less, more preferably about 7% or less, still more preferably about 6% or less, more preferably about 5% or less, still more preferably about 4% or less, more preferably about 3% or less, and still more preferably about 2% or less. In highly preferred embodiments, the relevant loci exhibit a recombination frequency of about 1% or less, e.g., about 0.75% or less, more preferably about 0.5% or less, or more preferably about 0.25% or less. Two loci on the same chromosome are also said to be "adjacent" to each other at a distance such that recombination between the two loci occurs at a frequency of less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, 0.25%, or less). In some cases, two different markers can have the same genetic map coordinates. In such cases, the two markers are so closely adjacent to each other that recombination between them occurs at a frequency as low as undetectable.
[0111] "coupling" state linkage refers to the state in which a "favorable" allele at the locus of interest is physically linked on the same chromosome strand as a "favorable" allele at a linked marker locus. In the coupling state, both favorable alleles are inherited together by the offspring. In the "repulsion" state linkage, a "favorable" allele at the locus of interest is physically linked to a "unfavorable" allele at a proximal marker locus, and the two "favorable" alleles are not inherited together (i.e., the two loci are "in phase" with each other).
[0112] "linkage disequilibrium" refers to the phenomenon that alleles tend to remain together in linkage groups at a higher frequency than expected from their respective frequencies when segregating from parents to offspring. Being in a state of linkage disequilibrium implies that the relevant loci are in a physically sufficient degree of proximity along the length of the chromosome such that they segregate together at a higher than random (i.e., non-random) frequency. Markers that exhibit linkage disequilibrium are considered to be linked. Linked loci co-segregate more than 50% of the time, e.g., from about 51% to about 100% of the time. In other words, two markers that co-segregate have a recombination frequency of less than 50% (and by definition are less than 50 cM apart on the same linkage group). As used herein, linkage can be between two markers, or between a marker and a locus affecting a phenotype. A marker locus can be "associated" (linked) with a trait. The degree of linkage of a marker locus to a locus affecting a phenotypic trait is measured as, e.g., the statistical probability of co-segregation of the molecular marker with the phenotype (e.g., F-statistic or LOD score).
[0113] "linkage group" (LG) refers to traits or markers that segregate substantially together. A linkage group corresponds substantially to a region of a chromosome that contains the genetic material encoding the trait or marker. Thus, a linkage group can be substantially attributed to a particular chromosome.
[0114] "locus" is a defined segment of DNA. For example, it can refer to the position on a chromosome at which a nucleotide, gene, sequence, or marker is located.
[0115] "map position" is the assigned position on a genetic map of linked genetic markers at which a particular marker can be found within a given species.
[0116] "mapping" is the process of defining linkage relationships of loci through the use of genetic markers, population segregation of markers, and standard genetic principles of recombination frequencies.
[0117] "Marker" or "molecular marker" or "marker locus" is a term used to denote a nucleic acid or amino acid sequence that is sufficiently unique to characterize a particular locus on a genome. Examples include restriction fragment length polymorphisms (RFLPs), simple sequence repeats (SSRs), target region amplified polymorphisms (TRAPs), isozyme electrophoresis, random amplified polymorphic DNA (RAPD), arbitrarily primed polymerase chain reaction (AP-PCR), DNA amplification fingerprinting (DAF), sequence-specific amplified region (SCAR), amplified fragment length polymorphism (AFLP), and single nucleotide polymorphism (SNP). In addition, other types of molecular markers are known in the art, and phenotypic traits can also be used as markers in the methods. All markers are used to define a particular locus on the Solanum lycopersicum genome. Thus each marker is an indication of a particular segment of DNA, with a unique nucleotide sequence. Map positions provide a measure of the relative position of a particular marker with respect to one another. When a trait is stated to be linked to a given marker, it is understood that the sequence affecting the trait actually co-segregates with the marker. If markers are identified on both sides of a trait, a more precise and definitive localization of the trait can be obtained. By measuring the occurrence of a marker in hybrid offspring, the presence of a trait can be detected by a relatively simple molecular test, without the need to actually assess the presence of the trait itself, which can be difficult and time consuming, as actual assessment of the trait requires growing the plants to a stage at which the trait can be expressed.
[0118] "Marker assisted selection" refers to the process of selecting one or more desirable traits in one or more plants by detecting one or more nucleic acids from the plant that are associated with the desired trait(s), and then selecting plants or germplasm that have the nucleic acid(s).
[0119] In certain examples, a plurality of marker loci or haplotypes are used to define a "marker profile." As used herein, "marker profile" refers to a combination of two or more marker loci or haplotypes within the genome of a particular plant. For example, in one example, a particular combination of marker loci or a particular combination of haplotypes defines the marker profile of a particular plant.
[0120] The terms "phenotype," "phenotypic trait," or "trait" can refer to the observable expression of a gene or series of genes. The phenotype can be observable by the naked eye, or by any other means of assessment known in the art, e.g., weighing, counting, measuring (length, width, angle, etc.), microscopy, biochemical analysis, or electromechanical determination. In some cases, the phenotype is directly controlled by a single gene or locus, i.e., a "monogenic trait" or "simple genetic trait." In the absence of large environmental variation, monogenic traits can segregate in a population to produce a "qualitative" or "discrete" distribution, i.e., phenotypes segregate into discrete classes. In other cases, the phenotype is the result of multiple genes and can be considered a "polygenic trait" or "complex trait." Polygenic traits segregate in a population to produce a "quantitative" or "continuous" distribution, i.e., phenotypes cannot be segregated into discrete classes. Both monogenic and polygenic traits can be influenced by the environment in which they are expressed, but polygenic traits tend to have greater environmental composition.
[0121] An "advantageous trait" or "advantageous phenotype," such as, for example, a fruit brown spot resistance, is a phenotype that is desirable in an agronomic context.
[0122] The term "plant" includes immature or mature whole plants, including plants from which seeds or grain or anthers have been removed. Seeds or embryos that will give rise to a plant are also considered plants.
[0123] A "plant part" refers to any portion or piece of a plant, including leaves, stems, shoots, roots, root tips, anthers, seeds, embryos, pollen, ovules, flowers, cotyledons, hypocotyls, pods, flowers, shoots, stems, tissues, tissue cultures, cells, and the like.
[0124] A "polymorphism" refers to a change or difference between two related nucleic acids. A "nucleotide polymorphism" refers to a nucleotide that is different in one sequence compared to the related sequence when the two nucleic acids are aligned for maximum identity.
[0125] "Polynucleotide," "polynucleotide sequence," "nucleic acid sequence," "nucleic acid fragment," and "oligonucleotide" are used interchangeably herein. These terms encompass nucleotide sequences and the like. A polynucleotide can be a polymer of RNA or DNA, which can be single-stranded or double-stranded, optionally containing synthetic, non-natural, or modified nucleotide bases. A polynucleotide in the form of a DNA polymer can be comprised of one or more strands of cDNA, genomic DNA, synthetic DNA or mixtures thereof.
[0126] "Primer" refers to an (synthetic or naturally occurring) oligonucleotide, which when placed in conditions where synthesis of a complementary strand is catalyzed by a polymerase, is capable of acting as a point of initiation for nucleic acid synthesis or replication along the complementary strand. Typically, a primer is an oligonucleotide of 10 to 30 nucleic acids in length, although longer or shorter sequences can be used. A primer can be provided in double-stranded form, although single-stranded form is preferred. A primer can also comprise a detectable label, such as a 5' end label.
[0127] "Probe" refers to an (synthetic or naturally occurring) oligonucleotide that is complementary (but not necessarily perfectly complementary) to a polynucleotide of interest and forms a double-stranded structure by hybridizing to at least one strand of the polynucleotide of interest. Typically, a probe is an oligonucleotide of 10 to 50 nucleic acids in length, although longer or shorter sequences can be used. A probe can also comprise a detectable label.
[0128] The terms "label" and "detectable label" refer to a molecule capable of detection, including, but not limited to, radioisotopes, fluorescent agents, chemiluminescent agents, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, chromophores, dyes, metal ions, metal sols, semiconductor nanocrystals, ligands (e.g., biotin, avidin, streptavidin, or hapten), and the like. Detectable labels can also include combinations of reporter genes and quenchers, such as employed in FRET probes or TaqMan probes.
[0129] The term "reporter gene" refers to a substance or a portion thereof that is capable of exhibiting a detectable signal that can be inhibited by a quencher. The detectable signal of the reporter gene is, for example, fluorescence in a detectable range.
[0130] The term "quencher" refers to a substance or a portion thereof that is capable of inhibiting, reducing, suppressing, etc. the detectable signal produced by the reporter gene.
[0131] The terms "quenching" and "fluorescence energy transfer" as used herein refer to the process in which, when a reporter gene and a quencher are in close proximity, and the reporter gene is excited by an energy source, a major portion of the energy of the excited state is transferred non-radiatively to the quencher, where it is either non-radiatively dissipated or emitted at a different wavelength than the reporter gene.
[0132] The term "quantitative trait locus" or "QTL" refers to a region of DNA that is associated with differential expression of a quantitative phenotypic trait in at least one genetic background (e.g., in at least one breeding population). The region of a QTL encompasses one or more genes that affect the trait under consideration or are in close linkage therewith.
[0133] A "reference sequence" or "consensus sequence" is a defined sequence used as a basis for sequence comparison. The reference sequence for the PHM marker is obtained by sequencing multiple lines at the locus, aligning the nucleotide sequences in a sequence alignment program (e.g., Sequencher), and then taking the most prevalent nucleotide sequence in the alignment. Polymorphisms that exist between individual sequences are annotated in the consensus sequence. The reference sequence is typically not an exact copy of any individual DNA sequence, but rather represents a mixture of the available sequences and is used to design primers and probes for polymorphisms within the sequence.
[0134] "Recombination frequency" is the frequency of exchange events (recombination) between two loci. Recombination frequency can be observed by tracking the segregation of markers and / or traits during meiosis.
[0135] "Selfed," "self pollinated," or "selfing" is the process by which a breeder mates a plant with itself; for example, a second generation hybrid, F2, with itself to produce progeny designated F2:3.
[0136] "SNP" or "single nucleotide polymorphism" refers to sequence variation that occurs when a single nucleotide (A, T, C, or G) in the genome sequence is altered or changed. A "SNP marker" exists when a SNP is mapped to a location on the Solanum lycopersicum genome. Numerous techniques for detecting SNPs are known in the art, including allele-specific hybridization, primer extension, direct sequencing, TM, and real-time PCR such as TaqMan assays.
[0137] A "transgenic plant" refers to a plant that comprises within its cells a foreign polynucleotide. Generally, the foreign polynucleotide has been stably integrated into the genome of the plant such that the polynucleotide is inherited by the progeny. The foreign polynucleotide can be integrated into the genome either alone or as part of a recombinant expression cassette. As used herein, "transgenic" refers to any cell, cell line, callus, tissue, plant part or plant that contains a foreign nucleic acid and has been altered by the hand of man to have a genotype that it would not otherwise have. The term "transgenic" as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation, using conventional plant breeding methods (e.g., crossing) or by the hand of man.
[0138] An "unfavorable allele" of a marker is one that segregates with an unfavorable plant phenotype, thereby providing a useful effect in identifying plants that can be removed from a breeding program or germplasm.
[0139] The term "vector" is used to refer to a polynucleotide or other molecule that transfers a nucleic acid fragment into a cell. Vectors optionally comprise parts that mediate maintenance of the vector, as well as permit its intended use (e.g., sequences necessary for replication, genes that confer drug or antibiotic resistance, multiple cloning sites, operably linked promoter / enhancer elements that enable expression of cloned genes, etc.). Vectors are often derived from plasmids, bacteriophage, or plant or animal viruses.
[0140] Turning now to the Examples:
[0141] Identification of markers. Haplotypes and / or marker profiles associated with traits of interest.
[0142] A variety of methods well known in the art are available for detecting a molecular marker or set of molecular markers that co-segregate with a trait of interest, such as resistance to browning. The basic idea behind these methods is the selection of markers for which the alternative genotypes (or alleles) have significantly different average phenotypes. Thus, one compares the magnitude of the difference between alternative genotypes (or alleles) or the level of significance of such a difference between marker loci. The trait gene is presumed to be located closest to the marker with the greatest associated genotypic difference.
[0143] Two such methods for detecting a trait locus of interest are: 1) population-based association analysis and 2) conventional linkage analysis. In population-based association analysis, lines are obtained from an existing population with multiple founders, such as an elite breeding line. Population-based association analysis relies on decay of linkage disequilibrium (LD) and the idea that, after so many generations of random mating in an unstructured population, only the correlation between genes controlling the trait of interest and markers in tight linkage with these genes will remain. In practice, most existing populations have population substructure.
[0144] Thus, by using data obtained from markers randomly distributed throughout the genome, individuals are assigned to populations, thereby minimizing the imbalance caused by population structure in each population (also referred to as subpopulation). For each line in a subpopulation, the phenotypic value is compared to the genotype (allele) at each marker locus. Significant marker-trait correlations indicate tight proximity between the marker locus and one or more loci involved in expression of the trait.
[0145] The same principles underlie conventional linkage analysis; however, LD is generated by constructing a population from a small number of founders. The founders are selected to maximize the level of polymorphism within the constructed population, and to assess the level of co-segregation of polymorphic sites with a given phenotype. A variety of statistical methods have been used to identify significant marker-trait associations. One such method is the interval mapping method, in which the likelihood that a gene controlling a trait of interest is located at each of a number of positions along a genetic map (e.g., at 1 cM intervals) is tested. Genotype / phenotype data are used to calculate a LOD score (log of the likelihood ratio) for each test position. When the LOD score exceeds a threshold value, there is significant evidence that a gene controlling the trait of interest is located at that position on the genetic map (which will fall between two specific marker loci).
[0146] The present disclosure provides marker loci that exhibit statistically significant co-segregation with at least one of the following traits: fruit brown rot resistance, as determined by population-based association analysis.
[0147] Detection of these loci or additional linked loci can be used in marker-assisted Solanum lycopersicum breeding programs to produce plants with advantageous characteristics.
[0148] The molecular markers for Solanum lycopersicum variety hybrid seed purity in the present disclosure include a first molecular marker and a second molecular marker;
[0149] The first molecular marker is a C to A variation at position 36453022 bp on chromosome 1 of the Solanum lycopersicum genome;
[0150] >Chr01-36453022: reference genome is SME-HQ_V2.0.
[0151] CTACATCTACGAGACCAAGTATGACTCATAGAATATTCTATGAGTCATAGACTGGGTCATAGATATGGTTCCAAATTTGAATTTCTGGAGGCATAGCCCTACAAGACCGGTCTACGCGTTGTAGACTACACTATGGCTCGTAAAGGTCTCTTCTGATAGAGTCCTAGAAACTCCTTGCCATTGGATCTACACACGAGGGG[C / A]AACTATGGCTCATGGAATATTTAATAGGCCATAGAAGACCCTT GTTGTGTAAAATTTCTAGTAACATGGTTTTTTAAGCCTATCAAATGGGTCGTGACATGACATCATCAGACCACAATTAATTAAACCAGCACTGAAGCAAGAATTCTATGCACCCACATGATCCCAACATAATCCCAAATATCCCACATTCAATAATT.
[0152] The second molecular marker is a T to C variation at position 98723146 bp on chromosome 1 of the eggplant genome.
[0153] >Chr01-98723146: Reference genome is SME-HQ_V2.0.
[0154] AGAATAACTAAAATAACAATTTATAAAAAGCTTATATTGCGCATGGGAAGATTATAAAGTTAGTCAGATCGATCATAAACCAGTAAAATCAAAAAGAGATGTAAAATGTTAAACATCAACCAACAACAAAAGGCAGATTATACACAAAAAATATTATTTTACAATGAGTTCTAAGACTTCCTCCTAAACATACTTAGACG[T / C]CAGCATTCTTTCACTTTCCCCCACATGCTCATGATTGCTCATAGGATTACCAAACTTGTTAACCACCTTTCCAGTCACCTCATTTTCACTAATTGCACCTGAATCAATCTTCTTGTTTCCATAGTCCCATACCAATGTCCCATATCTCAATCGACAAAATGTTGGGTGAAATATTTTTCTTCCAATCTAGGCATAATCAT.
[0155] According to some embodiments of the application, the eggplant variety comprises a mid-late eggplant variety.
[0156] According to some embodiments of the application, the eggplant variety comprises "Hongxiu No. 3".
[0157] According to some embodiments of the present application, the application comprises the following primer sequences:
[0158] Chr01-36453022-F1 (primer sequence 5'-3'):
[0159] GAAGGTGACCAAGTTCATGCTATTGGATCTACACACGAGGGGC;
[0160] Chr01-36453022-F2 (primer sequence 5'-3'):
[0161] GAAGGTCGGAGTCAACGGATTATTGGATCTACACACGAGGGGA;
[0162] Chr01-36453022-C (primer sequence 5'-3'):
[0163] TCACGACCCATTTGATAGGCTTAA;
[0164] Chr01-98723146-F1 (primer sequence 5'-3'):
[0165] GAAGGTGACCAAGTTCATGCTACTTCCTCCTAAACATACTTAGACGT;
[0166] Chr01-98723146-F2 (primer sequence 5'-3'):
[0167] GAAGGTCGGAGTCAACGGATTACTTCCTCCTAAACATACTTAGACGC;
[0168] Chr01-98723146-C (primer sequence 5'-3'):
[0169] GAAAATGAGGTGACTGGAAAGGTG.
[0170] According to some embodiments of the application, the 5' end of primer Chr01-36453022-F1 is connected to a FAM fluorescent linker.
[0171] According to some embodiments of the application, the 5' end of primer Chr01-98723146-F1 is connected to a FAM fluorescent linker.
[0172] According to some embodiments of the present application, a HEX fluorescent linker is connected to the 5' end of primer Chr01-36453022-F2.
[0173] According to some embodiments of the present application, a HEX fluorescent linker is connected to the 5' end of primer Chr01-98723146-F2.
[0174] According to some embodiments of the present application, the FAM fluorescent linker sequence is:
[0175] FAM: GAAGGTGACCAAGTTCATGCT;
[0176] According to some embodiments of the present application, the HEX fluorescent linker sequence is:
[0177] HEX: GAAGGTCGGAGTCAACGGATT.
[0178] According to some embodiments of the present application, the molecular marker is applied to identify true or false hybrid of the mid-late matured eggplant variety "Hongxiu No. 3".
[0179] According to some embodiments of the present application, the method for identifying true or false hybrid of the mid-late matured eggplant variety "Hongxiu No. 3" is:
[0180] (1) Taking the genomic DNA of the sample to be tested as a template, using two groups of primers corresponding to the molecular marker for amplification to obtain an amplification product;
[0181] (2) Performing fluorescence detection on the amplification product, if the primer Chr01-36453022, Chr01-98723146 corresponding FAM fluorescence signal is detected in the sample PCR product, then the corresponding detection site is A: A, C: C genotype, and it is determined as a false hybrid of paternal type;
[0182] If the primer Chr01-36453022, Chr01-98723146 corresponding HEX fluorescence signal is detected in the sample PCR product, then the corresponding detection site is C: C, T: T genotype, and it is determined as a false hybrid of maternal type;
[0183] If both FAM and HEX fluorescence signals are detected, then the detection site is C: A, T: C genotype, and it is determined as a true hybrid.
[0184] According to some embodiments of the present application, the method for identifying the hybrid purity of the mid-late matured eggplant variety "Hongxiu No. 3" includes the following steps:
[0185] (1) Taking the genomic DNA of the sample to be tested as a template, using two groups of primers corresponding to the molecular marker for amplification to obtain an amplification product;
[0186] (2) If the primer Chr01-36453022 and Chr01-98723146 corresponding HEX fluorescence signal is detected in the sample PCR product, the corresponding detection site is A:A, C:C genotype, and it is determined as the father type false hybrid;
[0187] If the primer Chr01-36453022 and Chr01-98723146 corresponding FAM fluorescence signal is detected in the sample PCR product, the corresponding detection site is C:C, T:T genotype, and it is determined as the mother type false hybrid;
[0188] If both FAM and HEX fluorescence signals are detected, the detection site is C:A, T:C genotype, and it is determined as the true hybrid;
[0189] If no fluorescence signal is detected, it is other genotype combination, and it is determined as other type hybrid;
[0190] (3) The ratio of true hybrid to total detection sample is calculated, and the eggplant hybrid seed purity is calculated.
[0191] According to some embodiments of the present application, the PCR amplification adopts Touchdown PCR; the Touchdown PCR amplification procedure is: 94℃ 15min; 95℃ 20s; 65℃-56℃ 60s, 10 cycles, and the annealing and extension temperature decreases by 0.8℃ in each cycle; 94℃ 20s; 57℃ 60s, 26 cycles.
[0192] According to some embodiments of the present application, the molecular marker is applied to identify the mid-late mature eggplant variety of “Hongxiu No. 3”.
[0193] The present application also provides the application of the above-mentioned molecular marker in identifying the true or false hybrid of the mid-late mature eggplant variety of “Hongxiu No. 3”.
[0194] Specifically, the method for identifying the true or false hybrid of the mid-late mature eggplant variety of “Hongxiu No. 3” is as follows:
[0195] (1) The genomic DNA of the sample to be tested is used as a template, and two groups of primers corresponding to the molecular marker are used for amplification to obtain an amplification product;
[0196] (2) If the primer Chr01-36453022 and Chr01-98723146 corresponding HEX fluorescence signal is detected in the sample PCR product, the corresponding detection site is A:A, C:C genotype, and it is determined as the father type false hybrid;
[0197] If the sample PCR product detects the FAM fluorescence signal corresponding to the primers Chr01-36453022 and Chr01-98723146, the corresponding detection site is C:C, T:T genotype, and it is determined as the maternal type false hybrid;
[0198] If both FAM and HEX fluorescence signals are detected at the same time, the detection site is C:A, T:C genotype, and it is determined as the true hybrid.
[0199] If no fluorescence signal is detected, it is other genotype combination, and it is determined as other type hybrid;
[0200] In addition, the application also discloses a method for identifying the hybrid purity of the mid-late matured eggplant variety "Hongxiu No. 3", which comprises the following steps:
[0201] (1) using the genomic DNA of the sample to be tested as a template, and performing PCR amplification by using the primers corresponding to the molecular markers in claim 3 to obtain an amplification product;
[0202] (2) performing fluorescence detection on the amplification product, and if the HEX fluorescence signal corresponding to Chr01-36453022 and Chr01-98723146 is detected, the corresponding detection site is A:A, C:C genotype, and it is determined as the paternal type false hybrid;
[0203] If the sample PCR product detects the FAM fluorescence signal corresponding to the primers Chr01-36453022 and Chr01-98723146, the corresponding detection site is C:C, T:T genotype, and it is determined as the maternal type false hybrid;
[0204] If both FAM and HEX fluorescence signals are detected at the same time, the detection site is C:A, T:C genotype, and it is determined as the true hybrid.
[0205] If no fluorescence signal is detected, it is other genotype combination, and it is determined as other type hybrid;
[0206] (3) calculating the ratio of the true hybrid to the total detection sample, and then the purity of the eggplant hybrid seed can be calculated.
[0207] Preferably, the PCR amplification adopts Touchdown PCR; the Touchdown PCR amplification procedure is as follows: 94℃ 15min; 95℃ 20s; 65℃-56℃ 60s, 10 cycles, and the annealing and extension temperature is reduced by 0.8℃ in each cycle; 94℃ 20s; 57℃ 60s, 26 cycles; the components and dosages used in the PCR amplification are shown in Table 1.
[0208] Table 1 Components and dosages used in PCR amplification
[0209] Preferably, the PCR amplification adopts Touchdown PCR; the Touchdown PCR amplification procedure is as follows: 94℃ 15min; 95℃ 20s; 65℃-56℃ 60s, 10 cycles, and the annealing and extension temperature is reduced by 0.8℃ in each cycle; 94℃ 20s; 57℃ 60s, 26 cycles; the components and dosages used in the PCR amplification are shown in Table 1.
[0210] The molecular marker of the application can be used not only for hybrid purity of the seeds of the single variety "Hongxiu No. 3", but also for effectively distinguishing the medium-late maturity eggplant variety "Hongxiu No. 3" from other varieties.
[0211] The application utilizes the method of whole genome chip sequencing variation detection to screen 2 SNP sites different between two parents, successfully develops SNP markers, and develops two pairs of KASP primers, which can quickly distinguish the paternal parent, the maternal parent and the hybrid by using fluorescence detection technology, i.e. the medium-late maturity eggplant variety "Hongxiu No. 3", which can be directly used for identification of the commercial medium-late maturity eggplant variety "Hongxiu No. 3", and then the molecular marker is relied on to evaluate the true and false hybrid of the commercial variety, and the rights and interests of the variety can be effectively protected. The purity of the variety can be quickly identified by using the molecular marker early, the loss caused by false hybrid can be effectively reduced, possible disputes can be reduced, the identification efficiency and accuracy can be improved, and evidence for variety protection is provided. Therefore, the application has great application value in identification of the hybrid of the medium-late maturity eggplant variety "Hongxiu No. 3" and variety protection.
[0212] The advantages and characteristics of the application will be clearer with the description. However, the specific experimental methods involved in the following examples are conventional methods or are implemented according to the suggested conditions in the manufacturer's instructions, unless otherwise specified.
[0213] If not specifically indicated, the technical means used in the examples is the conventional means familiar to those skilled in the art. The test methods in the following examples are conventional methods, unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained from the market.
[0214] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as familiar to those skilled in the art. In addition, any method and material similar or equivalent to those described can be applied in the application. The preferred implementation methods and materials described herein are only for demonstration.
[0215] Obtaining of the molecular marker for identification of the purity of the medium-late maturity eggplant variety "Hongxiu No. 3" in Example 1
[0216] 1. Whole genome chip sequencing variation detection
[0217] Variant detection refers to sequencing and difference analysis of a genome of an individual or a population of a species by high-throughput sequencing technology, obtaining a large number of single nucleotide polymorphism sites (SNP), insertion and deletion sites (InDel, Insertion / Deletion), structure variation sites (SV, Structure Variation) and copy number variation sites (CNV, copy number variation). With the substantial reduction in sequencing cost and the improvement in sequencing efficiency, whole genome chip sequencing variant detection has become one of the most rapid and effective methods for studying human diseases and molecular breeding of animals and plants. After the sequencing data is downloaded, the bioinformatics analysis is performed according to the following process.
[0218] (1) Quality control is performed on the original downloaded data to obtain clean data for analysis; the downloaded data is RAW date, and high-quality clean reads are obtained for subsequent analysis.
[0219] The filtering step of the sequencing data is as follows:
[0220] (a) removing reads containing adaptors;
[0221] (b) removing reads with more than 3 Ns;
[0222] (c) removing low-quality reads (the number of bases with a quality value Q < 5 accounts for more than 20% of the entire read).
[0223] (2) Aligning clean data with a reference genome; after obtaining clean reads, BWA software is used to align the clean reads with the reference genome, the initial alignment result is in sam format, and SAMtools software is used to convert the result to bam format and sort. If the results of a sample contain multiple libraries, SAMtools is used to combine the bam results of multiple libraries, picard is used to mark repetitive sequences, and data basic information statistics are performed;
[0224] (3) SNP variant detection; GATK software (v3.8, second-generation chip sequencing variant detection software https: / / software.broadinstitute.org / gatk / ) is used to detect SNPs;
[0225] (4) SNP screening; filtering out sites with a QUAL value (base quality value) less than 30, a MQ value less than 30, and a DP value less than 2, selecting double-parent homozygous and different SNP sites as candidate sites.
[0226] 2. Molecular marker development
[0227] According to the difference between the sequencing sequences between the parents, candidate SNP sites are selected, and KASP primers (the primers corresponding to the molecular markers of the application) are designed using the online primer design software SNP Primer (www.snpway.com). The KASP primers include a pair of specific primers containing different fluorescent adapters (Primer A and Primer B) and a reverse common primer (Primer C). Primer A is a FAM fluorescent adapter (GAAGGTGACCAAGTTCATGCT), and Primer B is a HEX fluorescent adapter (GAAGGTCGGAGTCAACGGATT). A primer pair with suitable specificity and annealing temperature is selected, and the primer is synthesized by Beijing Qikexing Company.
[0228] When the molecular marker is applied, the following steps are specifically included:
[0229] (1) Taking the genomic DNA of the sample to be tested as a template, Touchdown PCR amplification is performed using the amplification primers of the molecular marker to obtain an amplification product; the amplification program of Touchdown PCR is as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, and the annealing and extension temperature decreases by 0.8℃ for each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles;
[0230] (2) The amplification product is detected and analyzed. If the sample PCR product detects the HEX fluorescent signal corresponding to the primers Chr01-36453022 and Chr01-98723146, the corresponding detection site is A:A, C:C genotype, and it is determined as a paternal type false hybrid;
[0231] If the sample PCR product detects the FAM fluorescent signal corresponding to the primers Chr01-36453022 and Chr01-98723146, the corresponding detection site is C:C, T:T genotype, and it is determined as a maternal type false hybrid;
[0232] If both FAM and HEX fluorescent signals are detected, the detection site is C:A, T:C genotype, and it is determined as a true hybrid;
[0233] If no fluorescent signal is detected, it is other genotype combination, and it is determined as other type hybrid; (in actual detection, no fluorescent signal is produced, which may be caused by powder mixing in actual production).
[0234] The ratio of true hybrid to total detection sample is calculated, and the purity of eggplant hybrid seed is calculated.
[0235] 3. Specific application examples
[0236] Using two SNP markers, 188 samples to be tested were detected, and the proportion of true hybrids in the samples was calculated according to the detection results of the SNP markers. The primers correct each other, and when both primers are heterozygous during F1 detection, it is determined to be a true hybrid. The number of hybrid plants is determined by the number of single plants with consistent genotypes of the two marker sites, and the purity of the seeds is calculated (Tables 2 and 3). The primers have good stability in field verification tests, and are consistent with the results of field tests, and can be used for purity identification of eggplant hybrid varieties.
[0237] The detection method of the present embodiment can complete seed purity identification within 2h, and has the advantages of rapidity, low cost, and easy operation.
[0238] Table 2 Genotype and true and false hybrid determination of Chr01-36453022 and Chr01-98723146 marker detection
[0239]
[0240]
[0241]
[0242]
[0243]
[0244]
[0245] Table 3 Purity identification results
[0246]
[0247]
[0248] In summary, in breeding, by molecular marker identification screening, if the FAM fluorescence signal corresponding to the primers Chr01-36453022 and Chr01-98723146 is detected, it can be determined to be a false hybrid of the female parent; if the HEX fluorescence signal corresponding to the primers Chr01-36453022 and Chr01-98723146 is detected, it is a false hybrid of the male parent; if both fluorescence signals are detected, the detection site is C:A, T:C genotype, and it is determined to be a true hybrid. Through the screening of the molecular markers in the early stage, the purity of the commodity seeds can be identified, and the variety can be protected. The method is simple and easy to operate, and can greatly improve the efficiency for breeders.
[0249] Note that the present application is not limited to the above-described embodiments. The above-described embodiments are merely examples, and embodiments having substantially the same configuration, function, and effect as the technical idea of the present application are included in the technical scope of the present application. Furthermore, other modes constructed by applying various modifications to the embodiments, or by combining part of the configurations of the embodiments, which can be conceived by those skilled in the art, without departing from the spirit of the present application, are also included in the scope of the present application.
Claims
1. Use of a reagent for detecting a molecular marker in the following aspects, characterized in that, (I) predicting, screening and / or identifying hybrid purity of eggplant; and / or, (II) improvement of eggplant; the molecular marker comprises at least one of a first molecular marker and a second molecular marker; the first molecular marker is a C to A variation at position 36453022 bp on chromosome 1 of the eggplant genome; the second molecular marker is a T to C variation at position 98723146 bp on chromosome 1 of the eggplant genome; the improvement comprises accelerating selection of hybrid plants in the offspring eggplant by molecular marker assisted selection breeding; the variety of the eggplant is Hongxiu No. 3; the genome is SME-HQ_V2.
0.
2. A primer set characterized in that, the primer set comprises: a first primer set and a second primer set; the first primer set consists of: (a) a forward primer as shown in the nucleotide sequence of SEQ ID NO. 1; (b) a forward primer as shown in the nucleotide sequence of SEQ ID NO. 2; (c) a reverse primer as shown in the nucleotide sequence of SEQ ID NO. 5; the second primer set consists of: (a) a forward primer as shown in the nucleotide sequence of SEQ ID NO. 3; (b) a forward primer as shown in the nucleotide sequence of SEQ ID NO. 4; (c) a reverse primer as shown in the nucleotide sequence of SEQ ID NO.
6.
3. Use of the primer set of claim 2 in the following aspects: (I) predicting, screening and / or identifying hybrid purity of eggplant; and / or, (II) improvement of eggplant; and / or, (III) a kit for predicting, screening and / or identifying hybrid purity of eggplant; the improvement comprises accelerating selection of eggplant hybrids in the offspring eggplant by molecular marker assisted selection breeding; the variety of the eggplant is Hongxiu No.
3.
4. A kit, characterized in that, comprising the primer set of claim 2.
5. Use of the kit of claim 4 in the following aspects: (I) predicting, screening and / or identifying hybrid purity of eggplant; and / or, (II) improvement of eggplant; the improvement comprises accelerating selection of eggplant hybrids in the offspring eggplant by molecular marker assisted selection breeding; the variety of the eggplant is Hongxiu No.
3.
6. A method for identifying the purity of a hybrid eggplant, characterized by, comprising the following steps: extracting eggplant genomic DNA, identifying the genotype of the eggplant using the primer set of claim 2 and / or the kit of claim 4, and identifying the hybrid purity of the eggplant; the variety of the eggplant is Hongxiu No. 3; wherein the standard for identifying the genotype of the eggplant to determine the hybrid purity of the eggplant is as follows: (I) if the 36453022th base pair on chromosome 1 of the eggplant genome is AA and the 98723146th base pair on chromosome 1 of the eggplant genome is CC, it is determined to be a paternal type false hybrid; (I) if the base pair at position 36453022 of chromosome 1 of the eggplant genome is CC, and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TT, it is determined to be a maternal-type false hybrid; (II) if the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA, and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC, it is determined to be a true hybrid; (III) if other genotype combinations occur, it is determined to be a hybrid of other types.
7. A method for identifying the purity of a hybrid eggplant, characterized by, The method comprises the following steps: extracting eggplant genome DNA, PCR amplification using the primer set of claim 2 and / or the kit of claim 4, and obtaining the corresponding variety purity according to the fluorescence signal of the PCR product; The eggplant variety is Hongxiu No. 3; The standard for identifying the genotype of the eggplant hybrid purity is as follows: (I) if the base pair at position 36453022 of chromosome 1 of the eggplant genome is AA, and the base pair at position 98723146 of chromosome 1 of the eggplant genome is CC, it is determined to be a paternal-type false hybrid; (II) if the base pair at position 36453022 of chromosome 1 of the eggplant genome is CC, and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TT, it is determined to be a maternal-type false hybrid; (III) if the base pair at position 36453022 of chromosome 1 of the eggplant genome is CA, and the base pair at position 98723146 of chromosome 1 of the eggplant genome is TC, it is determined to be a true hybrid; (IV) if other genotype combinations occur, it is determined to be a hybrid of other types.
8. The method of claim 7, wherein, The reaction procedure of the PCR amplification comprises: (I) 94-95℃ pre-denaturation for 14-15min, 94-95℃ denaturation for 20-30s, 65-56℃ annealing and extension for 60-70s, 10-15 cycles, and reducing 0.6-0.8℃ for each cycle; and / or (II) 94-95℃ denaturation for 20-30s, 55-57℃ annealing and extension for 60-70s, 26-30 cycles.
Citation Information
Patent Citations
Primers for identifying purity of 'Fengbao' eggplant hybrid seeds and application of primers
CN110373495A
Breeding method of hybrid eggplant 23-15 and InDel molecular marker and method for identifying seed purity of hybrid eggplant 23-15
CN117502218A