Application of SMURF2 protein or coding gene thereof as target spot in preparation of antitumor drugs

Abstract

The invention discloses an application of SMURF2 protein or a coding gene thereof as a target spot in preparation of antitumor drugs. Researches find that reduction of the content of E3 ubiquitin ligase SMURF2 in vivo is beneficial to inhibition of tumor immune escape and enhancement of the efficacy of an anti-PD-1 blocking strategy. Therefore, the medicine is a reagent for reducing the expression quantity of the E3 ubiquitin ligase SMURF2 and is used for inhibiting PD-1 / PD-L1 mediated tumor immune escape. When the compound is used for resisting tumors, the expression of PD-L1 is preferably inhibited, so that tumor immune escape is inhibited, and the efficacy of an anti-PD-1 blocking strategy is improved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of SMURF2 protein or its encoding gene as a target in the preparation of anti-tumor drugs. Background Art

[0002] Tumors can evade immune-mediated recognition through a variety of immune escape mechanisms. For example, programmed cell death ligand 1 (PD-L1) can inhibit the activity of cytotoxic T cells after binding to programmed cell death receptor 1 (PD-1). In the tumor microenvironment (TME), overexpression of PD-L1 on cancer cells leads to apoptosis or impaired activity of tumor-infiltrating T cells, resulting in immune escape (CHEN J, LI G, MENG H, et al. Upregulation of B7-H1 expression is associatedwith macrophage infiltration in hepatocellular carcinomas [J]. Cancerimmunology, immunotherapy : CII, 2012, 61(1): 101-8.).

[0003] SMAD ubiquitin regulatory factor 2 (Smurf2) is a HECT-type E3 ubiquitin (Ub) ligase that regulates the ubiquitination modification of a variety of key intracellular proteins. An article reported (KLUPPF, GIESE C, HALAMA N, et al. E3 ubiquitin ligase Smurf2: a prognostic factorin microsatellite stable colorectal cancer [J]. Cancer management andresearch, 2019, 11: 1795-803.) that SMURF2 expression is upregulated in CRC specimens and affects survival according to the patient's MSI status. SMURF2 supports cancer cell migration and invasion, indicating that SMURF2 has an oncogenic function. SMURF2 plays a decisive role in cell differentiation, proliferation, and migration, and exhibits a dual role in cancer - as an oncogene and tumor suppressor.

[0004] A recent article reported (YU L, DONG L, WANG Y, et al. Reversible regulation of SATB1 ubiquitination by USP47 and SMURF2 mediates colon cancer cell proliferation and tumor progression [J]. Cancer letters, 2019, 448: 40-51.) that SMURF2 reduces aerobic glycolysis and colorectal cancer cell proliferation by promoting ChREBP ubiquitination and degradation. Although reports have shown that SMURF2 can reduce the proliferation of tumor colorectal cancer cells, there are currently no reports on SMURF2 regulating tumor immune escape. Summary of the invention

[0005] The purpose of the present invention is to provide a new use of E3 ubiquitin ligase SMURF2 and to provide the application of the molecule in anti-tumor drugs; another purpose of the present invention is to find a new molecule that can be effectively used to block tumor immune escape.

[0006] The inventors have found through research that reducing the expression of SMURF2 molecules can significantly inhibit the expression of PD-L1 in cells, thereby inhibiting tumor immune escape. It can be inferred that reducing the expression of SMURF2 molecules can enhance the efficacy of anti-PD-1 blocking strategies, and the present invention is completed.

[0007] The present invention first provides the use of SMURF2 protein or its encoding gene as a target in the preparation of an anti-tumor drug, wherein the anti-tumor drug has any one of the following functions: (1) Reduce the protein activity of SMURF2 protein; (2) Knockout the gene encoding SMURF2 protein; (3) Gene interference to reduce the expression of the gene encoding SMURF2 protein.

[0008] Preferably, the tumor type is colon cancer.

[0009] The present invention further provides the use of a compound in the preparation of an anti-tumor drug, wherein the compound has any one of the following functions: (1) Reduce the protein activity of SMURF2 protein; (2) Knockout the gene encoding SMURF2 protein; (3) Gene interference to reduce the expression of the gene encoding SMURF2 protein.

[0010] Preferably, the compound is any one of the following: (1) Small molecule compounds, monoclonal antibodies or nucleic acid aptamers that target SMURF2 protein and reduce the activity of SMURF2 protein; (2) a gene knockout sequence for knocking out the gene encoding the SMURF2 protein; (3) siRNA for reducing the expression of a gene encoding SMURF2 protein or a sequence for expressing siRNA.

[0011] Preferably, the tumor type is colon cancer.

[0012] Preferably, the anti-tumor drug is used in combination with an immune checkpoint inhibitor. The immune checkpoint inhibitor is an anti-PD-1 monoclonal antibody.

[0013] The present invention also provides an anti-tumor drug, the active ingredients of which include compound 1 and compound 2, wherein compound 1 is any one of the following: (1) Small molecule compounds, monoclonal antibodies or nucleic acid aptamers that target SMURF2 protein and reduce the activity of SMURF2 protein; (2) a gene knockout sequence for knocking out the gene encoding the SMURF2 protein; (3) siRNA for reducing the expression of the gene encoding SMURF2 protein or a sequence for expressing siRNA; Compound 2 is an immune checkpoint inhibitor. Preferably, the immune checkpoint inhibitor is an anti-PD-1 monoclonal antibody.

[0014] In the present invention, the gene knockout sequence for knocking out the gene encoding the SMURF2 protein can be constructed using the gene knockout method commonly used in the prior art, for example, using the CRISPR Cas9 gene knockout method, in which it is necessary to design an sgRNA sequence for the gene encoding the SMURF2 protein and construct it into a plasmid or the like for transgenic use.

[0015] The method for constructing a recombinant expression vector containing a molecule that reduces the content of SMURF2 is as follows: since the sgRNA sequence of the SMURF2 molecule is known in the art, a person of ordinary skill in the art can prepare a primer for SMURF2 sgRNA based on conventional means or obtain it commercially; use a restriction endonuclease to obtain a linearized vector; under the action of a ligase, connect the primer for sgRNA to the linearized vector, screen the successfully connected plasmid, and perform sequencing identification. The correctly identified plasmid can be used for subsequent applications.

[0016] In the present invention, the siRNA used to reduce the expression of the gene encoding the SMURF2 protein can be designed for the gene encoding the SMURF2 protein, and the siRNA can be directly synthesized for use, or a sequence for expressing the siRNA can be synthesized, such as in the form of shRNA, and a plasmid can be constructed for use, and the plasmid expresses the siRNA sequence in vivo to achieve gene interference.

[0017] Beneficial effects of the present invention: The present invention discloses the application of SMURF2 molecules in anti-tumor therapeutic drugs and tumor immune escape, provides new ideas and approaches for tumor immunotherapy based on immune checkpoint blockade, and has certain clinical application prospects.

[0018] The present invention has found that reducing the content of E3 ubiquitin ligase SMURF2 in the body helps inhibit tumor immune escape and enhance the efficacy of anti-PD-1 blocking strategies. Therefore, the above-mentioned drug is an agent that reduces the expression of E3 ubiquitin ligase SMURF2, which is used to inhibit PD-1 / PD-L1-mediated tumor immune escape. When used to fight tumors, it is preferred to inhibit PD-L1 expression, thereby inhibiting tumor immune escape and improving the efficacy of anti-PD-1 blocking strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 For Ctrl and Smurf2 KO CT26 (1 × 10 6 ) were subcutaneously transplanted into BALB / c mice, showing the tumor growth curve ( Figure 1 a), tumor weight ( Figure 1 b) and representative tumor images ( Figure 1 c). The results show the mean ± standard error (n ≥ 4), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0020] Figure 2 For Ctrl and Smurf2 KO MC38 cells (1 × 10 6 ) were subcutaneously transplanted into C57BL / 6 mice, showing the tumor growth curve ( Figure 2 a), tumor weight ( Figure 2 b) and representative tumor images ( Figure 2 c). The results show the mean ± standard error (n = 7), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0021] Figure 3 The tumor growth curves are shown in Figure 2. CT26 cells transfected with shCtrl and shSmurf2 were subcutaneously transplanted into BALB / c mice. Figure 3 a), tumor weight ( Figure 3 b) and representative tumor images ( Figure 3 c). The results show the mean ± standard error (n ≥ 6), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0022] Figure 4 MC38 cells transfected with shCtrl and shSmurf2 were subcutaneously transplanted into C57BL / 6 mice, and the tumor growth curve is shown ( Figure 4 a), tumor weight ( Figure 4 b) and representative tumor images ( Figure 4 c). The results show the mean ± standard error (n = 11), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0023] Figure 5 Figure 3. Tumor growth curves of CT26 cells transfected with Ctrl, Smurf2, and Smurf2-C716A were subcutaneously transplanted into BALB / c mice. Figure 5 a), tumor weight ( Figure 5 b) and representative tumor images ( Figure 5 c). The results show the mean ± standard error (n ≥ 8), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0024] Figure 6 For CT26 cells ( Figure 6 a) or MC38 cells ( Figure 6 In b), Smurf2 was knocked out, and after 0, 12, and 24 hours of interferon-γ stimulation, the expression level of PD-L1 in tumor cells was detected by Western Blot. The results show the mean ± standard error (n≥3), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0025] Figure 7 For CT26 cells ( Figure 7 a) or MC38 cells ( Figure 7 In b), Smurf2 was silenced, and after 0, 12, and 24 hours of interferon-γ stimulation, the expression level of PD-L1 in tumor cells was detected by Western Blot. The results show the mean ± standard error (n≥3), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0026] Figure 8 To knock out Smurf2 in CT26 cells, after 0 and 12 hours of interferon-γ stimulation, the expression level of PD-L1 on the surface of tumor cells was detected by flow cytometry. Figure 8 a in the figure is the peak value diagram of flow cytometry. Figure 8 b is the statistical graph of mean fluorescence intensity. The results show the mean ± standard error (n ≥ 3), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0027] Fig. 9 To silence Smurf2 in CT26 cells, after 0 and 12 hours of interferon-γ stimulation, the expression level of PD-L1 on the surface of tumor cells was detected by flow cytometry. Fig. 9 a in the figure is the peak value diagram of flow cytometry. Fig. 9 b is the statistical graph of mean fluorescence intensity. The results show the mean ± standard error (n ≥ 3), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0028] Fig.10 To overexpress Smurf2 and Smurf2-C716A in CT26 cells, after 0 and 12 hours of interferon-γ stimulation, the expression level of PD-L1 on the surface of tumor cells was detected by flow cytometry. Fig.10 a in the figure is the peak value diagram of flow cytometry. Fig.10 b is the statistical graph of mean fluorescence intensity. The results show the mean ± standard error (n ≥ 3), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0029] Fig.11 BALB / c mice were implanted with 1×10 6 Ctrl or Smurf2 KO CT26 tumor cells were implanted for 7 days and anti-PD-1 mAb or anti-IgG isotype control IgG2ɑ was injected intraperitoneally every 3 days. The tumor growth curve ( Fig.11 a), tumor weight ( Fig.11 b) and representative tumor images ( Fig.11 c). The results show the mean ± standard error (n ≥ 6), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0030] Fig.12 C57BL / 6 mice were implanted with 1×10 6Ctrl or Smurf2 KO MC38 tumor cells were implanted for 7 days and anti-PD-1 mAb or anti-IgG isotype control IgG2ɑ were intraperitoneally injected every 3 days. The tumor growth curve ( Fig.12 a), tumor weight ( Fig.12 b) and representative tumor images ( Fig.12 c). The results show the mean ± standard error (n ≥ 6), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. DETAILED DESCRIPTION

[0031] The reagents and raw materials used in the present invention are all commercially available or can be prepared according to literature methods. The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are calculated by volume.

[0032] Example 1: Smurf2 promotes tumor growth in immunized mice

[0033] The following primers were synthesized by Shanghai Jierui Bioengineering Co., Ltd. The specific sequences are as follows: Smurf2 gRNA upstream primer: CACCGACTCCTCCAGACCTACCGGA; Smurf2 gRNA downstream primer: AAACTCCGGTAGGTCTGGAGGAGTC.

[0034] shSmurf2 upstream primer: CCGGAATCCGGAACATTTATCCTATCTCGAGATAGGATAAATGTTCCGGATTTTTTTG; shSmurf2 downstream primer: AATTCAAAAAAATCCGGAACATTTATCCTATCTCGAGATAGGATAAATGTTCCGGATT.

[0035]

[0036] Smurf2-C716A is a mutation of cysteine ​​716 at Smurf2 to alanine.

[0037] (1) Smurf2 KO CT26 or MC38 cell lines: Primers for Smurf2 gRNA (Smurf2 gRNA upstream primer and Smurf2 gRNA downstream primer) were obtained from the market; the LentiCRISPRv2 linearized vector with GFP fluorescence was obtained using the restriction endonuclease BsmBI; the primers for gRNA (a pair of primers annealed to form a double strand) were connected to the linearized vector under the action of ligase, and the plasmids with successful connection were screened and sequenced for identification. The successfully connected plasmids were transfected into CT26 or MC38 cells, and cells with GFP green fluorescence were selected by flow sorting technology after 24 to 48 hours and spread into 96-well plates, with 1 cell per well, and cultured in an incubator at 37°C and 5% CO2. After 1-2 weeks, some cells were taken from each well to detect the expression of Smurf2 protein by Western Blot technology, and cells without Smurf2 protein expression were expanded and cultured.

[0038] (2) CT26 or MC38 cell lines expressing shSmurf2: Primers of shSmurf2 (shSmurf2 upstream primer and shSmurf2 downstream primer) were obtained from the market; restriction endonucleases AgeI and EcoRI were used to obtain the pLKO.1-TRC linearized vector with puromycin resistance; primers of shSmurf2 (a pair of primers annealed to form a double strand) were connected to the linearized vector under the action of ligase, and the successfully connected plasmids were screened and sequenced for identification. The successfully connected plasmids were transfected into CT26 or MC38 cells, and 6μg / ml or 2μg / ml puromycin was added after 24 to 48 hours and placed in an incubator at 37℃ and 5% CO2 for culture. After 3 days, a portion of cells in each well were taken to detect the expression of Smurf2 protein by Western Blot technology, and cells with reduced Smurf2 protein expression were expanded and cultured.

[0039] (3) CT26 or MC38 cell lines overexpressing Smurf2 and Smurf2-C716A: Primers for amplifying Smurf2 or Smurf2-C716A cDNA were obtained from the market; linearized vectors were obtained using restriction endonucleases; Smurf2 or Smurf2-C716A cDNA was obtained by PCR amplification (gene sequences were artificially synthesized and cloned into plasmids by gene synthesis companies), and sticky ends identical to those of expression vectors were obtained by enzyme digestion; cDNA was connected to the linearized vector under the action of ligase, and the successfully connected plasmids were screened and sequenced for identification. The successfully connected plasmids were transfected into CT26 or MC38 cells, and 6μg / ml or 2μg / ml puromycin was added after 24 to 48 hours and cultured in an incubator at 37°C and 5% CO2. After 3 days, a portion of cells in each well were taken to detect the expression of Smurf2 protein by Western Blot technology, and cells with increased Smurf2 protein expression were expanded and cultured.

[0040] (4) BALB / C or C57BL / 6 mice were purchased from Hangzhou Hangsi Biotechnology Co., Ltd. Mice aged 6 to 8 weeks were used in the experiment. All mice were housed under specific pathogen-free conditions. Mouse colon cancer cells CT26 or MC38 cells treated with the above steps (injection volume 1×10 per mouse) were injected into the mouse 6 The long and short dimensions of the tumors were measured using a digital caliper and the formula V = W × L was used. 2 ×0.5 to record the tumor volume, where W is the largest tumor diameter in centimeters and L is the second largest tumor diameter. Tumor tissues were collected for weight measurement and further analysis.

[0041] The results are as follows Figure 1-Figure 5 As shown: Mouse WT or Smurf2 KO CT26 cells were inoculated into BALB / c mice. The tumor size of the mice was measured using a vernier caliper 7 days after the cells were subcutaneously inoculated on the back of the mice. The size was measured every two days. The mice were killed around 19 days and the subcutaneous tumors were weighed. Figure 1 As shown, the tumor growth curve of the Smurf2 gene knockout group ( Figure 1 a), tumor weight ( Figure 1 b) and tumor size ( Figure 1 c) dropped sharply.

[0042] Similarly, mouse WT or Smurf2 KO MC38 cells were inoculated into C57BL / 6 mice, and the tumor size of the mice was measured using a vernier caliper 7 days later. The size was measured every two days, and the mice were killed around 19 days later, and the subcutaneous tumors were weighed. Figure 2 As shown, the tumor growth curve of the Smurf2 gene knockout group ( Figure 2 a), tumor weight ( Figure 2 b) and tumor size ( Figure 2 c) dropped sharply.

[0043] To further expand the above concept, the constructed shRNA-mediated Smurf2 knockdown cells were implanted into subcutaneous tumors, and mouse control cells or shSmurf2 CT26 cells were inoculated into BALB / c mice. After 7 days, the tumor size of the mice was measured using a vernier caliper. The size was measured every two days, and the mice were killed around 21 days to remove the subcutaneous tumors for weighing. Figure 3 As shown, the tumor growth curve of the Smurf2 gene knockdown group ( Figure 3 a), tumor weight ( Figure 3 b) and tumor size ( Figure 3 c) dropped sharply.

[0044] Similarly, mouse control cells or shSmurf2 MC38 cells were inoculated into C57BL / 6 mice. After 7 days, the tumor size of the mice was measured using a vernier caliper. The size was measured every two days. The mice were killed around 15 days and the subcutaneous tumors were weighed. Figure 4 As shown, the tumor growth curve of the Smurf2 gene knockdown group ( Figure 4 a), tumor weight ( Figure 4 b) and tumor size ( Figure 4 c) dropped sharply.

[0045] In addition, mouse control cells, CT26 cells overexpressing Smurf2 or overexpressing Smurf2-C716A were inoculated into BALB / c mice, and the tumor size of the mice was measured with a vernier caliper 7 days later. The size was measured every two days, and the mice were killed around 14 days later, and the subcutaneous tumors were weighed. Figure 5 As shown, the tumor growth curve of the Smurf2 gene knockdown group ( Figure 5 a), tumor weight ( Figure 5 b) and tumor size ( Figure 5 c) dropped sharply.

[0046] The above results indicate that Smurf2 gene knockout or knockdown can inhibit tumor growth in immune-competent mice, and Smurf2 gene elevation can promote tumor growth in immune-competent mice.

[0047] Example 2: Verification that Smurf2 promotes the expression of PD-L1 in tumor cells, thereby promoting tumor immune escape

[0048] The following primers were synthesized by Suzhou GeneGene Co., Ltd., and the specific sequences are as follows: Smurf2 siRNA upstream primer: GAGAAGGAGCUGGAGCUCAUUAUUU; Smurf2 siRNA downstream primer: AAAUAAUGAGCUCCAGCUCCUUCUC.

[0049] (1) Western Blot detection of Smurf2 and PD-L1 expression in CT26 and MC38 tumor cells: Cells were collected after 0, 12, and 24 hours of interferon-γ stimulation and subjected to Western Blot experiments.

[0050] Among them, interferon-γ (Z02916) was purchased from GenScript Company and used at a concentration of 80 ng / ml.

[0051] Antibody catalog numbers and sources used in Western Blot: Smurf2 (D8B8) was purchased from Cell Signaling Technology, and PD-L1 (D4H1Z) was purchased from Cell Signaling Technology.

[0052] (2) Flow cytometry to detect the expression of PD-L1 on the surface of CT26 tumor cells: The cells were collected 0, 12, and 24 hours after interferon-γ stimulation, and the cells were stained with PE / Cyanine 7 CD274 flow cytometry antibody at a ratio of 1:400 at room temperature in the dark. After 15 minutes, 500 μl of PBS (pH 7.2-7.4) was added, and the cells were centrifuged at 4°C and 5000 rpm for 5 minutes. After washing away the antibody, PBS was added to the cells according to the cell mass to suspend them and the expression of PD-L1 on the surface of tumor cells was detected by flow cytometry.

[0053] The product number and source of antibodies used in flow cytometry: PE / Cyanine 7 CD274 (124314) was purchased from BioLegend.

[0054] (3) Silencing genes: Evenly spread CT26 cells into the culture plate (taking a 24-well plate as an example, 50,000 to 100,000 cells per well). After the cells are completely attached to the wall, add the interference mix. The specific amount per well is as follows: Interference mix: 50 μl opti-MEM medium + 0.3-0.6 μl 10 μM siRNA + 6 times the amount of siRNA INTERFERin; INTERFERin was purchased from Polyplus (101000028).

[0055] The results are as follows Figure 6-Figure 10 As shown: The constructed Smurf2 KO CT26 cells or MC38 cells and control cells were plated into 24-well plates. After the cells were completely attached to the plate, interferon-γ was added for stimulation for 0, 12, and 24 hours, and the cells were collected for Western Blot experiments. Figure 6 As shown, compared with the control group, CT26 cells in the Smurf2 KO group ( Figure 6 a) and MC38 cells ( Figure 6 (b) The expression of PD-L1 was significantly decreased under IFN-γ stimulation.

[0056] The constructed shSmurf2 CT26 cells or MC38 cells and control cells were plated into 24-well plates. After the cells were completely attached to the plate, interferon-γ was added for stimulation for 0, 12, and 24 hours, and the cells were collected for Western Blot experiments. Figure 7 As shown, compared with control cells, in CT26 cells with shRNA-mediated Smurf2 knockdown ( Figure 7 a) and MC38 cells ( Figure 7 (b) The expression of PD-L1 was significantly decreased under IFN-γ stimulation.

[0057] The constructed Smurf2 KO CT26 cells and control cells were plated into 24-well plates. After the cells were completely attached to the plate, interferon-γ was added for stimulation for 0 and 12 hours, and the cells were collected for flow cytometry. Figure 8 As shown in the figure, compared with the control group cells, the expression of cell surface PD-L1 in CT26 cells in the Smurf2 KO group was significantly reduced under IFN-γ stimulation. Figure 8 a in the figure is the peak value diagram of flow cytometry. Figure 8 b in the figure is the statistical graph of the mean fluorescence intensity.

[0058] CT26 cells were plated in 24-well plates. After the cells were completely attached to the wall, Smurf2 was silenced for 24-48 hours. After 0 and 12 hours of stimulation with interferon-γ, the cells were collected and analyzed by flow cytometry. Fig. 9 As shown in the figure, compared with the control group cells, the expression of PD-L1 on the cell surface of CT26 cells in the Smurf2 silencing group was significantly reduced under IFN-γ stimulation. Fig. 9 a in the figure is the peak value diagram of flow cytometry. Fig. 9 b in the figure is the statistical graph of the mean fluorescence intensity.

[0059] The constructed CT26 cells overexpressing Smurf2 and Smurf2-C716A and control cells were plated into 24-well plates. After the cells were completely attached to the plate, interferon-γ was added for stimulation for 0 and 12 hours, and the cells were collected for flow cytometry. Fig.10 As shown in the figure, compared with the control group cells, the expression of PD-L1 on the cell surface of CT26 cells in the Smurf2 silencing group was significantly reduced under IFN-γ stimulation. Fig.10 a in the figure is the peak value diagram of flow cytometry. Fig.10 b in the figure is the statistical graph of the mean fluorescence intensity.

[0060] The results showed that Smurf2 gene knockout or knockdown could inhibit the expression of PD-L1 in tumor cells and on the cell surface, while Smurf2 gene elevation could promote the expression of PD-L1 in tumor cells and on the cell surface.

[0061] Example 3: Smurf2 knockout can enhance the efficacy of anti-PD-1 blocking strategies

[0062] Treated CT26 or MC38 cells (1×10 6 The long and short dimensions of the tumors were measured using a digital caliper and the formula V = W × L was used. 2 ×0.5 to record the tumor volume, where W is the maximum tumor diameter in centimeters and L is the second largest tumor diameter. Seven days after cell implantation, anti-PD-1 mAb or anti-IgG isotype control IgG2ɑ was intraperitoneally injected every 3 days.

[0063] Among them, anti-PD-L1 monoclonal antibody (A2122) and anti-IgG monoclonal antibody (A3123) were purchased from Selleck.

[0064] The results are as follows Figure 11-Figure 12 As shown: Mouse WT or Smurf2 KO CT26 cells were inoculated into BALB / c mice. After the cells were subcutaneously inoculated on the back of the mice, anti-PD-1 monoclonal antibody or anti-IgG monoclonal antibody was intraperitoneally injected into BALB / c mice inoculated with Smurf2 knockout CT26 tumor cells (Smurf2 KO) or wild-type control (WT). The injection was performed once every 3 days. The tumor size of the mice was measured with a vernier caliper every two days. The mice were killed around 15 days and the subcutaneous tumors were weighed. Fig.11 As shown, compared with the control group mice injected with anti-PD-1 monoclonal antibody intraperitoneally, the tumor growth curve of Smurf2 KO mice injected with anti-PD-1 monoclonal antibody intraperitoneally ( Fig.11 a), tumor weight ( Fig.11 b) and tumor size ( Fig.11 c) dropped sharply.

[0065] Mouse WT or Smurf2 KO MC38 cells were inoculated into C57BL / 6 mice. After the cells were subcutaneously inoculated on the back of the mice, anti-PD-1 monoclonal antibody or anti-IgG monoclonal antibody was intraperitoneally injected into BALB / c mice inoculated with Smurf2 knockout MC38 tumor cells (Smurf2 KO) or wild-type control (WT). The injection was once every 3 days. The tumor size of the mice was measured with a vernier caliper every two days. The mice were killed around 15 days and the subcutaneous tumors were weighed. Fig.12 As shown, compared with the control group mice injected with anti-PD-1 monoclonal antibody intraperitoneally, the tumor growth curve of Smurf2 KO mice injected with anti-PD-1 monoclonal antibody intraperitoneally ( Fig.12 a), tumor weight ( Fig.12 b) and tumor size ( Fig.12 c) dropped sharply.

[0066] The above results indicate that Smurf2 gene knockout or knockdown can inhibit tumor growth in immune-competent mice and enhance the efficacy of anti-PD-1 blocking strategy.

[0067] From the above experiments, we can see that PD-L1, as an important immune checkpoint, overexpression in the tumor immune microenvironment can lead to apoptosis or impaired activity of tumor-infiltrating T cells, thereby causing tumor immune escape. Based on this, it can be clearly inferred that when tumor cells in the body proliferate, reducing the expression of SMURF2 in the body can effectively prevent tumor immune escape and thus protect the body.

[0068] In summary, the increase of the indicator SMURF2 involved in the present invention in tumor tissue is closely related to the tumor immune microenvironment, and the occurrence and development of tumor patients can be assisted in diagnosis by detecting the SMURF2 gene and protein content in the patient's tumor tissue, and the expression level of SMURF2 in the patient can be targetedly reduced according to the test results to perform anti-tumor immune escape treatment.

[0069] Therefore, the present invention discloses the application of SMURF2 molecules in anti-tumor therapeutic drugs and tumor immune escape, provides new ideas and approaches for tumor immunotherapy based on immune checkpoint blockade, and has certain clinical application prospects.

Claims

1. Use of SMURF2 protein or its encoding gene as a target in the preparation of anti-tumor drugs, characterized in that: The anti-tumor drug has any of the following functions: (1) Reduce the protein activity of SMURF2 protein; (2) Knockout the gene encoding SMURF2 protein; (3) Gene interference to reduce the expression of the gene encoding SMURF2 protein.

2. The use according to claim 1, characterized in that: The tumor type was colon cancer.

3. Use of the compound in the preparation of anti-tumor drugs, characterized in that: The compound has any of the following functions: (1) Reduce the protein activity of SMURF2 protein; (2) Knockout the gene encoding SMURF2 protein; (3) Gene interference to reduce the expression of the gene encoding SMURF2 protein.

4. The use according to claim 3, characterized in that: The compound is any one of the following: (1) Small molecule compounds, monoclonal antibodies or nucleic acid aptamers that target SMURF2 protein and reduce the activity of SMURF2 protein; (2) a gene knockout sequence for knocking out the gene encoding the SMURF2 protein; (3) siRNA for reducing the expression of a gene encoding SMURF2 protein or a sequence for expressing siRNA.

5. The use according to claim 3 or 4, characterized in that: The tumor type was colon cancer.

6. The use according to claim 3 or 4, characterized in that: The anti-tumor drug is used in combination with an immune checkpoint inhibitor.

7. The use according to claim 6, characterized in that: The immune checkpoint inhibitor is an anti-PD-1 monoclonal antibody.

8. An anti-tumor drug, characterized in that: The active ingredients include compound 1 and compound 2, wherein compound 1 is any one of the following: (1) Small molecule compounds, monoclonal antibodies or nucleic acid aptamers that target SMURF2 protein and reduce the activity of SMURF2 protein; (2) a gene knockout sequence for knocking out the gene encoding the SMURF2 protein; (3) siRNA for reducing the expression of the gene encoding SMURF2 protein or a sequence for expressing siRNA; Compound 2 is an immune checkpoint inhibitor.

9. The anti-tumor drug according to claim 8, characterized in that: The immune checkpoint inhibitor is an anti-PD-1 monoclonal antibody.

Images