Use of SMURF2 protein or its encoding gene as a target in the preparation of anti-tumor drugs

By reducing SMURF2 expression and inhibiting PD-L1 expression, the problem of tumor immune escape was solved, the effect of anti-PD-1 blocking strategy was enhanced, and new ideas were provided for anti-tumor treatment.

CN119916024BActive Publication Date: 2025-06-17ZHEJIANG UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510409778.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-02
Publication Date
2025-06-17
Estimated Expiration
2045-04-02

AI Technical Summary

Technical Problem

Tumors avoid immune-mediated identification through immune escape mechanisms. The existing technology has not yet effectively solved the problem of SMURF2 regulating tumor immune escape.

Method used

By reducing the expression of SMURF2 molecules, the expression of PD-L1 is inhibited, thereby blocking tumor immune escape and enhancing the effect of anti-PD-1 blocking strategy.

Benefits of technology

It significantly inhibits tumor immune escape and enhances the efficacy of anti-PD-1 blocking strategy, providing new ideas and ways for anti-tumor treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119916024B_ABST
    Figure CN119916024B_ABST
Patent Text Reader

Abstract

The present invention discloses the use of SMURF2 protein or its encoding gene as a target in the preparation of anti-tumor drugs. The research of the present invention has found that reducing the content of E3 ubiquitin ligase SMURF2 in vivo helps to inhibit tumor immune escape and enhance the efficacy of anti-PD-1 blockade strategy. Therefore, the above-mentioned drug is a reagent for reducing the expression level of E3 ubiquitin ligase SMURF2 and is used to inhibit PD-1 / PD-L1-mediated tumor immune escape. When used for anti-tumor, it is preferably to inhibit the expression of PD-L1, thereby inhibiting tumor immune escape and improving the efficacy of anti-PD-1 blockade strategy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the application of SMURF2 protein or its encoding gene as a target in the preparation of anti-tumor drugs. Background Art

[0002] Tumors can evade immune-mediated recognition through multiple immune escape mechanisms. For example, after Programmed Cell Death Ligand 1 (PD-L1) binds to Programmed Cell Death Receptor 1 (PD-1), it can inhibit the activity of cytotoxic T cells. In the tumor microenvironment (TME), overexpression of PD-L1 on cancer cells leads to apoptosis or impaired activity of tumor-infiltrating T cells, resulting in immune escape (CHEN J, LI G, MENG H, et al. Upregulation of B7-H1 expression is associated with macrophage infiltration in hepatocellular carcinomas [J]. Cancer immunology, immunotherapy : CII, 2012, 61(1): 101-8.).

[0003] SMAD ubiquitin regulatory factor 2 (Smurf2) is a HECT-type E3 ubiquitin (Ub) ligase that can regulate the ubiquitination modification of multiple key intracellular proteins. There are reports (KLUPPF, GIESE C, HALAMA N, et al. E3 ubiquitin ligase Smurf2: a prognostic factor in microsatellite stable colorectal cancer [J]. Cancer management and research, 2019, 11: 1795-803.) that the expression of SMURF2 is upregulated in CRC specimens and affects survival according to the MSI status of patients. SMURF2 supports cancer cell migration and invasion, indicating that SMURF2 has carcinogenic functions. SMURF2 plays a decisive role in cell differentiation, proliferation and migration, and exhibits dual roles in cancer - as an oncogene and a tumor suppressor.

[0004] Recent articles reported (YU L, DONG L, WANG Y, et al. Reversible regulation of SATB1 ubiquitination by USP47 and SMURF2 mediates colon cancer cell proliferation and tumor progression [J]. Cancer letters, 2019, 448: 40-51.) that SMURF2 reduces aerobic glycolysis and colorectal cancer cell proliferation by promoting the ubiquitination and degradation of ChREBP. Although reports have shown that SMURF2 can reduce the proliferation of colorectal cancer cells, there have been no reports on the regulation of tumor immune escape by SMURF2. Summary of the Invention

[0005] The object of the present invention is to provide a new use of the E3 ubiquitin ligase SMURF2 and its application in anti-tumor drugs; another object of the present invention is to find new molecules that can effectively block tumor immune escape.

[0006] The inventors found through research that reducing the expression of the SMURF2 molecule can significantly inhibit the expression of PD-L1 in cells, thereby inhibiting tumor immune escape. It can be speculated from this that reducing the expression of the SMURF2 molecule can enhance the efficacy of anti-PD-1 blocking strategies and complete the present invention.

[0007] The present invention first provides the application of the SMURF2 protein or its coding gene as a target in the preparation of anti-tumor drugs, and the anti-tumor drugs have any one of the following functions:

[0008] (1) Reducing the protein activity of the SMURF2 protein;

[0009] (2) Knocking out the coding gene of the SMURF2 protein;

[0010] (3) Gene interference to reduce the expression of the coding gene of the SMURF2 protein.

[0011] Preferably, the tumor type is colon cancer.

[0012] The present invention also provides the application of a compound in the preparation of anti-tumor drugs, and the compound has any one of the following functions:

[0013] (1) Reducing the protein activity of the SMURF2 protein;

[0014] (2) Knocking out the coding gene of the SMURF2 protein;

[0015] (3)Gene interference to reduce the expression of the coding gene of SMURF2 protein.

[0016] Preferably, the compound is any one of the following:

[0017] (1)A small molecule compound, monoclonal antibody or nucleic acid aptamer that targets SMURF2 protein and reduces the activity of SMURF2 protein;

[0018] (2)A gene knockout sequence for knocking out the coding gene of SMURF2 protein;

[0019] (3)An siRNA for reducing the expression of the coding gene of SMURF2 protein or a sequence for expressing siRNA.

[0020] Preferably, the tumor type is colon cancer.

[0021] Preferably, the anti-tumor drug is used in combination with an immune checkpoint inhibitor. The immune checkpoint inhibitor is an anti-PD-1 monoclonal antibody.

[0022] The present invention also provides an anti-tumor drug, the active ingredient of which includes Compound 1 and Compound 2. Among them, Compound 1 is any one of the following:

[0023] (1)A small molecule compound, monoclonal antibody or nucleic acid aptamer that targets SMURF2 protein and reduces the activity of SMURF2 protein;

[0024] (2)A gene knockout sequence for knocking out the coding gene of SMURF2 protein;

[0025] (3)An siRNA for reducing the expression of the coding gene of SMURF2 protein or a sequence for expressing siRNA;

[0026] Compound 2 is an immune checkpoint inhibitor. Preferably, the immune checkpoint inhibitor is an anti-PD-1 monoclonal antibody.

[0027] In the present invention, for the gene knockout sequence for knocking out the coding gene of SMURF2 protein, the gene knockout sequence can be constructed by using the commonly used gene knockout methods in the prior art. For example, using the CRISPR Cas9 gene knockout method, in which an sgRNA sequence targeting the coding gene of SMURF2 protein needs to be designed and constructed into a plasmid or other forms for transgenic use.

[0028] The method for constructing a molecular recombinant expression vector containing a reduced SMURF2 content is as follows: Since the sgRNA sequence of the SMURF2 molecule is known in the art, those of ordinary skill in the art can prepare the primers for SMURF2 sgRNA based on conventional means or obtain them commercially; use a restriction endonuclease to obtain a linearized vector; under the action of a ligase, ligate the primers of the sgRNA with the linearized vector, screen the successfully ligated plasmids and perform sequencing identification. The correctly identified plasmids can be used for subsequent applications.

[0029] In the present invention, the siRNA for reducing the expression of the coding gene of the SMURF2 protein can be designed against the coding gene of the SMURF2 protein, and the siRNA can be directly synthesized and used, or the sequence for expressing the siRNA can be synthesized, such as in the form of shRNA, and a plasmid can be constructed and used. The plasmid expresses the siRNA sequence in vivo to achieve the gene interference effect.

[0030] The beneficial effects of the present invention:

[0031] The present invention discloses the application of the SMURF2 molecule in anti-tumor therapy drugs and tumor immune escape, providing new ideas and approaches for tumor immunotherapy based on immune checkpoint blockade, and having certain clinical application prospects.

[0032] The present invention's research finds that reducing the content of the E3 ubiquitin ligase SMURF2 in vivo helps to inhibit tumor immune escape and enhance the efficacy of the anti-PD-1 blockade strategy. Therefore, the above-mentioned drug is a reagent for reducing the expression level of the E3 ubiquitin ligase SMURF2, and is used to inhibit PD-1 / PD-L1-mediated tumor immune escape. When used for anti-tumor, it is preferably to inhibit the expression of PD-L1, thereby inhibiting tumor immune escape and improving the efficacy of the anti-PD-1 blockade strategy. Brief Description of the Drawings

[0033] Figure 1 For subcutaneous transplantation of Ctrl and Smurf2 KO CT26 (1×10 6 cells) into BALB / c mice, showing the tumor growth curve ( Figure 1 a in), the tumor weight ( Figure 1 b in), and representative tumor images ( Figure 1 c in). The results show the mean ± standard error (n≥4), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0034] Figure 2 For subcutaneous transplantation of Ctrl and Smurf2 KO MC38 cells (1×10 6 cells) into C57BL / 6 mice, showing the tumor growth curve (Figure 2 a) in Figure 2 b) and representative tumor images in Figure 2 c). Results are shown as mean ± SEM (n = 7), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0035] Figure 3 For subcutaneous transplantation of CT26 cells transfected with shCtrl and shSmurf2 into BALB / c mice, the tumor growth curves Figure 3 a) in Figure 3 b) and representative tumor images in Figure 3 c). Results are shown as mean ± SEM (n ≥ 6), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0036] Figure 4 For subcutaneous transplantation of MC38 cells transfected with shCtrl and shSmurf2 into C57BL / 6 mice, the tumor growth curves Figure 4 a) in Figure 4 b) and representative tumor images in Figure 4 c). Results are shown as mean ± SEM (n = 11), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0037] Figure 5 For subcutaneous transplantation of CT26 cells transfected with Ctrl, Smurf2 and Smurf2-C716A into BALB / c mice, the tumor growth curves Figure 5 a) in Figure 5 b) and representative tumor images in Figure 5 c). Results are shown as mean ± SEM (n ≥ 8), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0038] Figure 6 For knocking out Smurf2 in CT26 cells Figure 6 a) or MC38 cells Figure 6 b), after stimulation with interferon-γ for 0, 12, 24 hours, the expression levels of PD-L1 in tumor cells were detected by Western Blot. Results are shown as mean ± SEM (n ≥ 3), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0039] Figure 7 To silence Smurf2 in CT26 cells ( Figure 7 a) or MC38 cells ( Figure 7 b), after stimulation with interferon-γ for 0, 12, and 24 hours, the expression level of PD-L1 in tumor cells was detected by Western Blot. The results are shown as mean ± standard error (n≥3), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0040] Figure 8 To knockout Smurf2 in CT26 cells, after stimulation with interferon-γ for 0 and 12 hours, the expression level of PD-L1 on the surface of tumor cells was detected by flow cytometry. Among them, Figure 8 a in Figure 8 is the flow cytometry peak graph,

[0041] Figure 9 b in Figure 9 is the statistical graph of mean fluorescence intensity. The results are shown as mean ± standard error (n≥3), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Figure 9

[0042] Figure 10 Figure 10 To overexpress Smurf2 and Smurf2-C716A in CT26 cells, after stimulation with interferon-γ for 0 and 12 hours, the expression level of PD-L1 on the surface of tumor cells was detected by flow cytometry. Among them, Figure 10 a in is the flow cytometry peak graph,

[0043] Figure 11 b in Figure 11 6 BALB / c mice were implanted with 1×10 Figure 11in a), tumor weight ( Figure 11 in b) and representative tumor images ( Figure 11 in c). Results are shown as mean ± SEM (n≥6), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0044] Figure 12 For C57BL / 6 mice implanted with 1×10 6 Ctrl or Smurf2 KO MC38 tumor cells, anti-PD-1 monoclonal antibody or anti-IgG isotype control IgG2ɑ was intraperitoneally injected every 3 days starting 7 days after cell implantation. Tumor growth curves of tumors ( Figure 12 in a), tumor weight ( Figure 12 in b) and representative tumor images ( Figure 12 in c). Results are shown as mean ± SEM (n≥6), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Detailed implementation methods

[0045] The reagents and raw materials used in the present invention are all commercially available or can be prepared according to the methods in the literature. For the experimental methods without specific conditions indicated in the following examples, they are usually carried out under conventional conditions such as those described in "Molecular Cloning: A Laboratory Manual" by Sambrook et al. (New York: Cold Spring Harbor Laboratory Press, 1989), or under conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are calculated by volume.

[0046] Example 1: Smurf2 promotes the growth of tumors in immune mice

[0047] The following primers were all synthesized by Shanghai Jierui Biotechnology Co., Ltd., and the specific sequences are as follows:

[0048] Smurf2 gRNA upstream primer: CACCGACTCCTCCAGACCTACCGGA;

[0049] Smurf2 gRNA downstream primer: AAACTCCGGTAGGTCTGGAGGAGTC.

[0050] shSmurf2 upstream primer: CCGGAATCCGGAACATTTATCCTATCTCGAGATAGGATAAATGTTCCGGATTTTTTTG;

[0051] shSmurf2 downstream primer: AATTCAAAAAAATCCGGAACATTTATCCTATCTCGAGATAGGATAAATGTTCCGGATT.

[0052]

[0053] Smurf2-C716A is the mutation of cysteine at position 716 of Smurf2 to alanine.

[0054] (1) CT26 or MC38 cell lines with Smurf2 KO:

[0055] Purchase the primers for Smurf2 gRNA (Smurf2 gRNA upstream primer and Smurf2 gRNA downstream primer) commercially; obtain the linearized LentiCRISPRv2 vector with GFP fluorescence using the restriction enzyme BsmBI; under the action of ligase, ligate the primers of gRNA (forming a double strand after annealing of a pair of primers) with the linearized vector, screen the successfully ligated plasmids and perform sequencing identification. Transfect the successfully ligated plasmids into CT26 or MC38 cells, and after 24 to 48 hours, screen the cells with GFP green fluorescence by flow sorting technology and seed them into 96-well plates, 1 cell per well, and culture them in an incubator at 37°C and 5% CO2. After 1 - 2 weeks, take some cells from each well and detect the expression of Smurf2 protein by Western Blot technology, and expand the cells without Smurf2 protein expression for culture.

[0056] (2) CT26 or MC38 cell lines with shSmurf2:

[0057] Purchase the primers for shSmurf2 (shSmurf2 upstream primer and shSmurf2 downstream primer) commercially; obtain the linearized pLKO.1-TRC vector with puromycin resistance using the restriction enzymes AgeI and EcoRI; under the action of ligase, ligate the primers of shSmurf2 (forming a double strand after annealing of a pair of primers) with the linearized vector, screen the successfully ligated plasmids and perform sequencing identification. Transfect the successfully ligated plasmids into CT26 or MC38 cells, and after 24 to 48 hours, add 6 μg / ml or 2 μg / ml of puromycin and culture them in an incubator at 37°C and 5% CO2. After 3 days, take some cells from each well and detect the expression of Smurf2 protein by Western Blot technology, and expand the cells with reduced Smurf2 protein expression for culture.

[0058] (3) CT26 or MC38 cell lines overexpressing Smurf2 and Smurf2-C716A:

[0059] Amplify the primers for Smurf2 or Smurf2-C716A cDNA commercially; obtain the linearized vector using restriction enzymes; amplify Smurf2 or Smurf2-C716A cDNA by PCR (the gene sequence was artificially synthesized and cloned into a plasmid by a gene synthesis company), and obtain the same sticky ends as the expression vector by enzymatic digestion; under the action of ligase, ligate the cDNA with the linearized vector, screen the successfully ligated plasmids and perform sequencing identification. Transfect the successfully ligated plasmids into CT26 or MC38 cells, add 6 μg / ml or 2 μg / ml puromycin after 24 to 48 hours and culture them in an incubator at 37°C and 5% CO2. After 3 days, take some cells from each well and detect the expression of Smurf2 protein by Western Blot technology, and expand the cells with increased Smurf2 protein expression for culture.

[0060] (4)BALB / C or C57BL / 6 mice were purchased from Hangzhou Hangs Biotechnology Co., Ltd. Mice at 6 - 8 weeks of age were selected for the experiment. All mice were raised under specific pathogen-free conditions. Subcutaneously inject the mouse colon cancer cells CT26 or MC38 cells (1×10 6 cells per injection) treated in the above steps into BALB / C or C57BL / 6 mice, measure the long and short dimensions of the tumor using a digital caliper, and record the tumor volume with the formula V = W × L 2 ×0.5, where W is the maximum tumor diameter in centimeters and L is the second largest tumor diameter. Collect tumor tissues for weight measurement and further analysis.

[0061] The results are as Figures 1 - 5 shown:

[0062] Inoculate mouse WT or Smurf2 KO CT26 cells into BALB / c mice, subcutaneously inoculate the cells on the back of the mice, measure the tumor size of the mice using a vernier caliper 7 days later, measure it every two days, and sacrifice the mice around 19 days to take the subcutaneous tumors for weighing. As Figure 1 shown, the tumor growth curve ( Figure 1 a in), tumor weight ( Figure 1 b in), and tumor size ( Figure 1 c in) of the Smurf2 gene knockout group decreased sharply.

[0063] Similarly, inoculate mouse WT or Smurf2 KO MC38 cells into C57BL / 6 mice, measure the tumor size of the mice using a vernier caliper 7 days later, measure it every two days, and sacrifice the mice around 19 days to take the subcutaneous tumors for weighing. As Figure 2 shown, the tumor growth curve ( Figure 2in a), tumor weight ( Figure 2 in b), and tumor size ( Figure 2 in c) decreased sharply.

[0064] To further expand the above concept, the constructed shRNA-mediated Smurf2 knockdown cells were subcutaneously implanted with tumors. Mouse control cells or shSmurf2 CT26 cells were inoculated into BALB / c mice. Seven days later, the tumor size of the mice was measured using a vernier caliper, measured every two days, and the mice were sacrificed around 21 days to remove the subcutaneous tumors for weighing. As Figure 3 shown, the tumor growth curve ( Figure 3 in a), tumor weight ( Figure 3 in b), and tumor size ( Figure 3 in c) of the Smurf2 gene knockdown group decreased sharply.

[0065] Similarly, mouse control cells or shSmurf2 MC38 cells were inoculated into C57BL / 6 mice. Seven days later, the tumor size of the mice was measured using a vernier caliper, measured every two days, and the mice were sacrificed around 15 days to remove the subcutaneous tumors for weighing. As Figure 4 shown, the tumor growth curve ( Figure 4 in a), tumor weight ( Figure 4 in b), and tumor size ( Figure 4 in c) of the Smurf2 gene knockdown group decreased sharply.

[0066] In addition, mouse control cells, CT26 cells overexpressing Smurf2 or overexpressing Smurf2-C716A were inoculated into BALB / c mice. Seven days later, the tumor size of the mice was measured using a vernier caliper, measured every two days, and the mice were sacrificed around 14 days to remove the subcutaneous tumors for weighing. As Figure 5 shown, the tumor growth curve ( Figure 5 in a), tumor weight ( Figure 5 in b), and tumor size ( Figure 5 in c) of the Smurf2 gene knockdown group decreased sharply.

[0067] The above results indicate that: knockout or knockdown of the Smurf2 gene can inhibit the growth of tumors in immunocompetent mice, and elevation of the Smurf2 gene can promote the growth of tumors in immunocompetent mice.

[0068] Example 2: Verify that Smurf2 promotes the expression of PD-L1 in tumor cells, thereby promoting tumor immune escape

[0069] The following primers were synthesized by Suzhou GenePharma Co., Ltd., and the specific sequences are as follows:

[0070] Smurf2 siRNA forward primer: GAGAAGGAGCUGGAGCUCAUUAUUU;

[0071] Smurf2 siRNA reverse primer: AAAUAAUGAGCUCCAGCUCCUUCUC.

[0072] (1)Detection of the expression of Smurf2 and PD-L1 in CT26 and MC38 tumor cells by Western Blot: Cells were collected after being stimulated with interferon-γ for 0, 12, and 24 hours, and Western Blot experiments were performed.

[0073] Among them, interferon-γ (Z02916) was purchased from GenScript, and the concentration used was 80 ng / ml.

[0074] Catalog numbers and sources of antibodies used in Western Blot: Smurf2 (D8B8) was purchased from Cell Signaling Technology, and PD-L1 (D4H1Z) was purchased from Cell Signaling Technology.

[0075] (2)Detection of the expression of PD-L1 on the surface of CT26 tumor cells by flow cytometry: Cells were collected after being stimulated with interferon-γ for 0, 12, and 24 hours. The cells were stained with the flow antibody of PE / Cyanine 7 CD274 at a ratio of 1:400 in the dark at room temperature. After 15 minutes, 500 μl of PBS (pH 7.2 - 7.4) was added, and the cells were centrifuged at 5000 rpm for 5 minutes at 4°C. After washing off the antibody, the cells were resuspended with PBS according to the cell amount and then detected for the expression of PD-L1 on the surface of tumor cells by flow cytometry.

[0076] Catalog numbers and sources of antibodies used in flow cytometry: PE / Cyanine 7 CD274 (124314) was purchased from BioLegend.

[0077] (3)Gene silencing: CT26 cells were evenly plated in a culture plate (taking a 24-well plate as an example, 50,000 - 100,000 cells per well). After the cells were completely adherent, the interference mix was added. The specific dosage per well was as follows:

[0078] Interference mix: 50 μl of opti-MEM medium + 0.3 - 0.6 μl of 10 μM siRNA + 6 times the amount of siRNA of INTERFERin;

[0079] INTERFERin was purchased from Polyplus (101000028).

[0080] The results were as Figures 6 - 10 shown:

[0081] The constructed Smurf2 KO CT26 cells or MC38 cells and control cells were seeded into 24-well plates. After the cells were completely adherent, interferon-γ was added respectively, and the cells were collected after stimulation for 0, 12, and 24 hours, followed by Western Blot assay. As Figure 6 shown, compared with the control group cells, the expression of PD-L1 in Smurf2 KO CT26 cells ( Figure 6 a in Figure 6 ) and MC38 cells (

[0082] b in Figure 7 ) was significantly decreased under IFN-γ stimulation. Figure 7 Figure 7 Figure 7 b in

[0083] The constructed Smurf2 KO CT26 cells and control cells were seeded into 24-well plates. After the cells were completely adherent, interferon-γ was added respectively, and the cells were collected after stimulation for 0 and 12 hours, followed by flow cytometry. As Figure 8 shown, compared with the control group cells, the expression of cell surface PD-L1 in Smurf2 KO CT26 cells was significantly decreased under IFN-γ stimulation, Figure 8 a in Figure 8 is the flow cytometry peak graph,

[0084] CT26 cells were seeded into 24-well plates. After the cells were completely adherent, Smurf2 was silenced in the cells for 24 - 48 hours, and then interferon-γ was added respectively, and the cells were collected after stimulation for 0 and 12 hours, followed by flow cytometry. As Figure 9 shown, compared with the control group cells, the expression of cell surface PD-L1 in Smurf2-silenced CT26 cells was significantly decreased under IFN-γ stimulation, Figure 9 a in Figure 9 is the flow cytometry peak graph,

[0085] The constructed CT26 cells overexpressing Smurf2 and Smurf2-C716A and the control cells were seeded into 24-well plates. After the cells were completely adherent, they were stimulated with interferon-γ for 0 and 12 hours respectively, and then the cells were collected for flow cytometry. As Figure 10 shown, compared with the control group cells, the expression of cell surface PD-L1 on CT26 cells in the Smurf2-silenced group was significantly decreased under IFN-γ stimulation, Figure 10 where a in Figure 10 is the flow cytometry peak graph,

[0086] and b in

[0087] is the statistical graph of mean fluorescence intensity.

[0088] The treated CT26 or MC38 cells (1×10 6 cells) were subcutaneously injected into BALB / C or C57BL / 6 mice. The long and short dimensions of the tumors were measured using a digital caliper, and the tumor volume was recorded using the formula V = W×L 2 ×0.5, where W is the maximum tumor diameter in centimeters and L is the second largest tumor diameter. Seven days after implanting the cells, anti-PD-1 monoclonal antibody or anti-IgG isotype control IgG2ɑ was intraperitoneally injected every 3 days.

[0089] Among them, the anti-PD-L1 monoclonal antibody (A2122) and the anti-IgG monoclonal antibody (A3123) were purchased from Selleck.

[0090] The results were as Figures 11 - 12 shown:

[0091] Mouse WT or Smurf2 KO CT26 cells were inoculated into BALB / c mice. Seven days after the cells were subcutaneously inoculated onto the backs of the mice, anti-PD-1 monoclonal antibody or anti-IgG monoclonal antibody was intraperitoneally injected into BALB / c mice inoculated with Smurf2 knockout CT26 tumor cells (Smurf2 KO) or wild-type control (WT), once every 3 days. The tumor size of the mice was measured using a vernier caliper, once every two days, and the mice were sacrificed around 15 days to remove the subcutaneous tumors for weighing. As Figure 11 shown, compared with the control group mice intraperitoneally injected with anti-PD-1 monoclonal antibody, the tumor growth curve ( Figure 11 a in Figure 11in b) and tumor size ( Figure 11 in c) decreased sharply.

[0092] Mouse WT or Smurf2 KO MC38 cells were inoculated into C57BL / 6 mice. Seven days after subcutaneous inoculation of the cells into the back of the mice, anti-PD-1 monoclonal antibody or anti-IgG monoclonal antibody was intraperitoneally injected into BALB / c mice inoculated with Smurf2 knockout MC38 tumor cells (Smurf2 KO) or wild-type control (WT) every 3 days. The tumor size of the mice was measured using vernier calipers every two days. The mice were sacrificed around 15 days to obtain subcutaneous tumors for weighing. As Figure 12 shown, compared with the control group of mice intraperitoneally injected with anti-PD-1 monoclonal antibody, the tumor growth curve ( Figure 12 in a), tumor weight ( Figure 12 in b) and tumor size ( Figure 12 in c) of the Smurf2 KO group of mice intraperitoneally injected with anti-PD-1 monoclonal antibody decreased sharply.

[0093] The above results indicate that Smurf2 gene knockout or knockdown can inhibit the growth of tumors in immunocompetent mice, and at the same time, enhance the efficacy of anti-PD-1 blocking strategies.

[0094] From the above experiments, it can be seen that PD-L1, as an important immune checkpoint, overexpression in the tumor immune microenvironment will lead to apoptosis or impaired activity of tumor-infiltrating T cells, resulting in tumor immune escape. Accordingly, it can be clearly inferred that when the body's tumor cells expand, reducing the expression level of SMURF2 in the body can effectively avoid tumor immune escape and thus protect the body.

[0095] In summary, the increase of the index SMURF2 involved in the present invention in tumor tissues is closely related to the tumor immune microenvironment. The occurrence and development degree of tumor patients can be assisted in diagnosis by detecting the SMURF2 gene and protein content in the tumor tissues of patients, and the expression level of SMURF2 in patients can be specifically reduced according to the detection results for anti-tumor immune escape treatment.

[0096] Therefore, the present invention discloses the application of SMURF2 molecules in anti-tumor therapy drugs and tumor immune escape, providing new ideas and ways for tumor immunotherapy based on immune checkpoint blockade, and having certain clinical application prospects.

Claims

1. Use of a compound in combination with an immune checkpoint inhibitor in the preparation of an anti-tumor drug, characterized in that: The compound has any of the following functions: (1) Reduce the protein activity of SMURF2 protein; (2) Knockout the gene encoding SMURF2 protein; (3) Gene interference to reduce the expression of the gene encoding SMURF2 protein; The immune checkpoint inhibitor is an anti-PD-1 monoclonal antibody; The tumor type was colon cancer.

2. The use according to claim 1, characterized in that: The compound is any one of the following: (1) Small molecule compounds, monoclonal antibodies or nucleic acid aptamers that target SMURF2 protein and reduce the activity of SMURF2 protein; (2) a gene knockout sequence for knocking out the gene encoding the SMURF2 protein; (3) siRNA for reducing the expression of a gene encoding SMURF2 protein or a sequence for expressing siRNA.

3. An anti-tumor drug, characterized in that: The active ingredients include compound 1 and compound 2, wherein compound 1 is any one of the following: (1) Small molecule compounds, monoclonal antibodies or nucleic acid aptamers that target SMURF2 protein and reduce the activity of SMURF2 protein; (2) a gene knockout sequence for knocking out the gene encoding the SMURF2 protein; (3) siRNA for reducing the expression of the gene encoding SMURF2 protein or a sequence for expressing siRNA; Compound 2 is an immune checkpoint inhibitor, which is an anti-PD-1 monoclonal antibody.

Citation Information

Patent Citations

  • Pharmaceutical composition for resisting tumors

    CN117257962A